RESUMEN
BACKGROUND: Advances in medical imaging have made it possible to classify ankle fractures using Artificial Intelligence (AI). Recent studies have demonstrated good internal validity for machine learning algorithms using the AO/OTA 2018 classification. This study aimed to externally validate one such model for ankle fracture classification and ways to improve external validity. METHODS: In this retrospective observation study, we trained a deep-learning neural network (7,500 ankle studies) to classify traumatic malleolar fractures according to the AO/OTA classification. Our internal validation dataset (IVD) contained 409 studies collected from Danderyd Hospital in Stockholm, Sweden, between 2002 and 2016. The external validation dataset (EVD) contained 399 studies collected from Flinders Medical Centre, Adelaide, Australia, between 2016 and 2020. Our primary outcome measures were the area under the receiver operating characteristic (AUC) and the area under the precision-recall curve (AUPR) for fracture classification of AO/OTA malleolar (44) fractures. Secondary outcomes were performance on other fractures visible on ankle radiographs and inter-observer reliability of reviewers. RESULTS: Compared to the weighted mean AUC (wAUC) 0.86 (95%CI 0.82-0.89) for fracture detection in the EVD, the network attained wAUC 0.95 (95%CI 0.94-0.97) for the IVD. The area under the precision-recall curve (AUPR) was 0.93 vs. 0.96. The wAUC for individual outcomes (type 44A-C, group 44A1-C3, and subgroup 44A1.1-C3.3) was 0.82 for the EVD and 0.93 for the IVD. The weighted mean AUPR (wAUPR) was 0.59 vs 0.63. Throughout, the performance was superior to that of a random classifier for the EVD. CONCLUSION: Although the two datasets had considerable differences, the model transferred well to the EVD and the alternative clinical scenario it represents. The direct clinical implications of this study are that algorithms developed elsewhere need local validation and that discrepancies can be rectified using targeted training. In a wider sense, we believe this opens up possibilities for building advanced treatment recommendations based on exact fracture types that are more objective than current clinical decisions, often influenced by who is present during rounds.
Asunto(s)
Fracturas de Tobillo , Aprendizaje Profundo , Humanos , Fracturas de Tobillo/clasificación , Fracturas de Tobillo/diagnóstico por imagen , Estudios Retrospectivos , Reproducibilidad de los Resultados , Masculino , Femenino , Inteligencia Artificial , Radiografía , Adulto , Persona de Mediana Edad , SueciaRESUMEN
We report a rare case of large facial hyperpigmentation in a 25-year-old female. Starting one month after birth, the patient developed a blue-brown patch on the right side of her face, interspersed with black macules and papules. As she aged, the lesion progressively enlarged and darkened, eventually covering the entire right side of her face. Dermoscopic and reflectance confocal microscopy examinations indicated nevus spilus in some areas and Nevus of Ota in others, leading to a definitive diagnosis of overlapping nevus spilus and Nevus of Ota. With no signs of malignant transformation on clinical or imaging examination, successful treatment was achieved using Q-switched alexandrite laser without any adverse effects. Our case underscores the critical value of dermoscopy and reflectance confocal microscopy in diagnosing rare facial pigmentary conditions, as we compare the imaging characteristics of nevus spilus, nevus of Ota, and similar conditions, alongside their clinical and histopathological correlations. Furthermore, our findings highlight the significant role of imaging examinations in monitoring malignancy and guiding treatment decisions.
RESUMEN
In this paper, a rail-to-rail transconductance stable and enhanced ultra-low-voltage operational transconductance amplifier (OTA) is proposed for electrocardiogram (ECG) signal processing. The variation regularity of the bulk transconductance of pMOS and nMOS transistors and the cancellation mechanism of two types of transconductance variations are revealed. On this basis, a transconductance stabilization and enhancement technique is proposed. By using the "current-reused and transconductance-boosted complementary bulk-driven pseudo-differential pairs" structure, the bulk-driven pseudo-differential pair during the input common-mode range (ICMR) is stabilized and enhanced. The proposed OTA based on this technology is simulated using the TSMC 0.18 µm process in a Cadence environment. The proposed OTA consumes a power below 30 nW at a 0.4 V voltage supply with a DC gain of 54.9 dB and a gain-bandwidth product (GBW) of 14.4 kHz under a 15 pF capacitance load. The OTA has a high small signal figure-of-merit (FoM) of 7410 and excellent common-mode voltage (VCM) stability, with a transconductance variation of about 1.35%. Based on a current-scaling version of the proposed OTA, an OTA-C low-pass filter (LPF) for ECG signal processing with VCM stability is built and simulated. With a -3 dB bandwidth of 250 Hz and a power consumption of 20.23 nW, the filter achieves a FoM of 3.41 × 10-13, demonstrating good performance.
RESUMEN
OBJECTIVES: Aim of this work was the evaluation and validation of the AO/OTA classification of the anterior chest wall, here especially for the rib cartilage. METHODS: Study design was a retrospective analysis of patients who were hospitalized with fractures of the thoracic wall in the years 2010-2016. This resulted in a collective of n = 124 patients. All fractures of the anterior chest wall were classified according to their location, dislocation and fracture type according to the AO classification. An analysis of possible subtypes was carried out. RESULTS: 29.0% (36) of the patients had fractures of the rib cartilage. 23 of the 36 (64%) patients had multiple fractures, the total number of single fractures amounted to 94. 53.2% (50) of these fractures were in the right hemithorax, 46.8% (44) in the left hemithorax. 95.7% (90) of the fractures were A-fractures, 4.3% (4) were C-fractures. There were no B fractures. The C fractures also consisted exclusively of A fractures (AA fractures). 59.6% (56) of the fractures showed a dislocation. 30.9% (29) were avulsion fractures of either the osteochondral (22.3% (21)) or the sternocostal junction (8.5% (8)). DISCUSSION AND CONCLUSION: The costal cartilage obviously does not show typical B fractures as we know them from shaft fractures of long bones. We have compiled a structured analysis in the attached manuscript and validated the classification proposal. In conclusion, we propose an adaptation of the classification proposal based on our data with redefining type B fractures as fractures of the osteochondral joints.
RESUMEN
INTRODUCTION: Ochratoxins (OTs) are worldwide regulated mycotoxins contaminating a variety of food-environment and agro-environment. Several Aspergillus and Pencillium species synthesize OTs from a six-gene biosynthetic gene cluster (BGC) to produce the highly toxic final product OTA. Although many studies on OTA-degrading enzymes were performed, high efficiency enzymes with strong stability are extremely needed, and the OTA degrading mechanism is poorly understood. OBJECTIVES: The study aimed to explore the OT-degradation enzyme and investigate its degradation mechanisms in Metarhizium, which contain an OT biosynthetic gene cluster. METHODS: Phylogenomic relationship combined with RNA expression analysis were used to explore the distribution of OT BGC in fungi. Bioactivity-guided isolation and protein mass spectrometry were conducted to trace the degrading enzymes in Metarhizium spp., and the enzymes were heterologously expressed in E. coli and verified by in vitro assays. Structure prediction and point mutation were performed to reveal the catalytic mechanism of MbAmh1. RESULTS: Beyond Aspergillus and Pencillium species, three species of the distant phylogenetic taxon Metarhizium contain an expressed OT-like BGC but lack an otaD gene. Unexpectedly, no OT BGC products were found in some Metarhizium species. Instead, Metarhizium metabolized both OTA and OTB to their non-toxic degradation products. This activity of M. brunneum was attributed to an intracellular hydrolase MbAmh1, which was tracked by bioactivity-guided proteomic analysis combined with in vitro reaction. Recombinant MbAmh1 (5 µg/mL) completely degraded 1 µg/mL OTA within 3 min, demonstrating a strong degrading ability towards OTA. Additionally, MbAmh1 showed considerable temperature adaptability ranging from 30 to 70 °C and acidic pH stability ranging from 4.0 to 7.0. Identification of active sites supported the crucial role of metal iron for this enzymatic reaction. CONCLUSION: These findings reveal different patterns of OT synthesis in fungi and provide a potential OTA degrading enzyme for industrial applications.
RESUMEN
A GPE-PET (graphene-polyethylene terephthalate) bipolar electrode-electrochemiluminescence (BPE-ECL) platform was developed for ochratoxin A (OTA) detection. PET served as the electrode sheet substrate, and GPE was drop-coated onto the surface of PET to form a conductive line. On the functional sensing interface, the thiol (-SH) modified OTA aptamer (OTA-Aptamer) are fixed on the surface of the gold-plated cathode through AuS bonds. The efficient electron transfer ability of methylene blue (MB) made the anode ECL signal strong. Due to competition between OTA and MB with OTA-Aptamer, leading to a decrease in ECL intensity of the [Ru(bpy)3]2+/TPA system on the BPE anode. Under optimized conditions, the GPE-PET BPE-ECL biosensor displayed superior sensitivity for OTA with a detection limit of 2 ng mL-1 and a wide linear concentration range of 5-100 ng mL-1. This method could be further applied to detect various toxins and had broad application prospects.
Asunto(s)
Técnicas Biosensibles , Técnicas Electroquímicas , Electrodos , Mediciones Luminiscentes , Ocratoxinas , Ocratoxinas/análisis , Técnicas Biosensibles/instrumentación , Mediciones Luminiscentes/instrumentación , Mediciones Luminiscentes/métodos , Técnicas Electroquímicas/instrumentación , Grafito/química , Contaminación de Alimentos/análisis , Tereftalatos Polietilenos/química , Límite de DetecciónRESUMEN
Aspergillus carbonarius causes severe decays on berries in vineyards and is among the main fungal species responsible for grape contamination by ochratoxin A (OTA), which is the foremost mycotoxin produced by this fungus. The main goal of this study was to investigate at the transcriptome level the comparative profiles between two table grape varieties (Victoria and Fraoula, the white and red variety, respectively) after their inoculation with a virulent OTA-producing A. carbonarius strain. The two varieties revealed quite different transcriptomic signatures and the expression profiles of the differential expressed genes (DEGs) highlighted distinct and variety-specific responses during the infection period. The significant enrichment of pathways related to the modulation of transcriptional dynamics towards the activation of defence responses, the triggering of the metabolic shunt for the biosynthesis of secondary metabolites, mainly phenylpropanoids, and the upregulation of DEGs encoding phytoalexins, transcription factors, and genes involved in plant-pathogen interaction and immune signaling transduction was revealed in an early time point in Fraoula, whereas, in Victoria, any transcriptional reprogramming was observed after a delay. However, both varieties, to some extent, also showed common expression dynamics for specific DEG families, such as those encoding for laccases and stilbene synthases. Jasmonate (JA) may play a critical modulator role in the defence machinery as various JA-biosynthetic DEGs were upregulated. Along with the broader modulation of the transcriptome that was observed in white grape, expression profiles of specific A. carbonarius genes related to pathogenesis, fungal sporulation, and conidiation highlight the higher susceptibility of Victoria. Furthermore, the A. carbonarius transcriptional patterns directly associated with the regulation of the pathogen OTA-biosynthesis gene cluster were more highly induced in Victoria than in Fraoula. The latter was less contaminated by OTA and showed substantially lower sporulation. These findings contribute to uncovering the interplay beyond this plant-microbe interaction.
RESUMEN
BACKGROUND: The picosecond neodymium yttrium aluminum garnet laser (PNYL) has been successfully used in treating acquired bilateral nevus of Ota-like macules (ABNOM). The 730-nm picosecond titanium sapphire laser (PTSL) is an emerging tool for pigmentary disorders. However, no studies have compared two different wavelengths of picosecond laser for the treatment of ABNOM. AIMS: To compare the efficacy and safety of the 730-nm PTSL with the 1064-nm PNYL in the treatment of ABNOM. METHODS: Fifteen participants with ABNOM were randomized to undergo a single session of either the 730-nm PTSL on one side of the face and 1064-nm PNYL on the other side. Efficacy and safety assessments were performed by blinded visual evaluations at baseline, 12 weeks, and 24 weeks posttreatment. Participants' satisfaction and adverse effects were recorded. RESULTS: Compared to baseline, The 730-nm PTSL-treated side showed better improvement than that of the 1064-nm PNYL-treated side at 24 weeks posttreatment (1.67 ± 1.047 vs. 0.87 ± 0.640, p = 0.027). There were no significant differences in pain sensation and participants' satisfaction between the two laser treatments. CONCLUSIONS: The 730-nm PTSL is more effective than the 1064-nm PNYL in the treatment of ABNOM.
RESUMEN
Facial melanoses (FM) present complex diagnostic and therapeutic challenges, particularly in the setting of dermal melanocytoses (DM). We present a case that illustrates these challenges as it does not fit within existing classification frameworks. Initially considered as Ota nevus, characterized by blue or dark pigmentation and scleral involvement, histopathological findings suggested acquired bilateral nevus of Ota-like macules (ABNOM). While ABNOM, more common in Asians, rarely affects the sclera or children, recent studies indicate that it may be underdiagnosed in these groups. Differential diagnosis ruled out other FM causes due to mucosal involvement. Correct classification is essential for epidemiological accuracy and treatment decisions, especially given varying responses to Q-switched laser therapy and melanoma risks associated with Ota nevus and ABNOM. While the pathogenesis remains unclear, a two-hit model involving shared melanoma mutations in melanocytes has been proposed and warrants further molecular study.
RESUMEN
Dermal melanocytoses are a group of cutaneous disorders characterized by the presence of ectopic melanocytes in the dermis; the most well-known example is the Mongolian spot. Acquired dermal melanocytosis (ADM) is a term used to describe the onset of dermal melanocytosis occurring after its usual age of presentation (i.e., birth and infancy). ADMs usually occur on the face and can less commonly affect extrafacial sites, such as the back and limbs. Purely extrafacial ADM is extremely uncommon and, when present, is usually unifocal. Herein, we present an exceptionally rare example of purely extrafacial ADM with extensive bilateral involvement in a 44-year-old female originally from the Philippines.
RESUMEN
Ochratoxin A (OTA) induces kidney damage in animals and humans. Ferroptosis is an iron-dependent form of regulated cell death that is involved in OTA-induced kidney injury. Quercetin (QCT), which is commonly found in numerous fruit and vegetables, has extensive pharmacological properties, such as anti-oxidant and anti-inflammatory. The present study aimed to evaluate the effects of QCT on OTA-induced kidney damage and the associated ferroptosis mechanism in mice. The results showed that OTA induced kidney damage, as demonstrated by the presence of kidney histopathological lesions, increased serum BUN and CRE levels, mRNA levels of Ntn1, Kim1, Tnfa, Ilb and Il6, and immunofluorescence of TNFα. OTA induced lipid peroxidation and ferroptosis by increasing the MDA level, 4-HNE production, and the iron concentration, decreasing the GSH content, increasing ACSL4 and HO-1 mRNA and protein levels, and decreasing GPX4 mRNA and protein levels. QCT supplementation alleviated OTA-induced kidney damage and inhibited OTA-induced lipid peroxidation and ferroptosis by reversing the OTA-induced above changes. Erastin weakened the protective effects of QCT on the histopathological damage, renal function, and inflammation induced by OTA. These findings indicated that QCT alleviated OTA-induced kidney injury through ferroptosis, suggesting that QCT might serve as a feed additive in mycotoxin contamination environments.
Asunto(s)
Ferroptosis , Riñón , Peroxidación de Lípido , Ocratoxinas , Quercetina , Ocratoxinas/toxicidad , Animales , Ferroptosis/efectos de los fármacos , Quercetina/farmacología , Ratones , Masculino , Riñón/efectos de los fármacos , Riñón/patología , Riñón/metabolismo , Peroxidación de Lípido/efectos de los fármacos , Enfermedades Renales/inducido químicamente , Enfermedades Renales/metabolismo , Enfermedades Renales/tratamiento farmacológico , Enfermedades Renales/prevención & control , Receptor Celular 1 del Virus de la Hepatitis A/metabolismo , Antioxidantes/farmacologíaRESUMEN
Background and Objective: Nevus of Ota (NO), also known as "brownish-blue nevus of the palate of the eye", is a benign dermal pigmentation that increases skin disease. The Q-switched ruby laser is a classic treatment for nevus of Ota in children, but the optimal age for treatment is still controversial. The aim of this study was to investigate the treatment effect of Q-switched ruby laser in children with nevus of Ota at different ages and the effect on psychological health status. Materials and Methods: Children with nevus of Ota treated with Q-switched ruby laser in the Department of Dermatology of the Second Affiliated Hospital of Wenzhou Medical University from June 2015 to June 2019 were retrospectively analysed. And the mental health status was assessed using the CDI scale. Results: In the preschool children group (0-7 year age), the significant efficacy rates was 93.1%, the average number of treatments was 3.6, and the overall incidence of adverse reactions was 4.7%. The significant efficacy rates in the school-age children group (7-14 year age) was 90.3%, the average number of treatments was 5.1, and the overall incidence of adverse reactions was 13.7%. The mean post-treatment CDI score in the preschool children group was 10.8, and 9.7% of children exceeding 19 points. The mean pre-treatment CDI score in the school-age children group was 17.3, and 24.6% of children exceeding 19 points. The mean post-treatment CDI score was 13.6 and 15.1% of children exceeded 19 points. The chi-square test for the significant efficacy rate of the two groups showed P>0.05, which was not statistically significant. The significant efficacy rate of the preschool group and that of the school-age children group. The t-test for the number of treatments in the two groups showed P<0.05, which was statistically significant. Adverse reactions in the two groups showed a statistically significant P<0.05. The mean CDI scores and the percentage of depressed individuals in the school-age children group were significantly lower after treatment than before treatment (p<0.05). Conclusion: Q-switched ruby laser is safe and effective in treating nevus of Ota in children. Early treatment can reduce the number of treatments and the incidence of adverse reactions. In addition, early treatment can reduce children's depression, which is beneficial to mental health.
RESUMEN
Organisms maintain their cellular homeostatic balance by interacting with their environment through the use of their cell surface receptors. Membrane based receptors such as the transforming growth factor ß receptor (TGFR), the prolactin receptor (PRLR), and hepatocyte growth factor receptor (HGFR), along with their associated signaling cascade, play significant roles in retaining cellular homeostasis. While these receptors and related signaling pathways are essential for health of cell and organism, their dysregulation can lead to imbalance in cell function with severe pathological conditions such as cell death or cancer. Ochratoxin A (OTA) can disrupt cellular homeostasis by altering expression levels of these receptors and/or receptor-associated intracellular downstream signaling modulators and/or pattern and levels of their phosphorylation/dephosphorylation. Recent studies have shown that the activity of the TGFR, the PRLR, and HGFR and their associated signaling cascades change upon OTA exposure. A critical evaluation of these findings suggests that while increased activity of the HGFR and TGFR signaling pathways leads to an increase in cell survival and fibrosis, decreased activity of the PRLR signaling pathway leads to tissue damage. This review explores the roles of these receptors in OTA-related pathologies and effects on cellular homeostasis.
Asunto(s)
Homeostasis , Ocratoxinas , Receptores de Prolactina , Transducción de Señal , Ocratoxinas/toxicidad , Humanos , Transducción de Señal/efectos de los fármacos , Homeostasis/efectos de los fármacos , Animales , Receptores de Prolactina/metabolismo , Proteínas Proto-Oncogénicas c-met/metabolismo , Receptores de Factores de Crecimiento Transformadores beta/metabolismoRESUMEN
This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.
RESUMEN
The current model offers valuable insights for materials science, heat exchangers, renewable energy production, nanotechnology, manufacturing, medicinal treatments, and environmental engineering. The findings of this study have the potential to improve material design, increase heat transfer efficiency across various systems, enhance energy conversion processes, and drive advancements in nanotechnology, medicinal treatments, and engineering design. The goal of the current research is to analyze the effects of thermal radiation and the volume fraction of nanoparticles in MoS2-Ag/engine oil-based hybrid nanofluid flow passing through a cylinder. After performing a substantial similarity transformation, the nonlinear dimensionless framework is recast as ODEs. The Yamada-Ota and Xue models are then applied to the dimensionless equation setup, which is numerically solved using the BVP4C approach. The resulting velocity and temperature fields, corresponding to various parameters, are examined and compared across both models. This investigation demonstrates a significant variation in heat transfer rates between the Yamada-Ota and Xue models, with the former having a larger impact. The velocity and temperature fields decrease as the magnetic field parameter increases in both nanofluids. However, as the magnetic field parameter values grow, the velocity fields in the two nanofluids behave differently. The Yamada-Ota and Xue models are used to determine the behavior of the hybrid nanofluid flow over a nonlinear extended cylinder. In all situations, the velocity and temperature fields exhibit superior decay characteristics.
RESUMEN
Ochratoxin A (OTA) is a rat renal carcinogen that induces karyomegaly and micronuclei in proximal tubular epithelial cells (PTECs). We previously performed comprehensive gene profiling of alterations in promoter-region methylation and gene expression in PTECs of rats treated with OTA for 13 weeks. The OTA-specific gene profile was obtained by excluding genes showing expression changes similar to those upon treatment with 3-chloro-1,2-propanediol, a renal carcinogen not inducing karyomegaly. In this study, we validated the candidate genes using methylated DNA enrichment PCR and real-time RT-PCR, and identified Gen1, Anxa3, Cdkn1a, and Osm as genes showing OTA-specific epigenetic changes. These genes and related molecules were subjected to gene expression and immunohistochemical analyses in the PTECs of rats treated with OTA, other renal carcinogens, or non-carcinogenic renal toxicants for 4 or 13 weeks. Cdkn1a upregulation and increase of p21WAF1/CIP1+ karyomegalic PTECs were observed with OTA, matching the findings associated with micronucleus-inducing carcinogens. This suggested that the increase of p21WAF1/CIP1+ karyomegalic PTECs is linked to micronucleus formation, which in turn accelerates chromosomal instability. The upregulation of Cdkn1a-related genes with OTA suggests the acquisition of a senescence-associated secretory phenotype, which promotes the establishment of a carcinogenic environment. Meanwhile, OTA specifically caused a decrease of GEN1+ PTECs reflecting Gen1 downregulation and an increase of ANXA3+ PTECs reflecting Anxa3 upregulation, as well as Osm upregulation. OTA may efficiently disrupt pathways for repairing the DNA double-strand breaks that it itself causes, via Gen1 downregulation, and enhance cell proliferation through the upregulation of Anxa3 and Osm. This may exacerbate the chromosomal instability from the early stage of OTA-induced renal carcinogenesis before proliferative lesions form. OTA may cause renal carcinogenesis involving multiple epigenetic mechanisms.
Asunto(s)
Epigénesis Genética , Ocratoxinas , Venenos , Ocratoxinas/toxicidad , Riñón , Metilación de ADN , Neoplasias Renales/inducido químicamente , Fallo Renal Crónico/inducido químicamente , Animales , Ratas , Masculino , Ratas Endogámicas F344 , Carcinógenos Ambientales/toxicidad , Regulación de la Expresión GénicaRESUMEN
An innovative aptasensor incorporating MoS2-modified bicolor quantum dots and a portable spectrometer, designed for the simultaneous detection of ochratoxin A (OTA) and aflatoxin B1 (AFB1) in corn was developed. Carbon dots and CdZnTe quantum dots were as nano-donors to label OTA and AFB1 aptamers, respectively. These labeled aptamers were subsequently attached to MoS2 receptors, enabling fluorescence resonance energy transfer (FRET). With targets, the labeled aptamers detached from the nano-donors, thereby disrupting the FRET process and resulting in fluorescence recovery. Furthermore, a portable dual-mode fluorescence detection system, complemented with customized python-based analysis software, was developed to facilitate rapid and convenient detection using this dual-color FRET aptasensor. The developed host program is connected to the spectrometer and transmits data to the cloud, enabling the device to have Internet of Things (IoT) characteristics. Connected to the cloud, this IoT-enabled device offers convenient and reliable fungal toxin detection for food safety.
Asunto(s)
Aflatoxina B1 , Aptámeros de Nucleótidos , Técnicas Biosensibles , Transferencia Resonante de Energía de Fluorescencia , Contaminación de Alimentos , Ocratoxinas , Puntos Cuánticos , Programas Informáticos , Transferencia Resonante de Energía de Fluorescencia/instrumentación , Ocratoxinas/análisis , Aptámeros de Nucleótidos/química , Técnicas Biosensibles/instrumentación , Contaminación de Alimentos/análisis , Aflatoxina B1/análisis , Puntos Cuánticos/química , Zea mays/química , Fluorescencia , Telurio/química , Disulfuros , MolibdenoRESUMEN
Ochratoxin A (OTA) is a type of mycotoxin commonly found in raw and processed foods. It is essential to be aware of this toxin, as it can harm your health if consumed in high quantities. OTA can induce toxic effects in various cell models. However, a more comprehensive understanding of the harmful effects of OTA on human astrocytes is required. This study evaluated OTA's neurotoxic effects on the Gibco® Human Astrocyte (GHA) cell line, its underlying mechanisms, and the antioxidant N-acetylcysteine (NAC) ability to prevent them. OTA exposure within 5-30 µM has induced concentration-dependent cytotoxicity. In the OTA-treated cells, the levels of reactive oxygen species (ROS) were found to be significantly increased, while the glutathione (GSH) contents were found to decrease considerably. The western blotting of OTA-treated cells has revealed increased Bax, cleaved caspase-9/caspase-3 protein levels, and increased Bax/Bcl-2 ratio. In addition, exposure to OTA has resulted in the induction of antioxidant responses associated with the protein expressions of Nrf2, HO-1, and NQO1. On the other hand, the pretreatment with NAC has partially alleviated the significant toxic effects of OTA. In conclusion, our findings suggest that oxidative stress and apoptosis are involved in the OTA-induced cytotoxicity in GHA cells. NAC could act as a protective agent against OTA-induced oxidative damage.
Asunto(s)
Acetilcisteína , Apoptosis , Astrocitos , Glutatión , Ocratoxinas , Estrés Oxidativo , Especies Reactivas de Oxígeno , Ocratoxinas/toxicidad , Humanos , Astrocitos/efectos de los fármacos , Acetilcisteína/farmacología , Especies Reactivas de Oxígeno/metabolismo , Línea Celular , Apoptosis/efectos de los fármacos , Estrés Oxidativo/efectos de los fármacos , Glutatión/metabolismo , Supervivencia Celular/efectos de los fármacos , Antioxidantes/farmacología , Factor 2 Relacionado con NF-E2/metabolismo , Caspasa 3/metabolismo , Hemo-Oxigenasa 1/metabolismo , Proteína X Asociada a bcl-2/metabolismo , NAD(P)H Deshidrogenasa (Quinona)/metabolismoRESUMEN
BACKGROUND: The picosecond alexandrite laser has been safely and effectively used to treat the nevus of Ota in adults. However, limited data are available for children. OBJECTIVE: To investigate the efficacy, safety, and correlative influencing factors of a 755nm picosecond alexandrite laser in the treatment of nevus of Ota in children. METHODS: We retrospectively analyzed Chinese children with nevus of Ota who received a 755nm picosecond alexandrite laser treatment in a tertiary dermatological hospital. RESULT: A total of 305 pediatric patients received an average of two treatments achieving an average of 79% pigment clearance. After the first treatment, 22 patients achieved complete clearance (95%-100%), and 72 patients achieved excellent response (75%-94%), with an average initial efficacy of 63% lesion clearance. Treatment at an early age achieved better initial efficacy (0- to 12-month group >1- to 6-year group, 6- to 12-year group). And 0- to 12-month group achieved better final efficacy. More treatment sessions also increased the final efficacy. Both initial efficacy and final efficacy were better when treating a darker lesion. The incidence of complications was 12.1%, with 10.8% being post-inflammatory hyperpigmentation and 1.3% being hypopigmentation. The rate of recurrence was 6.6%. LIMITATION: Retrospective study. CONCLUSION: A 755nm picosecond alexandrite laser is safe and effective in treating nevus of Ota in children. Younger to initiate treatment, darker lesions, and more treatments are positively associated with better pigmentation clearance.