MetClo: methylase-assisted hierarchical DNA assembly using a single type IIS restriction enzyme.

Efficient DNA assembly is of great value in biological research and biotechnology. Type IIS restriction enzyme-based assembly systems allow assembly of multiple DNA fragments in a one-pot reaction. However, large DNA fragments can only be assembled by alternating use of two or more type IIS restriction enzymes in a multi-step approach. Here, we present MetClo, a DNA assembly method that uses only a single type IIS restriction enzyme for hierarchical DNA assembly. The method is based on in vivo methylation-mediated on/off switching of type IIS restriction enzyme recognition sites that overlap with site-specific methylase recognition sequences. We have developed practical MetClo systems for the type IIS enzymes BsaI, BpiI and LguI, and demonstrated hierarchical assembly of large DNA fragments up to 218 kb. The MetClo approach substantially reduces the need to remove internal restriction sites from components to be assembled. The use of a single type IIS enzyme throughout the different stages of DNA assembly allows novel and powerful design schemes for rapid large-scale hierarchical DNA assembly. The BsaI-based MetClo system is backward-compatible with component libraries of most of the existing type IIS restriction enzyme-based assembly systems, and has potential to become a standard for modular DNA assembly.

Management of E. coli sister chromatid cohesion in response to genotoxic stress.

Aberrant DNA replication is a major source of the mutations and chromosomal rearrangements associated with pathological disorders. In bacteria, several different DNA lesions are repaired by homologous recombination, a process that involves sister chromatid pairing. Previous work in Escherichia coli has demonstrated that sister chromatid interactions (SCIs) mediated by topological links termed precatenanes, are controlled by topoisomerase IV. In the present work, we demonstrate that during the repair of mitomycin C-induced lesions, topological links are rapidly substituted by an SOS-induced sister chromatid cohesion process involving the RecN protein. The loss of SCIs and viability defects observed in the absence of RecN were compensated by alterations in topoisomerase IV, suggesting that the main role of RecN during DNA repair is to promote contacts between sister chromatids. RecN also modulates whole chromosome organization and RecA dynamics suggesting that SCIs significantly contribute to the repair of DNA double-strand breaks (DSBs).

Dynamics and Cell-Type Specificity of the DNA Double-Strand Break Repair Protein RecN in the Developmental Cyanobacterium Anabaena sp. Strain PCC 7120.

DNA replication and repair are two fundamental processes required in life proliferation and cellular defense and some common proteins are involved in both processes. The filamentous cyanobacterium Anabaena sp. strain PCC 7120 is capable of forming heterocysts for N2 fixation in the absence of a combined-nitrogen source. This developmental process is intimately linked to cell cycle control. In this study, we investigated the localization of the DNA double-strand break repair protein RecN during key cellular events, such as chromosome damaging, cell division, and heterocyst differentiation. Treatment by a drug causing DNA double-strand breaks (DSBs) induced reorganization of the RecN focus preferentially towards the mid-cell position. RecN-GFP was absent in most mature heterocysts. Furthermore, our results showed that HetR, a central player in heterocyst development, was involved in the proper positioning and distribution of RecN-GFP. These results showed the dynamics of RecN in DSB repair and suggested a differential regulation of DNA DSB repair in vegetative cell and heterocysts. The absence of RecN in mature heterocysts is compatible with the terminal nature of these cells.

TaqIB and severity of coronary artery disease in the Turkish population: a pilot study.

The cholesteryl ester transfer protein (CETP) plays a crucial role in high-density lipoprotein (HDL) metabolism. Genetic variants that alter CETP concentration may cause significant alterations in HDL-cholesterol (HDL-C) concentration. In this case-control study, we analyzed the genotype frequencies of CETP Taq1B polymorphisms in coronary artery disease patients (CAD; n=210) and controls (n=100). We analyzed the role of the CETP Taq1B variant in severity of CAD, and its association with plasma lipids and CETP concentration. DNA was extracted from 310 patients undergoing coronary angiography. The Taq1B polymorphism was genotyped using polymerase chain reaction-restriction fragment length polymorphism (RFLP) analysis. Lipid concentrations were measured by an auto analyzer and CETP level by a commercial enzyme-linked immunosorbent assay (ELISA) kit. In our study population, the B2 allele frequency was higher in control subjects than patients with single, double or triple vessel disease. B2B2 genotype carriers had a significantly higher high-density lipoprotein cholesterol (HDL-C) concentration than those with the B1B1 genotype in controls (51.93±9.47versus 45.34±9.93; p<0.05) and in CAD patients (45.52±10.81 versus 40.38±9.12; p<0.05). B2B2 genotype carriers had a significantly lower CETP concentration than those with the B1B1 genotype in controls (1.39±0.58 versus 1.88±0.83; p< 0.05) and in CAD patients (2.04±1.39versus 2.81±1.68; p< 0.05). Our data suggest that the B2 allele is associated with higher concentrations of HDL-C and lower concentrations of CETP, which confer a protective effect on coronary artery disease.

Bacillus subtilis RecA and its accessory factors, RecF, RecO, RecR and RecX, are required for spore resistance to DNA double-strand break.

Bacillus subtilis RecA is important for spore resistance to DNA damage, even though spores contain a single non-replicating genome. We report that inactivation of RecA or its accessory factors, RecF, RecO, RecR and RecX, drastically reduce survival of mature dormant spores to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs). The presence of non-cleavable LexA renders spores less sensitive to DSBs, and spores impaired in DSB recognition or end-processing show sensitivities to X-rays similar to wild-type. In vitro RecA cannot compete with SsbA for nucleation onto ssDNA in the presence of ATP. RecO is sufficient, at least in vitro, to overcome SsbA inhibition and stimulate RecA polymerization on SsbA-coated ssDNA. In the presence of SsbA, RecA slightly affects DNA replication in vitro, but addition of RecO facilitates RecA-mediated inhibition of DNA synthesis. We propose that repairing of the DNA lesions generates a replication stress to germinating spores, and the RecA·ssDNA filament might act by preventing potentially dangerous forms of DNA repair occurring during replication. RecA might stabilize a stalled fork or prevent or promote dissolution of reversed forks rather than its cleavage that should require end-processing.

Early steps of double-strand break repair in Bacillus subtilis.

All organisms rely on integrated networks to repair DNA double-strand breaks (DSBs) in order to preserve the integrity of the genetic information, to re-establish replication, and to ensure proper chromosomal segregation. Genetic, cytological, biochemical and structural approaches have been used to analyze how Bacillus subtilis senses DNA damage and responds to DSBs. RecN, which is among the first responders to DNA DSBs, promotes the ordered recruitment of repair proteins to the site of a lesion. Cells have evolved different mechanisms for efficient end processing to create a 3'-tailed duplex DNA, the substrate for RecA binding, in the repair of one- and two-ended DSBs. Strand continuity is re-established via homologous recombination (HR), utilizing an intact homologous DNA molecule as a template. In the absence of transient diploidy or of HR, however, two-ended DSBs can be directly re-ligated via error-prone non-homologous end-joining. Here we review recent findings that shed light on the early stages of DSB repair in Firmicutes.

Development of nuclease-mediated site-specific genome modification.

Genome engineering is an emerging strategy to treat monogenic diseases that relies on the use of engineered nucleases to correct mutations at the nucleotide level. Zinc finger nucleases can be designed to stimulate homologous recombination-mediated gene targeting at a variety of loci, including genes known to cause the primary immunodeficiencies (PIDs). Recently, these nucleases have been used to correct disease-causing mutations in human cells, as well as to create new animal models for human disease. Although a number of hurdles remain before they can be used clinically, engineered nucleases hold increasing promise as a therapeutic tool, particularly for the PIDs.

The bacterial CRISPR/Cas system as analog of the mammalian adaptive immune system.

Bacteria, like mammals, have to constantly defend themselves from viral attack. Like mammals, they use both innate and adaptive defense mechanisms. In this point of view we highlight the commonalities between defense systems of bacteria and mammals. Our focus is on the recently discovered bacterial adaptive immune system, the clustered regularly interspaced short palindromic repeats (CRISPR) and their associated proteins (Cas). We suggest that fundamental aspects of CRISPR/Cas immunity may be viewed in light of the vast accumulated knowledge on the mammalian immune system, and propose that further insights will be revealed by thorough comparison between the systems.

Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

Structural constraints in collaborative competition of transcription factors against the nucleosome.

Cooperativity in transcription factor (TF) binding is essential in eukaryotic gene regulation and arises through diverse mechanisms. Here, we focus on one mechanism, collaborative competition, which is of interest because it arises both automatically (with no requirement for TF coevolution) and spontaneously (with no requirement for ATP-dependent nucleosome remodeling factors). Previous experimental studies of collaborative competition analyzed cases in which target sites for pairs of cooperating TFs were contained within the same side of the nucleosome. Here, we utilize new assays to measure cooperativity in protein binding to pairs of nucleosomal DNA target sites. We focus on the cases that are of greatest in vivo relevance, in which one binding site is located close to the end of a nucleosome and the other binding site is located at diverse positions throughout the nucleosome. Our results reveal energetically significant positive (favorable) cooperativity for pairs of sites on the same side of the nucleosome but, for the cases examined, energetically insignificant cooperativity between sites on opposite sides of the nucleosome. These findings imply a special significance for TF binding sites that are spaced within one-half nucleosome length (74 bp) or less along the genome and may prove useful for prediction of cooperatively acting TFs genome wide.

The phage-host arms race: shaping the evolution of microbes.

Bacteria, the most abundant organisms on the planet, are outnumbered by a factor of 10 to 1 by phages that infect them. Faced with the rapid evolution and turnover of phage particles, bacteria have evolved various mechanisms to evade phage infection and killing, leading to an evolutionary arms race. The extensive co-evolution of both phage and host has resulted in considerable diversity on the part of both bacterial and phage defensive and offensive strategies. Here, we discuss the unique and common features of phage resistance mechanisms and their role in global biodiversity. The commonalities between defense mechanisms suggest avenues for the discovery of novel forms of these mechanisms based on their evolutionary traits.

The type IIB restriction endonucleases.

The endonucleases from the Type IIB restriction-modification systems differ from all other restriction enzymes. The Type IIB enzymes cleave both DNA strands at specified locations distant from their recognition sequences, like Type IIS nucleases, but they are unique in that they do so on both sides of the site, to liberate the site from the remainder of the DNA on a short duplex. The fact that these enzymes cut DNA at specific locations mark them as Type II systems, as opposed to the Type I enzymes that cut DNA randomly, but in terms of gene organization and protein assembly, most Type IIB restriction-modification systems have more in common with Type I than with other Type II systems. Our current knowledge of the Type IIB systems is reviewed in the present paper.

Dynamics of the bacterial SMC complex and SMC-like proteins involved in DNA repair.

Bacteria and archaea possess several different SMC-like proteins, which perform essential functions in a variety of chromosome dynamics, such as chromosome compaction, segregation, and DNA repair. SMC-like proteins localize to distinct sites within the cells at different time points in the cell cycle, or are recruited to sites of DNA breaks and damage. The bacterial SMC (MukB) complex appears to perform a condensin-like function, while SbcC and RecN act early during DNA repair, but apparently at different sites within the cells. Thus, bacterial SMC-like proteins have dynamic functions in chromosome segregation and maintenance of genetic stability.

Expression of I-CreI endonuclease generates deletions within the rDNA of Drosophila.

The rDNA arrays in Drosophila contain the cis-acting nucleolus organizer regions responsible for forming the nucleolus and the genes for the 28S, 18S, and 5.8S/2S RNA components of the ribosomes and so serve a central role in protein synthesis. Mutations or alterations that affect the nucleolus organizer region have pleiotropic effects on genome regulation and development and may play a role in genomewide phenomena such as aging and cancer. We demonstrate a method to create an allelic series of graded deletions in the Drosophila Y-linked rDNA of otherwise isogenic chromosomes, quantify the size of the deletions using real-time PCR, and monitor magnification of the rDNA arrays as their functions are restored. We use this series to define the thresholds of Y-linked rDNA required for sufficient protein translation, as well as establish the rate of Y-linked rDNA magnification in Drosophila. Finally, we show that I-CreI expression can revert rDNA deletion phenotypes, suggesting that double-strand breaks are sufficient to induce rDNA magnification.

[Regulation of gene expression in type II restriction-modification system].

Type II restriction-modification systems are comprised of a restriction endonuclease and methyltransferase. The enzymes are coded by individual genes and recognize the same DNA sequence. Endonuclease makes a double-stranded break in the recognition site, and methyltransferase covalently modifies the DNA bases within the recognition site, thereby down-regulating endonuclease activity. Coordinated action of these enzymes plays a role of primitive immune system and protects bacterial host cell from the invasion of foreign (for example, viral) DNA. However, uncontrolled expression of the restriction-modification system genes can result in the death of bacterial host cell because of the endonuclease cleavage of host DNA. In the present review, the data on the expression regulation of the type II restriction-modification enzymes are discussed.

In vivo restriction endonuclease activity of the Anabaena PCC 7120 XisA protein in Escherichia coli.

Anabaena PCC 7120 genome contains three elements, which get excised out during late stages of heterocyst differentiation by a site-specific recombination process. The XisA protein, which excises the nifD element, shows sequence homology with the integrase family of tyrosine recombinase. The 11 bp target site of XisA CGGAGTAATCC contains a 3 bp inverted repeat. Here, we report restriction endonuclease activity of XisA by specific loss of plasmids containing single or double target sites. The pMX25 plasmid containing two target sites demonstrated endonuclease activity proportional to excision frequency. Different plasmid substrates containing one base pair mutation in the inverted repeat of the target site were monitored for endonuclease activity. Mutation of A4C retained endonuclease activity, while other modifications lost endonuclease activity. The presence of an additional copy of the target site enhanced endonuclease activity. These results suggest that the XisA protein could be an IIE type of restriction endonuclease in addition to being a recombinase.

Bacillus subtilis SbcC protein plays an important role in DNA inter-strand cross-link repair.

BACKGROUND: Several distinct pathways for the repair of damaged DNA exist in all cells. DNA modifications are repaired by base excision or nucleotide excision repair, while DNA double strand breaks (DSBs) can be repaired through direct joining of broken ends (non homologous end joining, NHEJ) or through recombination with the non broken sister chromosome (homologous recombination, HR). Rad50 protein plays an important role in repair of DNA damage in eukaryotic cells, and forms a complex with the Mre11 nuclease. The prokaryotic ortholog of Rad50, SbcC, also forms a complex with a nuclease, SbcD, in Escherichia coli, and has been implicated in the removal of hairpin structures that can arise during DNA replication. Ku protein is a component of the NHEJ pathway in pro- and eukaryotic cells. RESULTS: A deletion of the sbcC gene rendered Bacillus subtilis cells sensitive to DNA damage caused by Mitomycin C (MMC) or by gamma irradiation. The deletion of the sbcC gene in a recN mutant background increased the sensitivity of the single recN mutant strain. SbcC was also non-epistatic with AddAB (analog of Escherichia coli RecBCD), but epistatic with RecA. A deletion of the ykoV gene encoding the B. subtilis Ku protein in a sbcC mutant strain did not resulted in an increase in sensitivity towards MMC and gamma irradiation, but exacerbated the phenotype of a recN or a recA mutant strain. In exponentially growing cells, SbcC-GFP was present throughout the cells, or as a central focus in rare cases. Upon induction of DNA damage, SbcC formed 1, rarely 2, foci on the nucleoids. Different to RecN protein, which forms repair centers at any location on the nucleoids, SbcC foci mostly co-localized with the DNA polymerase complex. In contrast to this, AddA-GFP or AddB-GFP did not form detectable foci upon addition of MMC. CONCLUSION: Our experiments show that SbcC plays an important role in the repair of DNA inter-strand cross-links (induced by MMC), most likely through HR, and suggest that NHEJ via Ku serves as a backup DNA repair system. The cell biological experiments show that SbcC functions in close proximity to the replication machinery, suggesting that SbcC may act on stalled or collapsed replication forks. Our results show that different patterns of localization exist for DNA repair proteins, and that the B. subtilis SMC proteins RecN and SbcC play distinct roles in the repair of DNA damage.

Recruitment of Bacillus subtilis RecN to DNA double-strand breaks in the absence of DNA end processing.

The recognition and processing of double-strand breaks (DSBs) to a 3' single-stranded DNA (ssDNA) overhang structure in Bacillus subtilis is poorly understood. Mutations in addA and addB or null mutations in recJ (DeltarecJ), recQ (DeltarecQ), or recS (DeltarecS) genes, when present in otherwise-Rec+ cells, render cells moderately sensitive to the killing action of different DNA-damaging agents. Inactivation of a RecQ-like helicase (DeltarecQ or DeltarecS) in addAB cells showed an additive effect; however, when DeltarecJ was combined with addAB, a strong synergistic effect was observed with a survival rate similar to that of DeltarecA cells. RecF was nonepistatic with RecJ or AddAB. After induction of DSBs, RecN-yellow fluorescent protein (YFP) foci were formed in addAB DeltarecJ cells. AddAB and RecJ were required for the formation of a single RecN focus, because in their absence multiple RecN-YFP foci accumulated within the cells. Green fluorescent protein-RecA failed to form filamentous structures (termed threads) in addAB DeltarecJ cells. We propose that RecN is one of the first recombination proteins detected as a discrete focus in live cells in response to DSBs and that either AddAB or RecQ(S)-RecJ are required for the generation of a duplex with a 3'-ssDNA tail needed for filament formation of RecA.

[The role of weak specific and nonspecific interactions in recognition and conversation by enzymes of long DNA]. / Rol' slabykh spetsificheskikh i nespetsificheskikh vzaimodeistvii v uznavanii i prevrashchenii fermentami protiazhennykh DNK.

According to a currently accepted model, enzymes engage in high-rate sliding along DNA when searching for specific recognition sequences or structural elements (modified nucleotides, breaks, single-stranded DNA fragments, etc.). Such sliding requires these enzymes to possess sufficiently high affinity for DNA of any sequence. Thus, significant differences in the enzymes' affinity for specific and nonspecific DNA sequences cannot be expected, and formation of a complex between an enzyme and its target DNA unlikely contributes significantly in the enzyme specificity. To elucidate the factors providing the specificity we have analyzed many DNA replication, DNA repair, topoisomerization, integration, and recombination enzymes using a number of physicochemical methods, including a method of stepwise increase in ligand complexity developed in our laboratory. It was shown that high affinity of all studied enzymes for long DNA is provided by formation of many weak contacts of the enzymes with all nucleotide units covered by protein globules. Contacts of positively charged amino acid residues with internucleotide phosphate groups contribute most to such interactions; the contribution of each contact is very small and the full contact interface usually resembles interactions between oppositely charged biopolymer surfaces. In some cases significant contribution to the affinity is made through hydrophobic and/or van der Waals interactions of the enzymes with nucleobases. Overall, depending on the enzyme, such nonspecific interactions provide 5-8 orders of the enzyme affinity for DNA. Specific interactions of enzymes with long DNA, in contrast to contacts of enzymes with small ligands, are usually weak and comparable in efficiency with weak nonspecific contacts. The sum of specific interactions most often provides approximately one and rarely two orders of the affinity. According to structural data, DNA binding to any of the investigated enzymes is followed by a stage of DNA conformation adjustment including partial or complete DNA melting, deformation of its backbone, stretching, compression, bending or kinking, eversion of nucleotides from the DNA helix, etc. The full set of such changes is characteristic for each individual enzyme. The fact that all enzyme-dependent changes in DNA are effected through weak specific rather than strong interactions is very important. Enzyme-specific changes in DNA conformation are required for effective adjustment of reacting orbitals with accuracy about 10-15 degrees, which is possible only for specific DNA. A transition from nonspecific to specific DNA leads to an increase in the reaction rate (kcat) by 4-8 orders of magnitude. Thus, the stages of DNA conformation adjustment and catalysis proper provide the high specificity of enzyme action.

RecN and RecG are required for Escherichia coli survival of Bleomycin-induced damage.

The sensitivity of a panel of DNA repair-defective bacterial strains to BLM was investigated. Escherichia coli recA cells were far more sensitive than were uvrA, dam-3, and mutM mutY strains, underscoring the importance of RecA to survival. Strains recBCD and recN, which lack proteins required for double strand break (DSB) repair, were highly sensitive to BLM, while recF cells were not. The requirement for DSB-specific enzymes supports the hypothesis that DSBs are the primary cause of bleomycin cytotoxicity. The acute sensitivity of recN cells was comparable to that of recA, implying a central role for the RecN protein in BLM lesion repair. The Holliday junction processing enzymes RecG and RuvC were both required for BLM survival. The recG ruvC double mutant was no more sensitive than either mutation alone, suggesting that both enzymes participate in the same pathway. Surprisingly, ruvAB cells were no more sensitive than wildtype, implying that RuvC is able to perform its role without RuvAB. This observation contrasts with current models of recombination in which RuvA, B, and C function as a single complex. The most straightforward explanation of these results is that DSB repair involves a structure that serves as a good substrate for RecG, and not RuvAB.