First Report of Rice yellow mottle virus in Rice in Federal Democratic Republic of Ethiopia.

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (5). In the Federal Democratic Republic of Ethiopia, however, the disease has never been reported in rice fields. In September 2012, plants with leaf yellowing and mottling symptoms were observed near Bahir Dar and in the Fogera district in the northwestern part of the country during a joint survey of scientists from Madagascar (FOFIFA), Ethiopian Institute of Agricultural Research (EIAR), and Japan International Cooperation Agency (JICA). The disease was observed in 2013 in Fogera and Dera districts, where samples were collected, causing small patches of infected plants in ~5% of the fields. Symptomatic leaves of two plants collected in the fields were inoculated on five plants of the susceptible O. sativa cultivar IR64. All inoculated plants reproduced the typical yellow mottle symptoms. Symptomatic leaves of eight plants collected in the fields reacted positively when tested by double antibody sandwich (DAS)-ELISA tests with a polyclonal antiserum raised against a Madagascan isolate of RYMV (2), indicating for the first time the presence of the virus in Ethiopia. Triple antibody sandwich (TAS) tests with discriminant monoclonal antibodies (2) revealed that they all belonged to serotype 4, a serotype found in East Africa and in Madagascar. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from four samples. The 720-bp coat protein (CP) gene was amplified with reverse transcription (RT)-PCR with the primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. KMO17554, KMO14555, KMO17556, and KMO17557). The four sequences showed over 98% nucleotide identity between each other. They shared over 92% nucleotide identity with isolates of strains S4 found in Kenya, Uganda, Tanzania, and Madagascar (4). Agricultural changes associated to rice intensification are known to favor RYMV emergence and spread (5). Recent efforts have been led by the National Rice Research and Development Strategy (NRRDSE) to intensify rice cultivation in Ethiopia (1). Early knowledge of RYMV occurrence in the country is a prerequisite to extended surveys of the disease and implementation of control measures. References: (1) K. Assefa et al. Challenges and opportunities of rice in Ethiopian agricultural development. www.eiar.gov.et/Publications/frgseries2.pdf , 2011. (2) D. Fargette et al. Arch. Virol. 147:583, 2002. (3) A. Pinel et al. Arch. Virol. 145:1621, 2000. (4) M. Rakotomalala et al. Virus Res. 171:71, 2013. (5) O. Traoré et al. Virus Res. 141:258, 2009.

Bacteriological and physico-chemical quality of drinking water sources in a rural community of Ethiopia.

BACKGROUND: Accesses to safe water is a universal need however, many of the world's population lack access to adequate and safe water. Consumption of water contaminated causes health risk to the public and the situation is serous in rural areas. OBJECTIVES: To assess the bacteriological and physico-chemical quality of drinking water sources in a rural community of Ethiopia. METHODS: Water samples were collected from tap, open springs, open dug wells and protected springs for bacteriological analysis of total coliforms and thermotolerant coliforms. The turbidity, pH and temperature were measured immediately after collection. RESULTS: Most drinking water sources were found to have coliform counts above the recommended national and international guidelines and had high sanitary risk scores. There was a statistically significant difference among water sources with respect to TC and TTC (p < 0.05) and there was a statistically significant positive correlation between coliform counts and sanitary risk scores (p < 0.01). Most water sources didn't satisfy the turbidity values recommended by WHO. CONCLUSION: The water sources were heavily contaminated which suggested poor protection and sanitation practice in the water sources. Source protection strategies as well as monitoring are recommend for this community.

Antibiogram of nosocomial urinary tract infections in Felege Hiwot referral hospital, Ethiopia.

BACKGROUND: Nosocomial infections increase the cost of medical care, extend hospital stay and reflect on the morbidity and mortality of the admitted patients. Urinary tract infections (UTIs) are one of the most common nosocomial infections in humans. OBJECTIVES: To determine the prevalence and antibiogram of nosocomial UITs from a referral hospital. METHODS: A cross-sectional study was conducted on 1 254 patients from April to August 2010. Antimicrobial susceptibility tests were done using disc diffusion technique as per the standard of Kirby-Bauer method. RESULTS: Of the 1 254 patients, 118 (9.4%) developed nosocomial UTIs. Seventy three (61.9%) and 44 (37.1%) of the bacterial isolates were gram negative and gram positive, respectively. One patient had a mixed infection. E. coli, S.aureus and K. pneumonia were the most predominant isolates. Gender, catheterization and pre-operative antimicrobial prophylaxis and underlying diseases were significantly associated with the occurrence of nosocomial UTIs (p=0.001). Most bacterial isolates showed high resistance rates (>80%) to ampicillin, amoxicillin/clavulanic acid, chloramphenicol and cloxacillin. CONCLUSION: Catheterization and preoperative antibiotic prophylaxis were found to be the risk factors for nosocomial infection. Effective infection prevention measures should be in place to reduce the prevalence of nosocomial UTIs.

Antimicrobial susceptibility patterns of E. coli from clinical sources in northeast Ethiopia.

BACKGROUND: Escherichia coli is the leading cause of urinary tract, ear, wound and other infections in humans. Increasing rates of antimicrobial resistance among E. coli is a growing concern worldwide. OBJECTIVES: The aim of this study was to determine the prevalence and antimicrobial susceptibility of E. coli from clinical samples. METHOD: A retrospective review of culture results of urine, ear discharge, pus swab from wounds, and eye discharge was done. A total of 3,149 samples were analyzed for isolation and identification of bacteria and antimicrobial susceptibility testing. RESULTS: E. coli was isolated from 446 (14.2%) samples. The highest isolation rate was obtained from urine samples 203 (45.5%). High resistance rates to erythromycin (89.4%), amoxicillin (86.0%) and tetracycline (72.6%) were documented. However, significantly high degree of sensitivity rates to nitrofurantoin (96.4%), norflaxocin (90.6%), gentamicin (79.6%) and ciprofloxacin were recorded (p<0.001). Multiple antimicrobial resistances of 74.6% and increased resistance rates to all antimicrobials except ciprofloxacin were also recorded. CONCLUSION: E. coli isolates showed high rates of resistance to erythromycin, amoxicillin and tetracycline. Nitrofurantoin, norflaxocin, gentamicin and ciprofloxacin are considered appropriate for empirical treatment of E. coli in the study area. Regular monitoring of antimicrobial susceptibility is recommended.

Prevalence of Salmonella typhi and intestinal parasites among food handlers in Bahir Dar Town, Northwest Ethiopia

Background:Food borne diseases are a global public health problem. Food handlers play a major role for the transmission of food borne diseases. Objectives: This study was aimed at exploring the prevalence of intestinal parasites; S. typhi carrier rate and risk factors among food handlers at Bahir Dar town. Methods: A cross -sectional survey was conducted among food handlers working in different kitchens. A pre-tested structured questionnaire was used for collecting data. Stool samples were investigated for intestinal parasites and S. typhi as per the standard laboratory methods. Results: Among 384 food handlers; females comprised 300 (78). The majority 371 (96.6) were young adults (12 - 40 years). The median year of service was 1 year (1 month to 24 years). All food handlers had no previous medical checkup and 54 (14) were certified as food handlers. One hundred fifty eight (41.1) food handlers had intestinal parasites and 6 (1.6) were found positive for S. typhi. Of these; 25 (6.5) were suffering from diarrhoea. Nine species of intestinal parasites; 2 protozoa (E. histolytica/dispar 12.76and G. lamblia 7. 0) and 7 helminthes (A. lumbricoides; 11.7; Hookworm; 8.1; S. stercoralis; 2.86; S. mansoni; 1.8; Taenia species; 1.3; H. nana; 0.5and T. trichiuria; 0.5) were detected. Conclusion: Inexperienced and poor personal hygienic food handlers play a role for transmission of food borne infections. Local health authorities should implement food handler's training on food safety; institute periodic focused medical check up for food handlers and improve human waste disposal

Impact assessment of a community-based animal health project in Dollo Ado and Dollo Bay districts, southern Ethiopia.

Participatory methods were used to assess the impact of a community-based animal health worker (CAHW) project in two remote pastoralist districts of Ethiopia. The CAHW project had been operating for 3 years at the time of the assessment. Participatory methods were standardized and repeated with 10 groups of informants in the project area. The assessment showed significant reductions in disease impact for diseases handled by CAHWs compared with diseases not handled by CAHWs. In camels, there was significant reduction (p < 0.001) in the impact of mange, trypanosomosis, helminthosis, anthrax and non-specific respiratory disease. In cattle there was a signficant reduction (p < 0.001) in the impact of blackleg, anthrax and helminthosis. In sheep and goats there was a sign reduction (p < 0.001) in the impact of mange, helminthosis, contagious caprine pleuropneumonia, orf and non-specific diarrhoea. In order of importance, these reductions in disease impact were attributed to (1) increased use of modern veterinary services provided by CAHWs, (2) vaccination campaigns involving CAHWs, (3) good rainfall and availability of grazing and (4) decreased herd mobility. Decreased herd mobility was also associated with negative impact of tick infestation. Community-based animal health workers were considered to be highly accessible, available, affordable and trustworthy relative to other service providers. They were also perceived to be suppliers of a good quality service. Specific types of positive impact attributed to CAHW activities were increases in milk, meat, income and draught power.