RESUMO
In the early 1990s, the monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) was introduced into the Dominican Republic (DO), and molecular characterization revealed it was an isolate of TYLCV-Israel (TYLCV-IL[DO]) (3,5). In 2006, a study of the variability of TYLCV in DO revealed that TYLCV-IL[DO] was associated with all samples of tomato yellow leaf curl (TYLC) tested and, thus, that the virus had been genetically stable for >15 years (2). However, in 2010 and 2011, 2 of 10 and 11 of 18 samples of TYLC, respectively, were negative for TYLCV infection based upon PCR with the TYLCV-specific primer pair, 2560v (5'-GAGAACAATTGGGATATG-3')/1480c (5'-AATCATGGATTCACGCAC-3'), which directs the amplification of a ~1.7 kb fragment. In 2011, two such samples from the Azua Valley were tested by PCR with the 1470v (5'-AGTGATGAGTTCCCCTGTGC-3')/UPC2 primer pair (1), and sequence analysis of the ~0.4 kb fragment amplified from both samples revealed infection with the mild strain of TYLCV (TYLCV-Mld). A primer specific for TYLCV-Mld was designed (2070v, 5'-AAACGGAGAAATATATAAGGAGCC-3'), and PCR with the 2070v/1480c primer pair directed the amplification of the expected ~2.1 kb fragment from all 11 TYLC samples collected in 2011 that were PCR-negative for TYLCV-IL[DO] infection. Sequence analyses confirmed these were TYLCV-Mld fragments. The complete TYLCV-Mld genome was amplified from two samples from the Azua Valley with Templiphi, the amplified DNA products digested with Sal I, and the resulting ~2.8 kb fragments ligated into Sal I-digested pGEM-11. The complete sequences of these isolates were 2,791 nt and 99% identical to each other and 98% identical to sequences of TYLCV-Mld isolates. The TYLCV-Mld isolates from the DO were designated TYLCV-Mld:DO:TY5:01:2011 (KJ913682) and TYLCV-Mld:DO:TY5:02:2011 (KJ913683). A multimeric clone of TYLCV-Mld:DO:TY5:01:2011 was generated in the binary vector pCAMBIA1300 by cloning a 2.2 kb Sal I-EcoRI fragment containing the intergenic region to generate a 0.8-mer (pCTYMld0.8), and then the full-length Sal I fragment was cloned into the Sal I site of pCTYMld0.8 to generate a 1.8-mer (pCTYMldDO-01-1.8). Tomato plants agroinoculated with Agrobacterium tumefaciens carrying pCTYMldDO-01-1.8 developed severe TYLC disease symptoms 10 to 14 days after inoculation, whereas plants inoculated with a strain carrying the empty vector did not develop symptoms. Samples of processing tomatoes with TYLC were collected in 2012 to 2014 in the DO and tested for TYLCV-IL[DO] and TYLCV-Mld by PCR with the 2560v/1480c and 2070v/1480c primers pairs, respectively; these samples had infections of 93% (13/14), 86% (18/21), and 61% (11/18) with TYLCV-Mld; 29% (4/14), 19% (4/21), and 56% (10/18) with TYLCV-IL[DO]; and 21% (3/14), 5% (1/21), and 28% (5/18) with both viruses, respectively. These results reveal that there has been a striking population shift in the begomovirus causing TYLC in the DO, with TYLCV-Mld becoming predominant. This may reflect selection pressure(s) favoring a small pre-existing population of TYLCV-Mld, such as new tomato varieties, or a recent introduction event, such as that described in Venezuela (4). References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1994. (2) R. L. Gilbertson et al. Page 279 in: Tomato yellow leaf curl virus disease. Springer, 2007. (3) M. K. Nahkla et al. Plant Dis. 78:926, 1994. (4) G. Romay et al. Australasian Plant Dis. Notes, in press, 2014. (5) R. Salati et al. Phytopathology 92:487, 2002.
RESUMO
Processing tomatoes (Solanum lycopersicum) are an important industry in the Dominican Republic. In November 2012, symptoms typical of tospovirus infection (bronzing, chlorosis, and necrosis of leaves) appeared in numerous processing tomato fields in the North (>50% incidence in some fields) and a few fields in the South (<1% incidence). Plants in affected fields had large populations of thrips on leaves and in flowers. Symptomatic leaves from four fields in the North (Guayubin, Juan Gomez, Hatillo Palma, and Navarrete) and one field in the South (Azua) were positive for infection by Tomato spotted wilt virus (TSWV) when tested with AgDia immunostrips. However, RT-PCR tests of these samples with a TSWV N gene primer pair (1) were negative, whereas the expected size 590 and 777 bp fragments were amplified with N gene primers for Groundnut ringspot virus (GRSV, 2) and Tomato chlorotic spot virus (TCSV; NF5'ATGTCTAAGGTCAAGCTCACC3' and NR5'TTATGCAACACCTGAAATTTTGGC3'), respectively. These fragments were sequenced (KF420087 and KF420088) and comparisons revealed 99, 83, and 80% identities with N gene sequences of TCSV, GRSV, and TSWV, respectively. Portions of the L, M, and S RNAs were amplified from symptomatic leaves by RT-PCR with degenerate L (TOSPO L For: CWGARGATRTDATWATAAATAAYAATGC and TOSPO L Rev: GCATCNACAGAWATYTTCCA), M (TOSPO M For: AGAGCAATCAGTGCATC and TOSPO M Rev: CTTRCAGGCTTCAATRAAKGC), and S (3) primers. The expected L, M, and S RNA fragments of 450, 849, and 871 bp, respectively, were amplified and sequenced (KF420089, KF420090, and KF420091). Sequence comparisons revealed 98, 83, and 78%; 99, 94, and 82%; and 99, 83, and 77% identities with TCSV-, GRSV-, and TSWV-L, M, and S RNA sequences, respectively. Weed surveys around tomato fields revealed tospovirus symptoms (chlorosis, mosaic/mottle, and necrosis) in leaves of two common species, Boerhavia erecta and Cleome viscosa. Symptomatic leaves were positive with TSWV immunostrips, whereas RT-PCR and sequence analyses of these leaves from C. viscosa (one each from the North and South) and B. erecta (one from the South) revealed infection with TCSV (99% identities for L, M, and S RNA fragments). In contrast, leaves from pepper plants with tospovirus symptoms (chlorosis, ringspots, and necrosis) in a commercial greenhouse in the North (Villa Gonzales) were positive for TSWV based on immunostrips and RT-PCR and sequence analyses. Dot blot hybridization tests with the cloned TCSV L RNA fragment confirmed TCSV infection in PCR-positive tomato plants and weeds, whereas no hybridization signal was detected for TSWV-infected peppers or uninfected tomatoes. Identification of thrips collected from symptomatic tomato plants at Navarrete and Hatillo Palma revealed that tomato thrips (Frankliniella schultzei) was predominant (90%) along with Western flower thrips (F. occidentalis) (10%), whereas only F. schultzei was identified from weeds in the South. Thus, TCSV is causing the tospovirus disease of processing tomato, and this is the first report of this virus in the Dominican Republic. This is also consistent with F. schultzei being an efficient vector of TCSV. An IPM program for TCSV based on planting thrips- and virus-free transplants and resistant varieties, roguing symptomatic plants, thrips monitoring and management, and area-wide sanitation is being implemented. References: (1) H. R. Pappu et al. Tobacco Sci. 40:74, 1996. (2) C. G. Webster et al. Virol. 413:216, 2011. (3) R. J. Weeks et al. Acta Hort. 431:159, 1996.
