Protocol to cryopreserve and isolate nuclei from adipose tissue without dimethyl sulfoxide.

Cryopreservation injuries involve nuclear DNA damage. A protocol for cryopreserving and isolating adipocyte nuclei is proposed. Adipose tissue samples were directly analyzed (NoCRYO-0h), or stored at -196°C for 7 days without 10% dimethyl sulfoxide (DMSO) (CRYO-WO-DMSO) or with DMSO (CRYO-W-DMSO). To determine the effect of DMSO on cryopreservation treatment, adipose tissue samples were stored at 4°C for 24 h with 10% DMSO (NoCRYO-W-DMSO-24h) and without (NoCRYO-WO-DMSO-24h). Samples were processed in isolation buffer, and nuclear integrity was measured by flow cytometry. The coefficient of variation, forward scatter, side scatter, and number of nuclei analyzed were evaluated. Pea (Pisum sativum) was used to measure the amount of DNA. All groups contained similar amounts of DNA to previously reported values and a satisfactory number of nuclei were analyzed. CRYO-W-DMSO presented a higher coefficient of variation (3.19 ± 0.09) compared to NoCRYO-0h (1.85 ± 0.09) and CRYO-WO-DMSO (2.02 ± 0.02). The coefficient of variation was increased in NoCRYO-W-DMSO-24h (3.80 ± 0.01) compared to NoCRYO-WO-DMSO-24h (2.46 ± 0.03). These results relate DMSO presence to DNA damage independently of the cryopreservation process. CRYO-W-DMSO showed increased side scatter (93.46 ± 5.03) compared to NoCRYO-0h (41.13 ± 3.19) and CRYO-WO-DMSO (48.01 ± 2.28), indicating that cryopreservation with DMSO caused chromatin condensation and/or nuclear fragmentation. CRYO-W-DMSO and CRYO-WO-DMSO presented lower forward scatter (186.33 ± 9.33 and 196.89 ± 26.86, respectively) compared to NoCRYO-0h (322.80 ± 3.36), indicating that cryopreservation reduced nuclei size. Thus, a simple method for cryopreservation and isolation of adipocyte nuclei causing less damage to DNA integrity was proposed.

The First Report of Tomato chlorotic spot virus (TCSV) Infecting Long Beans and Chili Peppers in the Dominican Republic.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.