Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 9 de 9
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Cureus ; 16(4): e59364, 2024 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-38817460

RESUMO

Objectives This cross-sectional analytical study aims to evaluate medical students' awareness and satisfaction regarding the utilization of simulation-based learning (SBL) as a method for clinical teaching at King Saud University (KSU) over the past 12 months. It seeks to understand how such learning methods enhance students' self-satisfaction and clinical skills, facilitate the application of learned knowledge, and assess the role of instructors in providing ample practice opportunities in the skills laboratory. Furthermore, the study aims to assess the satisfaction levels of students in both preclinical and clinical years regarding the time allocated for skills laboratory sessions and the integration of high-fidelity technology in simulation-based training programs at KSU. Methods In this cross-sectional study, a total of 306 male and female medical students from the College of Medicine at KSU participated, comprising 196 preclinical students (first, second, and third years) and 110 clinical students (fourth and fifth years). Quantitative data was collected through a structured questionnaire on a 5-point Likert scale that showed degrees of satisfaction. The satisfaction was measured based on a 5-point Likert scale that shows the degree of satisfaction from (very dissatisfied, dissatisfied, neither dissatisfied nor satisfied, satisfied, and very satisfied), and we calculated the p-value based on an independent t-test, and the percentage represented the percentage of students who chose satisfied and very satisfied. Results The results showed overall satisfaction with SBL (mean: 3.98, 71.10%), and it was recognized as a useful and effective method of learning skills. It is reported that it helped the students implement what they learned. At the same time, lower satisfaction was identified in areas with less allocated time for skill labs. Moreover, lack of accessibility and lack of trained staff were reported, and they should be addressed by providing staff with proper training. Conclusion The results of the study will help to understand how students' learning needs should be addressed. Moreover, providing simulation-based training is a pathway compliant with the best educational standards that should be adapted according to each institution's singularities. Besides offering further results, the study presents suggestions for further research.

2.
Polymers (Basel) ; 14(22)2022 Nov 08.
Artigo em Inglês | MEDLINE | ID: mdl-36432928

RESUMO

The use of radiation is mandatory in modern life, but the harms of radiation cannot be avoided. To minimize the effect of radiation, protection is required for the safety of the environment and human life. Hence, inventing a better shield than a conventional shielding material is the priority of researchers. Due to this reason, this current research deals with an innovative shielding material named EKZ samples having a composition of (epoxy resin (90-40) wt %-kaolin clay (10-25) wt %-ZnO-nano particles (0-35) wt %). The numerous compositional variations of (epoxy resin, kaolin clay, and ZnO-nano particles on the prepared EKZ samples varied the density of the samples from 1.24 to 1.95 g/cm3. The radiation shielding parameter of linear attenuation coefficient (LAC), half value layer (HVL), tenth value layer (TVL), and radiation protection efficiency (RPE) were measured to evaluate the radiation diffusion efficiency of newly made EKZ samples. These radiation shielding parameters were measured with the help of the HPGe detector utilizing the three-point sources (Am-241, Cs-137, and Co-60). The obtained results exposed that the value of linear attenuation coefficient (LAC) and radiation protection efficiency (RPE) was maximum, yet the value of half value layer (HVL), and tenth value layer (TVL), were minimum due to the greater amount of kaolin clay and ZnO-nanoparticles, whereas the amount of epoxy resin was lesser. In addition, it has been clear that as-prepared EKZ samples are suitable for low-dose shielding applications as well as EKZ-35 showed a better shielding ability.

3.
Ann Med ; 54(1): 1938-1951, 2022 12.
Artigo em Inglês | MEDLINE | ID: mdl-35801810

RESUMO

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.


Assuntos
Epilepsia , Canal de Sódio Disparado por Voltagem NAV1.1 , Epilepsia/tratamento farmacológico , Epilepsia/genética , Humanos , Canal de Sódio Disparado por Voltagem NAV1.1/genética , Canal de Sódio Disparado por Voltagem NAV1.2/genética , Canal de Sódio Disparado por Voltagem NAV1.3/genética , Polimorfismo Genético , Prognóstico , Arábia Saudita , Canais de Sódio/genética , Subunidade beta-1 do Canal de Sódio Disparado por Voltagem/genética
4.
Healthcare (Basel) ; 9(12)2021 Nov 28.
Artigo em Inglês | MEDLINE | ID: mdl-34946376

RESUMO

Background: Food poisoning is caused by eating contaminated food. Improper food safety knowledge, poor food handling, and inadequate personal hygiene may allow microbes to grow in sufficient numbers to cause a food-borne illness. The aim of this paper was to assess the knowledge, attitudes, and practices regarding food poisoning and its determinants of parents in the Aseer region of Saudi Arabia. Methodology: This is a descriptive cross-sectional study conducted on 3011 parents in the Aseer region in the southwest region of Saudi Arabia. An online questionnaire was used to collect the data. The level of knowledge of the participants was scored as a percentage and further classified as "good" or "poor". Attitudes were classified as "positive", "neutral", or "negative" based on a calculated composite mean score. The participants were asked about standard food hygiene practices, and the practices were recorded based on how often they were performed, with the results recorded as "usually", "sometimes", or "never". Results: The age range of the parents was between 18 and 65 years old, with a mean age of 28.9 ± 10.4 years. Among the participants, 96.2% were Saudi, and 81.8% were female. Almost 53% of the fathers and 41% of the mothers were university graduates. About 55% of the mothers were housewives. Almost equal proportions of the parents had "good" and "poor" levels of knowledge on food poisoning. Around 41% of the parents had positive attitudes towards safe food consumption. Older parents (defined as above 30 years of age), males, university graduates, and urban residents had significantly higher levels of knowledge regarding food poisoning. Conclusions: This study provided much needed information on the knowledge, attitudes, and practices related to food poisoning among parents in the Aseer region of Saudi Arabia. Although most respondents reported satisfactory practices, gaps were identified in knowledge and attitudes. This suggests a need for further investigation focused on the observed practices and strengthening health education activities for the community.

5.
J Family Med Prim Care ; 10(9): 3464-3469, 2021 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-34760774

RESUMO

BACKGROUND: Well-baby clinic (WBC) service is implemented in all primary health care centers and is provided based on international standards to all children under 5 years in Saudi Arabia. It is a comprehensive package of health promotion and curative care to improve and maintain the health status and well-being of this age group. AIM: The main aim is to assess parents' awareness and perception regarding WBC in primary health care centers in Abha sector, Kingdom of Saudi Arabia (KSA). METHODOLOGY: A descriptive cross-sectional approach was used in the current study. The study targeted all babies' caregivers attending WBCs in primary health care centers in Abha city. The children's parents were included using three stages cluster sample technique. The questionnaire included participants' demographic data such as age, gender, relation to the baby, educational level, work, and monthly income. Awareness regarding the WBC was assessed using two main items covering hearing about the clinic provided services. RESULTS: The study included 1593 participants whose ages ranged from 19 to 55 years old with a mean age of 34.6 ± 11.8 years. About 64% of the respondents knew about the WBC, which was significantly higher among the females than males (P = .003). Also, 71.2% of respondents aged 25-34 years knew about well-baby clinic (WBC) compared to 35% of parents aged less than 25 years (P = .001). Exact 57.1% of the respondents went to the nearest governmental health office at vaccination times. About 46% of the respondents reported that the clinic nurse was the main person who dealt with them. Regarding services provided by a nurse at the vaccination clinic, registering child vaccination was the most reported (66.2%), followed by helping the mother make the child calm (56.8%). CONCLUSIONS: In conclusion, the study revealed that proper care is vital for a child's survival as well as optimal physical and mental development. Adequately cared child has proper well-being and happiness. Mothers and children caregivers had adequate awareness and acceptable attitude towards WBCs and provided services. Some barriers were declared including lack of available WBCs within the residence range, not all WBCs usually working, and more information should be provided about WBCs.

6.
Explore (NY) ; 16(4): 264-270, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32249199

RESUMO

BACKGROUND: We investigated and compared the effect of the radiofrequency electromagnetic field (RF-EM) emitted by a cell phone on the electrocardiogram and heart rate variability (HRV) of normotensive normal-weight and obese medical students. METHOD: Twenty medical student volunteers, normal weight (age = 23 ± 2, BMI = 23.05 ± 1.72) or obese (age = 24 ± 2, BMI = 32.39 ± 4.78), were exposed to a cell phone (1) close to the heart in silent mode, no ringing or vibrating; (2) close to the heart in ring and vibration mode; (3) next to the ear (brain) while listening; and (4) next to the ear while listening and speaking. RESULTS: The average basal HR of obese students significantly increased, while the PR interval; time domains, including standard deviation (SD) of all normal R-R intervals (SDNN), mean of the SD of all normal R-R intervals (SDNNi), SD of the average of normal R-R intervals (SDANN), and percentage of R-R intervals at least 50 ms different from the previous interval (pNN50); and high-power frequency (HF) decreased. The LF/HF ratio also significantly increased. The SDNN, SDNNi, SDANN, pNN50, and HF levels significantly decreased and the LF/HF significantly increased in normal-weight and obese individuals only when the phone was near the apex of the heart in ring and vibration mode. All changes were more profound in obese students. CONCLUSION: Keeping the phone in a chest pocket reduced the HRV of normal-weight and obese medical students and exaggerated the effect of obesity on sympathetic activation.


Assuntos
Telefone Celular , Campos Eletromagnéticos/efeitos adversos , Frequência Cardíaca/efeitos da radiação , Obesidade/fisiopatologia , Adulto , Pressão Sanguínea , Eletrocardiografia , Frequência Cardíaca/fisiologia , Humanos , Masculino , Arábia Saudita , Estudantes de Medicina
7.
J Food Biochem ; 44(1): e13094, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31702060

RESUMO

This study investigated the effect of the aqueous extract of Crataegus aronia on blood coagulation in rats. Rats (200 ± 10 g,) were divided into two groups (6 rats/each) of control or C. aronia-treated rats which treated with the vehicle or the extract (200 mg/kg) for 21 days. With normal liver structure, serum levels of ALT, AST and É£-GT, platelet count, and plasma levels of vWF, values of PT and aPTT were significantly increased in C. aronia-treated rats. Also, it lowered serum levels of vitamin K (VK) and plasma activities of FII, FV, FVII, FVIII, FIX, FX, and FXI and downregulated hepatic levels of the VK-dependent factors (FII, FVII, FIX, and FX). In addition, C. aronia reduced fecal levels of triglycerides and cholesterol and serum levels triglycerides, cholesterol, LDL-c, and vLDL-c. In conclusion, with the hypocoagulant effect of C. aronia activity involves VK-dependent and non-vitamin K-dependent factors. PRACTICAL APPLICATIONS: In this study, we are reporting for the first time an in vivo hypocoagulant effect of C. aronia in rats. Such effect involved both VK-dependent and independent factors. However, the decrease in the activity and expression of VK-dependent factors was associated with reduced fecal levels of TGs and CHOL and serum levels of TGs, CHOL, LDL-c, and vLDL-c. These data suggest a possible impairment in the VK absorption, transport, or hepatic uptake. These data encourage further pharmacological, translational, and clinical studies to isolate the active ingredients to investigate them at the human level.


Assuntos
Crataegus , Photinia , Animais , Coagulação Sanguínea , Fígado , Ratos , Vitamina K
8.
Arch Physiol Biochem ; 125(4): 311-320, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-29616829

RESUMO

This study investigated the effects of chronic supraphysiological dose of testosterone propionate administration cardiovascular function in rats from the perspective of haemostatic function including platelet functions, coagulation, and fibrinolysis. Testosterone significantly enhanced cardiac contractility by enhancing LVSP (10%), dp/dtmax (36.7%), dp/dtmin (14.6%) without altering heart rate, diastolic function, and serum lipid profile. While it has no effect on platelets count, thromboxane B2 levels, and platelet aggregation, testosterone significantly enhanced bleeding time and increased circulatory and thoracic aorta mRNA and protein levels of tPA (46.5%, 58.2%, and 74.3%, respectively) and significantly decreased those of PAI-1 (29.3%, 26.4%, and 32.8%, respectively). While there were no significant changes in PT and aPTT, mRNA and protein levels of prothrombin and factor VII were downregulated in the livers of the testosterone-treated rats (57.7% and 64.9%, respectively). Overall, chronic testosterone administration in rats may act as a cardio-protective agent by modulating haemostasis in rats.


Assuntos
Fibrinólise/efeitos dos fármacos , Hemostasia/efeitos dos fármacos , Contração Miocárdica/efeitos dos fármacos , Testosterona/administração & dosagem , Testosterona/farmacologia , Animais , Diástole/efeitos dos fármacos , Diástole/fisiologia , Frequência Cardíaca/efeitos dos fármacos , Lipídeos/sangue , Masculino , Agregação Plaquetária/efeitos dos fármacos , Ratos , Ratos Sprague-Dawley , Fatores de Tempo
9.
Platelets ; 30(5): 624-630, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-30102104

RESUMO

This study investigated the effect of testosterone deficiency and replacement on platelets function and aggregation, coagulation, and fibrinolysis in young adult healthy male rats. Rats were classified into three groups (n = 6/group) of either "a sham-operated+ vehicle," "an orchidectomized (ORX)+ vehicle," and "an ORX+testosterone propionate (0.5 mg/kg, 3X/week, S.C)." All treatments were carried out for 12 weeks. Our results showed that ORX rats had induced platelets aggregation and coagulation and inhibited fibrinolysis. ORX-induced rats had increased ratios of adenosine diphosphate-induced aggregation, shorter bleeding time, clotting time, prothrombin time, and activated partial thromboplastin time and their sera showed increased levels of thromboxane B2 and fibrinogen levels. Concomitantly, their plasma showed increased TPA-1 and decreased tissue plasminogen activator (tPA) levels. At molecular levels, the aorta of ORX-induced rats showed increased aortic mRNA and protein levels of plasminogen activator inhibitor-1 (PAI-1), protein levels of von Willebrand Factor (vWF) and decreased mRNA and protein levels of tPA, and their liver showed increased protein levels of prothrombin and factor VII. Testosterone post-therapy to ORX-induced rats significantly reversed all these hematological and molecular changes. In conclusion, independent of any other risk factors, testosterone deficiency induces platelets aggregation and hypercoagulation and inhibits fibrinolysis, effects that can be reversed by testosterone therapy.


Assuntos
Coagulação Sanguínea/efeitos dos fármacos , Fibrinólise/efeitos dos fármacos , Testosterona/farmacologia , Animais , Biomarcadores , Tempo de Sangramento , Modelos Animais de Doenças , Hemorragia/sangue , Hemorragia/diagnóstico , Hemorragia/tratamento farmacológico , Masculino , Orquiectomia , Tempo de Tromboplastina Parcial , Agregação Plaquetária/efeitos dos fármacos , Tempo de Protrombina , Ratos
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...