Comparison of ethanol-baited trap designs for ambrosia beetles in orchards in the eastern United States.

Ambrosia beetles (Coleoptera: Curculionidae: Scolytinae) are among the most devastating pests of orchards, nurseries, and forests. Improving trap design and ethanol lures for capturing ambrosia beetles is necessary to develop effective monitoring and management strategies. In this 2-year study, we assessed 4 trap designs and 3 commercially formulated ethanol lures to refine trapping methods tailored for orchard environments in the eastern United States. Our investigation included orchards in 2 regions, Georgia (pecan orchards) and New York (apple orchards), targeting major ambrosia beetle (Coleoptera: Curculionidae) pest species such as Xylosandrus crassiusculus (Motschulsky), X. compactus (Eichhoff), X. germanus (Blandford), and Anisandrus maiche (Stark). Among the trap designs evaluated, clear sticky cards were most effective for capturing ambrosia beetles across orchard locations. Notably, in Georgia, sticky cards paired with specific low-release ethanol lures demonstrated enhanced capture of X. crassiusculus and X. compactus, 2 key ambrosia beetle pests found infesting young pecan trees. Similarly, in New York, sticky cards baited with low-release ethanol lures captured the highest rates of X. germanus and A. maiche, thus indicating its suitability for diverse ambrosia beetle populations. Overall, our study provides practical implications for tailoring trapping protocols to optimize ambrosia beetle management strategies in orchard settings.

Warmer temperatures trigger insecticide-associated pest outbreaks.

BACKGROUND: Rising global temperatures are associated with emerging insect pests, reflecting earlier and longer insect activity, faster development, more generations per year and changing species' ranges. Insecticides are often the first tools available to manage these new threats. In the southeastern US, sweet potato whitefly (Bemisia tabaci) has recently become the major threat to vegetable production. We used data from a multi-year, regional whitefly monitoring network to search for climate, land use, and management correlates of whitefly activity. RESULTS: Strikingly, whiteflies were detected earlier and grew more abundant in landscapes with greater insecticide use, but only when temperatures were also relatively warm. Whitefly outbreaks in hotter conditions were not associated with specific active ingredients used to suppress whiteflies, which would be consistent with a regional disruption of biocontrol following sprays for other pests. In addition, peak whitefly detections occurred earlier in areas with more vegetable production, but later with more cotton production, consistent with whiteflies moving among crops. CONCLUSION: Altogether, our findings suggest possible links between warmer temperatures, more abundant pests, and frequent insecticide applications disrupting biological control, though this remains to be explicitly demonstrated. Climate-initiated pesticide treadmills of this type may become an increasingly common driver of emerging pest outbreaks as global change accelerates. © 2023 Society of Chemical Industry.

Biology, distribution, and management of invasive South American tomato leafminer, Tuta absoluta (Meyrick) (Lepidoptera; Gelechiidae), in Asia.

South American tomato leafminer, Tuta absoluta (Meyrick, 1917) (Lepidoptera: Gelechiidae), is native to South America, but is a major invasive and quarantine pest species in Europe, Africa, and Asia. It causes extensive damage of up to 100% yield loss in tomatoes (Solanum lycopersicum) in open and greenhouse conditions. Since its first invasion in Spain in 2006, it has spread rapidly into many countries in the Mediterranean and Western Europe and further invaded Africa and Asia. In Asia, it was first recorded in August 2009 in Turkey and spread to most South and East Asian countries. In this study, we reviewed existing work on the biology and distribution of T. absoluta in Asia, as well as the damage it causes. This review will help to develop efficient management tactics as well as establish quarantine and phytosanitary precautions in uninvaded countries.

Post-Application Field Persistence and Efficacy of Cordyceps javanica against Bemisia tabaci.

Previously, Cordyceps javanica Wf GA17, a causing agent of whitefly epizootics in southern Georgia, demonstrated superior temperature tolerance and higher virulence against the whitefly Bemisia tabaci than commercial strains in the laboratory. The post-application persistence and efficacy of this fungus against B. tabaci were compared with that of the commercially available C. javanica Apopka97 strain over a two-year field study in cotton and vegetable crops. When blastospores of both strains were applied alone, whitefly populations were not effectively suppressed. Thus, JMS stylet oil was added to fungal treatments for enhancing efficacy and persistence. For 0-day samples, all fungal treatments caused similar but significant levels of immature mortality regardless of fungal strain, propagule form (conidia vs. blastospores), and application method (alone or mixed with JMS). In follow-up samplings, Wf GA17 blastospores + JMS achieved higher control levels than other treatments in some trials, but the efficacy did not last long. The JMS oil alone caused significant mortality and suppressed whiteflies. Over 90% of spores lost viability 24 h after treatment in all fungal treatments. Across evaluation times, there was no difference between the two fungal strains (conidia or blastospores, alone or combined with JMS), but conidia persisted better than blastospores for both strains. Overall, the field persistence and efficacy of C. javanica did not last long; therefore, improved delivery methods and formulations are needed for enhancement.

Control efficacy of azadirachtin on the fall armyworm, Spodoptera frugiperda (J. E. Smith) by soil drenching.

The fall armyworm (FAW), Spodoptera frugiperda, is an important agricultural pest species native to the Western Hemisphere and has recently invaded to Africa and Asia. Owing to the development of pesticide resistance and environmental contamination, ecofriendly pesticides are desirable for FAW control. Azadirachtin is a plant-derived natural pesticide with low toxicity to humans and the natural environment. Azadirachtin is primarily applied by foliar spraying; however, this approach lowers the efficacy of controlling target insects owing to photodegradation and might give a harmful effect on nontarget beneficial insects. Thus, we investigated whether applying azadirachtin to soil improves FAW control and its toxicity to corn plants. Soil drainage of azadirachtin exhibited no phytotoxic effects on corn plants but significantly reduced the larval body weight and delayed the developmental period of each larval instar of FAW. Applying 10, 15, and 20 ppm azadirachtin to soil inhibited larval growth by 68%, 76%, and 91%, respectively. Furthermore, the survival rate of FAW gradually decreased when larvae were fed azadirachtin-treated corn leaves. Collectively, this is the first study suggesting the systemic efficacy of azadirachtin by soil drenching against FAW.

First Report of Impatiens Necrotic Spot Virus Infecting Lettuce in Arizona and Southern Desert Regions of California.

Impatiens necrotic spot virus (INSV; family Tospoviridae, genus Orthotospovirus) is a thrips-borne pathogen that infects a wide range of ornamental and vegetable crops. INSV was first reported in lettuce (Lactuca sativa) in the Salinas Valley of CA (Monterey County) in 2006 (Koike et al. 2008). Since then, the pathogen has continued to impact lettuce production in the region, causing severe economic losses with increasing incidence and severity in recent years. Tomato spotted wilt virus (TSWV), another tospovirus, also infects lettuce, but its occurrence is much less frequent than INSV (Kuo et al. 2014). While INSV has not been reported in the desert areas of CA and AZ, there are concerns that the virus could become established in this region. In early March 2021, symptoms resembling those caused by orthotospovirus infection were observed in several romaine and iceberg lettuce fields in the Yuma and Tacna regions of Yuma County, AZ. Symptoms included leaves that exhibited tan to dark brown necrotic spots, distorted leaf shapes, and stunted plant growth. Similar symptoms were also reported in romaine fields and one green leaf and iceberg lettuce field in the neighboring Imperial and Riverside Counties of CA. A total of 14 samples (5 from Tacna, 4 from Yuma, 4 from Imperial, 1 from Riverside) were tested using ImmunoStrips (Agdia, Elkhart, IN) for INSV and TSWV. Results confirmed the presence of INSV in 13 out of 14 samples, and the absence of INSV in one sample originating from Yuma. All 14 samples tested negative for TSWV. The 13 INSV positive samples were processed for RT-PCR validation. Total RNA was extracted from each sample using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). RT-PCR was performed with OneStep Ahead RT-PCR Kit (Qiagen) with primers to the N gene of INSV S RNA (Accession KF745140.1; INSV F = CCAAATACTACTTTAACCGCAAGT; INSV R = ACACCCAAGACACAGGATTT). All reactions generated a single amplicon at the correct size of 524 bp. One sample each from Yuma, Tacna, and Brawley (Imperial County), as well as a romaine lettuce sample collected from the Salinas Valley in March 2021, were sent for Sanger bi-directional sequencing (Eton Biosciences, San Diego, CA). Sequence analysis revealed that all three desert samples (Yuma, Tacna, and Brawley with Accessions OK340696, OK340697, OK340698, respectively) shared 100% sequence identity and 99.43% identity to the Salinas Valley 2021 sample (SV-L2, Accession OK340699). Additionally, all desert samples shared 99.24% sequence identity to the Salinas Valley lettuce isolate previously described in 2014 (SV-L1, Accession KF745140.1; Kuo et al. 2014), while the SV-L2 and SV-L1 sequences shared 99.43% identity. By the end of the season (April 2021) a total of 43 lettuce fields in Yuma County, AZ, and 9 fields in Imperial and Riverside Counties, CA were confirmed to have INSV infection using ImmunoStrips. Impacted fields included romaine, green leaf, red leaf, and head lettuce varieties, and both direct-seeded and transplanted lettuce, under conventional and organic management regimes. In AZ, INSV incidence in fields ranged between 0.2% and 33%, while in Imperial and Riverside Counties, CA, field incidence remained low at less than 0.1%. It is possible that INSV was introduced from the Salinas Valley of CA through the movement of infected lettuce transplants and/or thrips vectors. To our knowledge, this is the first report of INSV infecting lettuce in Arizona and the southern desert region of California.

Identification and Virulence of Cordyceps javanica Strain wf GA17 Isolated From a Natural Fungal Population in Sweetpotato Whiteflies (Hemiptera: Aleyrodidae).

A new strain of the entomopathogenic fungus, identified as Cordyceps javanica (Frieder. & Bally) Kepler, B. Shrestha & Spatafora (Hypocreales: Cordycipitaceae) wf GA17, was found naturally infecting the sweetpotato whitefly, Bemisia tabaci (Gennadius) MEAM1 in southern Georgia, US, in September 2017. The fungus was tested for pathogenicity and virulence in comparison with commercially available entomopathogenic fungal strains against several insect species in the laboratory. In specific, it was compared with Cordyceps fumosorosea (Wize) Kepler, B. Shrestha & Spatafora (Hypocreales: Cordycipitaceae) Apopka 97, Beauveria bassiana (Bals.-Criv.) Vuill. (Hypocreales: Cordycipitaceae) strain GHA, and Metarhizium brunneum Petch (Hypocreales: Clavicipitaceae) strain F52 for virulence against B. tabaci (4th instars) and cotton aphid, Aphis gossypii Glover (Hemiptera: Aphididae) (4th instars with or without wingbuds), on leaf-discs, and against last instars of pecan weevil Curculio caryae (Horn) (Coleoptera: Curculionidae) and citrus root weevil Diaprepes abbreviatus (L.) (Coleoptera: Curculionidae) in soil cups. Against B. tabaci, C. javanica exhibited higher mortality and mycosis development at 5 d post inoculation than other fungi. In assays against A. gossypii with and without wingbuds, C. javanica and C. fumosorosea had the highest mortality and mycosis levels and B. bassiana had the lowest; nymphs with wingbuds were more susceptible to some fungal infection than those without. Against C. caryae, B. bassiana was more effective than other fungi. For D. abbreviatus, B. bassiana also caused the highest mortality while M. brunneum had the lowest, with Cordyceps spp. being intermediate. Overall, the findings suggest high potential of the new strain, C. javanica wf GA17, for managing whiteflies and aphids, while it was not as effective as B. bassiana against the curculionids.

Assessing Feeding Damage from Two Leaffooted Bugs, Leptoglossus clypealis Heidemann and Leptoglossus zonatus (Dallas) (Hemiptera: Coreidae), on Four Almond Varieties.

Leaffooted bugs (Leptoglossus spp; Hemiptera: Coreidae) are phytophagous insects native to the Western Hemisphere. In California, Leptoglossus clypealis and Leptoglossus zonatus are occasional pests on almonds. Early season feeding by L. clypealis and L. zonatus leads to almond drop, while late season feeding results in strikes on kernels, kernel necrosis, and shriveled kernels. A field cage study was conducted to assess feeding damage associated with L. clypealis and L. zonatus on four almond varieties, Nonpareil, Fritz, Monterey, and Carmel. The objectives were to determine whether leaffooted bugs caused significant almond drop, to pinpoint when the almond was vulnerable, and to determine the final damage at harvest. Branches with ~20 almonds were caged and used to compare almond drop and final damage in four treatments: (1) control branches, (2) mechanically punctured almonds, (3) adult Leptoglossus clypealis, and (4) adult Leptoglossus zonatus. Replicates were set up for eight weeks during two seasons. Early season feeding resulted in higher almond drop than late season, and L. zonatus resulted in greater drop than L. clypealis. The almond hull width of the four varieties in the study did not influence susceptibility to feeding damage. The final damage assessment at harvest found significant levels of kernel strikes, kernel necrosis, and shriveled almonds in bug feeding cages, with higher levels attributed to L. zonatus than L. clypealis. Further research is warranted to develop an Integrated Pest Management program with reduced risk controls for L. zonatus.

Tracking neonicotinoids following their use as cotton seed treatments.

Neonicotinoids are a leading class of insecticides on the global market, accounting for nearly 25%. They are widely used in both agricultural and residential settings. Causing neuron failure by irreversibly binding to the insect nicotinic acetylcholine receptor, neonicotinoids offer broad spectrum efficacy against a variety of pests. However, because they are non-selective with regard to insect species, there has been some concern with neonicotinoid use over threats to pollinators such as honeybees, and potential indirect effects to migratory waterfowl as a result of invertebrate prey population depletion. In order to study occurrence and fate of neonicotinoids (thiamethoxam and imidacloprid), we analyzed cotton leaves on plants grown from neonicotinoid-treated seeds and corresponding soil samples between cotton rows. Neonicotinoid concentration data from cotton leaves appears to be consistent with the claim that seed treatments protect plants for 3-4 weeks; by 30 days post-planting, neonicotinoid concentrations fell, in general, to 200 ng/g or lower. This represents about a 10-fold decrease from plant concentrations at approximately 2 weeks post-planting. It was found that neonicotinoids used as seed treatments remained present in the soil for months post planting and could be available for runoff. To that end, 21 playa wetlands were sampled; 10 had at least one quantifiable neonicotinoid present, three of which were classified as grassland or rangeland playas, two were urban, and the remaining five were cropland playas. In several instances, neonicotinoid concentrations in playas exceeded EPA chronic benchmarks for aquatic invertebrates.

Population genetic structure of Pseudatomoscelis seriatus (Hemiptera: Miridae) in the cotton-growing regions of the United States.

The cotton fleahopper, Pseudatomoscelis seriatus (Reuter) (Hemiptera: Miridae) is an economically important insect pest of cotton in the United States. However, reports of cotton fleahopper infestation and its management in cotton fields are restricted primarily to Texas, Oklahoma, and Arkansas. The objective of this study was to understand the genetic diversity of cotton fleahopper populations infesting cotton in the cotton-growing areas of the United States. Amplified fragment length polymorphism markers were used to detect genetic diversity and to characterize geographic genotypes across the distribution of the cotton fleahopper in the United States. We used 172 individuals and 559 amplified fragment length polymorphism loci in this study and found significant, but low, level of genetic differentiation among geographic populations (F(ST) = 0.02; P < 0.0001). Molecular fingerprints of cotton fleahopper populations were partitioned into three broad regional genetic populations with a western, central, and eastern distribution. The western (Arizona) and eastern (Florida, Georgia, South Carolina, and North Carolina) populations are genetically distinct, whereas the central (Texas, Oklahoma, Arkansas, Mississippi, Louisiana, and Alabama) population represents an admixed population, which include both western and eastern populations. These results suggest considerable gene flow among the populations within regions but restricted gene flow among populations from eastern and western region.

Compensation of Lygus hesperus induced preflower fruit loss in cotton.

A 3-yr field study quantified the compensatory ability of cotton (Gossypium hirsutum L.) to preflower fruit damage by Lygus hesperus Knight in the Texas High Plains under limited irrigation. Experiments were designed to achieve varying levels of preflower fruit loss by augmenting Lygus bug populations using nymphal bugs reared in a laboratory colony. Treatments included 1) three bugs per plant (3PP), 2) one bug per plant (1PP), 3) naturally occurring background bug density or untreated control (NC), and 4) 0 bugs achieved through insecticide spray applications (SC). Lygus release treatments (3PP and 1PP) were initiated at early fruiting (squaring) and repeated weekly for a total of three consecutive weeks. Two levels of Lygus bug infestations, one insect per plant (1PP) and three insects per plant (3PP), inflicted fruit loss percentages of 24-38 during the maximum fruit set period. Observations on the number of fruit lost at the crop preharvest stage indicate that plants receiving the 3PP and 1PP treatments exhibited higher ability to restrain physiological fruit loss when compared with the two control treatments (NC and SC). Cotton plants could not fully compensate the yield loss because of fruit damage caused by Lygus bugs at the observed level of damage. The total lint yields in the 1PP and 3PP treatments were 114 and 118 kg/ha lower, respectively, compared with that in treatment SC. The reduction in yield was primarily because of the loss of first fruiting position bolls. However, lint yields from bolls other than first position of the cotton plant were similar across treatments. Fiber quality data indicated an increase in fiber length from insect release treatment plants compared with the two control treatments.

Host preference of cotton fleahopper, Pseudatomoscelis seriatus (Reuter) is not labile to geographic origin and prior experience.

Several phytophagous insects exhibit distinct preference for their host plants. In widely distributed generalist insects, host preference can be influenced by geographic variation in host plant distribution and abundance as well as by prior experience. We have studied host preference of the cotton fleahopper, Pseudatomoscelis seriatus (Reuter), a pest of cotton in Texas and other neighboring states, by measuring olfactory orientation to horsemint (Monarda punctata L.) and cotton (Gossypium hirsutum L.). Horsemint is one of the primary, native, wild hosts of cotton fleahopper during late-spring and early summer in Texas, and it is commonly believed to be the main source of this pest in cotton. Although the abundance of horsemint, and therefore the fleahopper exposure to it, varies geographically, cotton fleahopper's preference for this native host-plant is maintained across two ecoregions in Texas, TX High Plains (Lubbock area) and Brazos Valley (College Station area). Similarly, preference for horsemint was retained regardless of prior experience with cotton throughout all the life stages of the insect. This fixed preference of cotton fleahopper to horsemint could be because of their ancestral insect-plant interaction, better fitness of cotton fleahopper on horsemint, and relatively low abundance of horsemint compared with cotton. Information gained from this study could be used to implement cultural control practices such as trap cropping, to develop attractants to monitor this pest, or both.

Controlling morphology of peptide-based soft structures by covalent modifications.

Control of gross morphology of soft matter remains an area of continued interest. Towards this goal, this paper describes conjugation of mannose residues and introduction of thiol functionalities to diphenylalanine (FF) dipeptide, a fibrillating motif from amyloid-ß peptide, as covalent modifiers of its solution-phase self-assembly process. It was found that covalent attachment of a single mannose residue to FF leads to the retention of tubular structures, whereas the conjugation of two mannose units, linked through a Lys residue, resulted in a dramatic change from tubular morphology to spherical structures. However, a similar switch to spherical objects could be achieved by introducing a thiol residue in the mono-mannosylated FF dipeptide. Interestingly, these glycopeptides also exhibited interaction with concanavalin A, thereby providing an indirect evidence for the availability of mannose units for the process of lectin-carbohydrate interaction in the self-organized state.

Peptide-based synthetic design, construction and morphology of soft structures.

Peptide-based self-assembly offers a unique entry into the construction of soft structures with interesting material properties and functions. Aromatic amino acid-containing peptides are commonly employed as they exhibit high propensity to aggregate due to increased hydrophobic content, promotion of favorable secondary structures, planarity and the possibility of π-π interactions. Incorporation of covalent scaffolds, stimuli-responsive handles and carbohydrate moieties augment beneficial characteristics to the resulting peptide conjugates. These modifications were shown to enforce self-association, elicit stimuli response and achieve improved hydrophilic properties, to name but a few.