RESUMO
Strawberries in southern California have shown decline symptoms during the last 2 years. More than 70% of plants tested in California were infected with two newly identified criniviruses that infect strawberry (Strawberry pallidosis and Beet pseudo-yellows). Strawberry cultivars are usually symptomless when infected with one virus, and testing for other strawberry viruses is performed to identify any other viruses that may be involved in the symptomatology. Primers SLRSV F (5' CCTCTCCAACC-TGCTAGACT 3') and SLRSV R (5' AAGCGCATGAAGGTGTAACT 3') that amplify a 497-bp fragment of RNA 2 of Strawberry latent ringspot virus (SLRSV) were developed and utilized for reverse transcription-polymerase chain reaction (RT-PCR) detection. SLRSV belongs to the family Sequiviridae and is transmitted by nematodes of the genus Xiphinema. The virus has a broad host range (4) and is usually symptomless in strawberries. Strawberry plants from commercial fields in California, Oregon, Washington, and British Columbia, Canada were tested. SLRSV was identified in 17% of plants tested from California and 4% of plants tested from British Columbia, while all samples from Oregon and Washington tested negative. The fragment amplified (GenBank Accession No. AY461735, isolate from British Columbia, Canada) shares 84% nucleotide and 94% amino acid sequence identity with the previously published sequence of SLRSV from strawberry (GenBank Accession No. X77466) (3). The virus was transmitted mechanically from strawberry samples from Canada to Chenopodium quinoa, and the infected C. quinoa plants tested positive for SLRSV with RT-PCR, while no amplicons were obtained from noninoculated control plants. To our knowledge, this is the first report of SLRSV in strawberry in North America, although it has been previously reported in a single cherry tree in Ontario, Canada (1) and in an imported seed lot of parsley in California (2). The number of plants that tested positive as well as the geographic distribution of the virus indicates that the virus is widespread in California, but further testing is needed to identify its distribution in other states. References: (1) W. R. Allen et al. Phytopathology 60:1262, 1970. (2) C. M. Hanson and R. N. Campbell. Plant Dis. Rep. 63:142, 1979. (3) S. Kreiah et al. J. Gen. Virol. 75:2527, 1994. (4) K. Schmelzer. Phytopath. Z. 66:1, 1969.
RESUMO
Mammalian hexokinase types one and three (HK1 and HK3) are 100 kDa isozymes that phosphorylate glucose to glucose-6-phosphate. HK1 is present in most tissues but is especially prominent in brain and kidney. HK3 is less well studied, but may be most prominent in the spleen and lymphocytes. In this study, we determined the ontogeny of the expression of these isoforms in the rat. Using immunohistochemistry, we identified HK1 and HK3 immunoreactivity in the brain, heart, kidney, liver, skeletal muscle and spleen from gestational day 14 (E14) to 45 days after birth (P45). With the exception of the liver and spleen, we observed a similar age- and cell-dependent staining pattern for both isoforms in all organs studied. The brain and spleen were analyzed in more detail to identify specific regions of immunoreactivity during maturation. A transient expression of HK1 and HK3 was noted in the cell bodies of mature neurons, including layers V and VI of the cerebral cortex and the cerebellar Purkinje cells followed by localization to the white matter of the cerebrum and cerebellum. In the spleen, HK3 immunoreactivity was detected postnatally and appeared to track with the infiltration of B cells. Our demonstration of changing patterns of immunoreactivity for HK1 and HK3 in fetal and postnatal organs suggests that these HK isoforms are involved the process of development. We speculate that HK1 and HK3 share a complex interaction during development of these organs and regulate glucose metabolism at multiple levels during development.
Assuntos
Regulação da Expressão Gênica no Desenvolvimento/fisiologia , Regulação Enzimológica da Expressão Gênica/fisiologia , Hexoquinase/genética , Isoenzimas/genética , Animais , Anticorpos Monoclonais , Encéfalo/enzimologia , Idade Gestacional , Imuno-Histoquímica , Rim/enzimologia , Fígado/enzimologia , Músculo Esquelético/enzimologia , Miocárdio/enzimologia , Ratos , Ratos Sprague-Dawley , Baço/enzimologiaRESUMO
Fifty-eight primiparous women were studied to explore perceived differences in femininity between women who chose to breastfeed and women who chose to bottlefeed. A demographic questionnaire and a sex role inventory were administered to the sample. Although breast and bottlefeeders did not differ significantly in their perceived levels of femininity, analysis of the data revealed that women who had no clear cut sense of identity were more likely to bottlefeed.
Assuntos
Alimentação com Mamadeira/psicologia , Aleitamento Materno/psicologia , Identidade de Gênero , Adulto , Alimentação com Mamadeira/estatística & dados numéricos , Aleitamento Materno/estatística & dados numéricos , Feminino , Humanos , North Carolina , Paridade , Fatores Socioeconômicos , Inquéritos e QuestionáriosRESUMO
Understanding how contrast is produced and controlled in computed tomography (CT) is essential to proper application of this modality. In the typical CT scanner, a narrow x-ray beam in the section thickness direction and an air gap in the section plane are used to reduce scatter and improve contrast. High- and low-contrast detectability of a CT scanner are important performance parameters contributing to optimal image quality. The limits of detectability of high-contrast objects (ie, spatial resolution) are affected by detector aperture size, pixel size of the image, algorithm used to reconstruct the image, and section thickness. Visibility of low-contrast objects is limited by image noise and the algorithm. Contrast in CT images can be controlled by the window level and window width settings used to display the image. These settings dictate how the actual measurements of tissue attenuation are translated into a gray-scale image. Wide window widths can be used to provide an accurate representation of bone, and narrow widths are more useful for visualizing soft tissues.
Assuntos
Intensificação de Imagem Radiográfica/métodos , Tomografia Computadorizada por Raios X/métodos , Meios de Contraste , Humanos , Tecnologia RadiológicaRESUMO
We have developed a Fabry-Perot interferometer and image-plane detector system to be used as a receiver for a Doppler lidar. This system incorporates the latest technology in multichannel detectors, and it is an important step toward the development of operational wind profiler systems for the atmosphere (troposphere, stratosphere, and lower mesosphere). The instrumentation includes a stable highresolution optically contacted plane talon and a multiring anode detector to scan the image plane of the Fabry-Perot interferometer spatially. The high wavelength resolution provided by the interferometer permits the aerosol and molecular components of the backscattered signal to be distinguished, and the Doppler shift of either component can then be used to determine the wind altitude profile. The receiverperformance has been tested by measuring the wind profile in the boundary layer. The Fabry-Perot interferometer and image-plane detector characteristics are described and sample measurements are presented. The potential of the system as a wind profiler in the troposphere, the stratosphere, and the mesosphere is also considered.
RESUMO
The Vietnam Era Twin Registry consists of 4,774 male-male twin pairs born between 1939 and 1957 with both brothers having served in the United States military during the Vietnam War. The registry was originally developed to provide the best control group for Vietnam-exposed servicemen to study the long-term health consequences of service in Vietnam. Recognizing the potential value of the registry for other areas of medical research, the Department of Veterans Affairs in 1988 opened the registry for use by both VA and non-VA investigators. The existence of centralized VA data bases for deaths and VA hospitalizations will strengthen future followup of the twins. This article describes the characteristics of the registry population and the process for accessing the registry.
Assuntos
Sistema de Registros , Gêmeos/estatística & dados numéricos , Veteranos/estatística & dados numéricos , Adulto , Demografia , Humanos , Masculino , Pessoa de Meia-Idade , Estados Unidos , United States Department of Veterans AffairsRESUMO
Xenon computerized tomography (Xe CT) blood flow studies were conducted in 25 patients referred for a possible extracranial-intracranial bypass procedure for occlusive vascular disease in one or more extra- or intracranial vessels. These studies were helpful in selecting eight candidates for surgery. The Xe CT studies were performed at one or two brain levels using a prototype Xe CT system for measurement of cerebral blood flow which was designed in collaboration with the General Electric Co., and adapted for the GE 9800 scanner. In those patients selected to undergo operation, Xe CT demonstrated compromise of flow reserve regionally, globally, and/or in the watershed area. All eight patients who underwent the procedure showed a favorable clinical response postoperatively, and seven had a dramatic increase in flow. The 17 patients whose baseline CT studies showed no reduction of flow with the Xe CT method were not selected for surgery. All 25 patients have remained neurologically stable to date. Case studies of three of the eight patients undergoing bypass surgery are presented. This limited but consistent experience suggests that Xe CT blood flow mapping makes possible the recognition of brain regions in which flow reserves are compromised. This is due to the relatively high degree of spatial resolution that this technique provides and to the fact that mapping can be correlated directly with the anatomy. Used in combination with a careful clinical examination and an accurate medical history, this study method appears to be a useful guide in the selection of patients who are most at risk from hemodynamic instability and those who are most likely to benefit from flow-augmentation surgery.
Assuntos
Arteriopatias Oclusivas/diagnóstico por imagem , Revascularização Cerebral , Circulação Cerebrovascular , Tomografia Computadorizada de Emissão , Idoso , Arteriopatias Oclusivas/cirurgia , Doenças das Artérias Carótidas/diagnóstico por imagem , Doenças das Artérias Carótidas/cirurgia , Artéria Carótida Interna , Artérias Cerebrais/diagnóstico por imagem , Artérias Cerebrais/cirurgia , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Radioisótopos de XenônioRESUMO
Computed tomography (CT) using metrizamide is a valuable tool in the neuroradiologic evaluation of the spinal cord, but CT must be used with care when measuring object size because size may vary with different window center (level) settings. A simple method to determine appropriate window center (level) settings during CT object measurement is described. A polystyrene core with a Teflon outer cylinder designed to simulate the spinal column, spinal cord, and subarachnoid space was scanned with varying concentrations of metrizamide with an EMI 1010 unit. Computer printouts of the CT pixel matrix were analyzed and a constant relationship of the phantom cord true size to the CT numbers of the metrizamide concentration and the phantom spinal cord was found. Window center (level) selection greatly influences measurement of cord size, whereas window width dose not. The appropriate window center (level) selection is the mean between the metrizamide CT attenuation number and the cord CT attenuation number.
Assuntos
Metrizamida , Mielografia/métodos , Tomografia Computadorizada por Raios X/métodos , Estudos de Avaliação como Assunto , Tecnologia RadiológicaAssuntos
Neoplasias Laríngeas/terapia , Pólipos/terapia , Prega Vocal , Treinamento da Voz , Adulto , Animais , Feminino , HumanosRESUMO
Xeroradiographs were exposed over a range of mAs and kVp in the mammographic energy range. At each kVp, the technique yielding the widest halo also produced the greatest detectability of small aluminum specks in mammographic phantoms. As the kVp increased, the maximum halo width and number of visible specks decreased. At all kVps, the techniques yielding the widest halo furnished almost constant energy deposition in the selenium plate. This constant plate dose was correlated to patient exposure at the entrance of the breast, and the relationships between patient entrance exposure, kVp, and minumum detectable speck size were determined.
Assuntos
Xerorradiografia/métodos , Feminino , Humanos , Doses de Radiação , Tecnologia Radiológica , Xeromamografia/métodosRESUMO
The pattern of photosynthetic carbon metabolism was determined in tissue cultures of Portulaca oleracea. Four-carbon acids are the most heavily labeled photosynthetic products during short term exposure to (14)CO(2), containing greater than 40% of the total radioactivity incorporated. Phosphoglyceric acid and sugars account for only 10% of the label after equal exposure times. Other features of the CO(2) assimilation pattern in Portulaca callus tissue include a relatively large percentage of label located in various minor products throughout the time course studied, and a greater incorporation of (14)C into sugars in tissue cultures than occurs in leaves. Ultrastructurally, the chloroplasts and cells of the callus are like those in the mesophyll cells of Portulaca leaves. The requirement for Kranz anatomy for operation of functional C(4) physiology is discussed.
Assuntos
Radioisótopos de Cobalto/análise , Aerossóis , Animais , Carga Corporal (Radioterapia) , Osso e Ossos/análise , Cobalto , Radioisótopos de Cobalto/sangue , Radioisótopos de Cobalto/urina , Cães , Marcação por Isótopo , Rim/análise , Fígado/análise , Pulmão/análise , Linfonodos/análise , Óxidos , Fatores de Tempo , Traqueia/análiseRESUMO
Given the limitations of available material and methods for measuring skin response, the relative biological effectivenss (RBE) for the development and healing of skin reaction to pions in this experiment is 1.43. This is based on data obtained from a patient with malignant melanoma, in whom multiple skin nodules and the surrounding normal skin were randomized into three dose levels for pions and x-rays. The RBE for skin reaction was obtained while the skin tumor nodules appeared to regress at least as rapidly with pion therapy as with x-rays. Without benefit of adequate observation of time required for nodule regrowth, any estimate of tumor RBE is speculative.
Assuntos
Melanoma/radioterapia , Efeitos da Radiação , Neoplasias Cutâneas/radioterapia , Pele/efeitos da radiação , Relação Dose-Resposta à Radiação , Transferência de Energia , Humanos , Metástase Neoplásica , Dosagem Radioterapêutica , Raios XRESUMO
Ionization chambers often exhibit a stem effect, caused by interactions of radiation with air near the chamber end, or with dielectric in the chamber stem or cable. These interactions contribute to the apparent measured exposure. To determine the stem efffect for several common ionization chamber systems, exposures were measured with TLD capsules placed at the center of 60Co fields of various sizes. These exposure measurements then were repeated with various ionization chamber systems, including two Victoreen R meters (25- and 100-R chambers), a Capintec 192 dosimeter with a Farmer 0.6-cm3 probe, a PTW transit dose probe, and an EG and G IC-18 probe with a Keithley 610-B electrometer. From a comparison of TLD and ionization chamber measurements of the variation in exposure rate with field size, stem corrections for the different systems were determined within 1%.