Antiviral activity of porphyrins and porphyrin-like compounds against tick-borne encephalitis virus: Blockage of the viral entry/fusion machinery by photosensitization-mediated destruction of the viral envelope.

Tick-borne encephalitis virus (TBEV), the causative agent of tick-borne encephalitis (TBE), is a medically important flavivirus endemic to the European-Asian continent. Although more than 12,000 clinical cases are reported annually worldwide, there is no anti-TBEV therapy available to treat patients with TBE. Porphyrins are macrocyclic molecules consisting of a planar tetrapyrrolic ring that can coordinate a metal cation. In this study, we investigated the cytotoxicity and anti-TBEV activity of a large series of alkyl- or (het)aryl-substituted porphyrins, metalloporphyrins, and chlorins and characterized their molecular interactions with the viral envelope in detail. Our structure-activity relationship study showed that the tetrapyrrole ring is an essential structural element for anti-TBEV activity, but that the presence of different structurally distinct side chains with different lengths, charges, and rigidity or metal cation coordination can significantly alter the antiviral potency of porphyrin scaffolds. Porphyrins were demonstrated to interact with the TBEV lipid membrane and envelope protein E, disrupt the TBEV envelope and inhibit the TBEV entry/fusion machinery. The crucial mechanism of the anti-TBEV activity of porphyrins is based on photosensitization and the formation of highly reactive singlet oxygen. In addition to blocking viral entry and fusion, porphyrins were also observed to interact with RNA oligonucleotides derived from TBEV genomic RNA, indicating that these compounds could target multiple viral/cellular structures. Furthermore, immunization of mice with porphyrin-inactivated TBEV resulted in the formation of TBEV-neutralizing antibodies and protected the mice from TBEV infection. Porphyrins can thus be used to inactivate TBEV while retaining the immunogenic properties of the virus and could be useful for producing new inactivated TBEV vaccines.

Hexahelicene DNA-binding: Minor groove selectivity, semi-intercalation and chiral recognition.

In this contribution, we focused on a fundamental study targeting the interaction of water-soluble [6]helicene derivative 1 (1-butyl-3-(2-methyl[6]helicenyl)-imidazolium bromide) with double-stranded (ds) DNA. A synthetic 30-base pair duplex, plasmid, chromosomal calf thymus and salmon DNA were investigated using electrochemistry, electrophoresis and spectroscopic tools supported by molecular dynamics (MD) and quantum mechanical approaches. Both experimental and theoretical work revealed the minor groove binding of 1 to the dsDNA. Both the positively charged imidazole ring and hydrophobic part of the side chain contributed to the accommodation of 1 into the dsDNA structure. Neither intercalation into the duplex DNA nor the stable binding of 1 to single-stranded DNA were found in topoisomerase relaxation experiments with structural components of 1, i.e. [6]helicene (2) and 1-butyl-3-methylimidazolium bromide (3), nor by theoretical calculations. Finally, the binding of optically pure enantiomers (P)-1 and (M)-1 was studied using circular dichroism spectroscopy, isothermal titration calorimetry and UV Resonance Raman (UVRR) methods. Using MD and quantum mechanical methods, minor groove and semi-intercalation were proposed for compound 1 as the predominant binding modes. From the UVRR findings, we also can conclude that 1 tends to preferentially interact with adenine and guanine residues in the structure of dsDNA.

Assessing the Anthelmintic Candidates BLK127 and HBK4 for Their Efficacy on Haemonchus contortus Adults and Eggs, and Their Hepatotoxicity and Biotransformation.

As a widely distributed parasitic nematode of ruminants, Haemonchus contortus has become resistant to most anthelmintic classes, there has been a major demand for new compounds against H. contortus and related nematodes. Recent phenotypic screening has revealed two compounds, designated as BLK127 and HBK4, that are active against H. contortus larvae. The present study was designed to assess the activity of these compounds against H. contortus eggs and adults, hepatotoxicity in rats and sheep, as well as biotransformation in H. contortus adults and the ovine liver. Both compounds exhibited no inhibitory effect on the hatching of eggs. The benzyloxy amide BLK127 significantly decreased the viability of adults in sensitive and resistant strains of H. contortus and showed no hepatotoxic effect, even at the highest concentration tested (100 µM). In contrast, HBK4 had no impact on the viability of H. contortus adults and exhibited significant hepatotoxicity. Based on these findings, HBK4 was excluded from further studies, while BLK127 seems to be a potential candidate for a new anthelmintic. Consequently, biotransformation of BLK127 was tested in H. contortus adults and the ovine liver. In H. contortus, several metabolites formed via hydroxylation, hydrolysis and glycosidation were identified, but the extent of biotransformation was low, and the total quantity of the metabolites formed did not differ significantly between the sensitive and resistant strains. In contrast, ovine liver cells metabolized BLK127 more extensively with a glycine conjugate of 4-(pentyloxy)benzoic acid as the main BLK127 metabolite.

Guanine quadruplexes in the RNA genome of the tick-borne encephalitis virus: their role as a new antiviral target and in virus biology.

We have identified seven putative guanine quadruplexes (G4) in the RNA genome of tick-borne encephalitis virus (TBEV), a flavivirus causing thousands of human infections and numerous deaths every year. The formation of G4s was confirmed by biophysical methods on synthetic oligonucleotides derived from the predicted TBEV sequences. TBEV-5, located at the NS4b/NS5 boundary and conserved among all known flaviviruses, was tested along with its mutated variants for interactions with a panel of known G4 ligands, for the ability to affect RNA synthesis by the flaviviral RNA-dependent RNA polymerase (RdRp) and for effects on TBEV replication fitness in cells. G4-stabilizing TBEV-5 mutations strongly inhibited RdRp RNA synthesis and exhibited substantially reduced replication fitness, different plaque morphology and increased sensitivity to G4-binding ligands in cell-based systems. In contrast, strongly destabilizing TBEV-5 G4 mutations caused rapid reversion to the wild-type genotype. Our results suggest that there is a threshold of stability for G4 sequences in the TBEV genome, with any deviation resulting in either dramatic changes in viral phenotype or a rapid return to this optimal level of G4 stability. The data indicate that G4s are critical elements for efficient TBEV replication and are suitable targets to tackle TBEV infection.

G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly.

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.

Diversity of Parallel Guanine Quadruplexes Induced by Guanine Substitutions.

Recently, we reported an inhibitory effect of guanine substitutions on the conformational switch from antiparallel to parallel quadruplexes (G4) induced by dehydrating agents. As a possible cause, we proposed a difference in the sensitivity of parallel and antiparallel quadruplexes to the guanine substitutions in the resulting thermodynamic stability. Reports on the influence of guanine substitutions on the biophysical properties of intramolecular parallel quadruplexes are rare. Moreover, such reports are often complicated by the multimerisation tendencies of parallel quadruplexes. To address this incomplete knowledge, we employed circular dichroism spectroscopy (CD), both as stopped-flow-assisted fast kinetics measurements and end-point measurements, accompanied by thermodynamic analyses, based on UV absorption melting profiles, and electrophoretic methods. We showed that parallel quadruplexes are significantly more sensitive towards guanine substitutions than antiparallel ones. Furthermore, guanine-substituted variants, which in principle might correspond to native genomic sequences, distinctly differ in their biophysical properties, indicating that the four guanines in each tetrad of parallel quadruplexes are not equal. In addition, we were able to distinguish by CD an intramolecular G4 from intermolecular ones resulting from multimerisation mediated by terminal tetrad association, but not from intermolecular G4s formed due to inter-strand Hoogsteen hydrogen bond formation. In conclusion, our study indicates significant variability in parallel quadruplex structures, otherwise disregarded without detailed experimental analysis.

Guanine Substitutions Prevent Conformational Switch from Antiparallel to Parallel G-Quadruplex.

Guanine quadruplexes, recently reported to form in vivo, represent a broad spectrum of non-canonical conformations of nucleic acids. The actual conformation might differ between water solutions and crowding or dehydrating solutions that better reflect the conditions in the cell. Here we show, using spectroscopic techniques, that most guanine substitutions prevent the conformational switch from antiparallel or hybrid forms to parallel ones when induced by dehydrating agents. The inhibitory effect does not depend on the position of the substitution, but, interestingly, on the type of substitution and, to some extent, on its destabilising potential. A parallel form might be induced in some cases by ligands such as N-methyl mesoporphyrin IX and even this ligand-induced switch is inhibited by guanine substitution. The ability or inability to have a conformation switch, based on actual conditions, might significantly influence potential conformation-dependent quadruplex interactions.

Systematic investigation of sequence requirements for DNA i-motif formation.

The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.

i-Motif of cytosine-rich human telomere DNA fragments containing natural base lesions.

i-Motif (iM) is a four stranded DNA structure formed by cytosine-rich sequences, which are often present in functionally important parts of the genome such as promoters of genes and telomeres. Using electronic circular dichroism and UV absorption spectroscopies and electrophoretic methods, we examined the effect of four naturally occurring DNA base lesions on the folding and stability of the iM formed by the human telomere DNA sequence (C3TAA)3C3T. The results demonstrate that the TAA loop lesions, the apurinic site and 8-oxoadenine substituting for adenine, and the 5-hydroxymethyluracil substituting for thymine only marginally disturb the formation of iM. The presence of uracil, which is formed by enzymatic or spontaneous deamination of cytosine, shifts iM formation towards substantially more acidic pH values and simultaneously distinctly reduces iM stability. This effect depends on the position of the damage sites in the sequence. The results have enabled us to formulate additional rules for iM formation.

Clustered abasic lesions profoundly change the structure and stability of human telomeric G-quadruplexes.

Ionizing radiation produces clustered damage to DNA which is difficult to repair and thus more harmful than single lesions. Clustered lesions have only been investigated in dsDNA models. Introducing the term 'clustered damage to G-quadruplexes' we report here on the structural effects of multiple tetrahydrofuranyl abasic sites replacing loop adenines (A/AP) and tetrad guanines (G/AP) in quadruplexes formed by the human telomere d[AG3(TTAG3)3] (htel-22) and d[TAG3(TTAG3)3TT] (htel-25) in K+ solutions. Single to triple A/APs increased the population of parallel strands in their structures by stabilizing propeller type loops, shifting the antiparallel htel-22 into hybrid or parallel quadruplexes. In htel-25, the G/APs inhibited the formation of parallel strands and these adopted antiparallel topologies. Clustered G/AP and A/APs reduced the thermal stability of the wild-type htel-25. Depending on position, A/APs diminished or intensified the damaging effect of the G/APs. Taken together, clustered lesions can disrupt the topology and stability of the htel quadruplexes and restrict their conformational space. These in vitro results suggest that formation of clustered lesions in the chromosome capping structure can result in the unfolding of existing G-quadruplexes which can lead to telomere shortening.

Diverse effects of naturally occurring base lesions on the structure and stability of the human telomere DNA quadruplex.

Various base lesions continuously form in cellular nucleic acids and the unrepaired lesions are promutagenic and procarcinogenic. Though natural base lesions have been extensively studied in double-stranded DNA models, these studies are only less than a decade old for non-canonical DNA models, such as quadruplexes. Here we present a report on the effects of three frequently occurring natural lesions that can form in the TTA loops on the structure of the human telomere quadruplex d[AG3(TTAG3)3]. We compared the effect of the abasic site and 8-oxoadenine replacing adenine and 5-hydroxymethyluracil substituting for thymine. The results showed that the three lesions impacted the stability and quadruplex folding in markedly different ways. The effects depended on the type of lesion and the position in the sequence. Analogous lesions of guanine in the G-tetrads extensively destabilized the quadruplex and the effects depended more on the position than on the type of lesion. The distinct effects of the loop substitutions as well as comparison of the modifications of the loops and the quadruplex tetrads are discussed in this communication.

Unique C. elegans telomeric overhang structures reveal the evolutionarily conserved properties of telomeric DNA.

There are two basic mechanisms that are associated with the maintenance of the telomere length, which endows cancer cells with unlimited proliferative potential. One mechanism, referred to as alternative lengthening of telomeres (ALT), accounts for approximately 10-15% of all human cancers. Tumours engaged in the ALT pathway are characterised by the presence of the single stranded 5'-C-rich telomeric overhang (C-overhang). This recently identified hallmark of ALT cancers distinguishes them from healthy tissues and renders the C-overhang as a clear target for anticancer therapy. We analysed structures of the 5'-C-rich and 3'-G-rich telomeric overhangs from human and Caenorhabditis elegans, the recently established multicellular in vivo model of ALT tumours. We show that the telomeric DNA from C. elegans and humans forms fundamentally different secondary structures. The unique structural characteristics of C. elegans telomeric DNA that are distinct not only from those of humans but also from those of other multicellular eukaryotes allowed us to identify evolutionarily conserved properties of telomeric DNA. Differences in structural organisation of the telomeric DNA between the C. elegans and human impose limitations on the use of the C. elegans as an ALT tumour model.

Loss of loop adenines alters human telomere d[AG3(TTAG3)3] quadruplex folding.

Abasic (AP) lesions are the most frequent type of damages occurring in cellular DNA. Here we describe the conformational effects of AP sites substituted for 2'-deoxyadenosine in the first (ap7), second (ap13) or third (ap19) loop of the quadruplex formed in K(+) by the human telomere DNA 5'-d[AG3(TTAG3)3]. CD spectra and electrophoresis reveal that the presence of AP sites does not hinder the formation of intramolecular quadruplexes. NMR spectra show that the structural heterogeneity is substantially reduced in ap7 and ap19 as compared to that in the wild-type. These two (ap7 and ap19) sequences are shown to adopt the hybrid-1 and hybrid-2 quadruplex topology, respectively, with AP site located in a propeller-like loop. All three studied sequences transform easily into parallel quadruplex in dehydrating ethanol solution. Thus, the AP site in any loop region facilitates the formation of the propeller loop. Substitution of all adenines by AP sites stabilizes the parallel quadruplex even in the absence of ethanol. Whereas guanines are the major determinants of quadruplex stability, the presence or absence of loop adenines substantially influences quadruplex folding. The naturally occurring adenine-lacking sites in the human telomere DNA can change the quadruplex topology in vivo with potentially vital biological consequences.

Circular dichroism spectroscopy of DNA: from duplexes to quadruplexes.

Nucleic acids bear the genetic information and participate in its expression and evolution during replication, repair, recombination, transcription, and translation. These phenomena are mostly based on recognition of nucleic acids by proteins. The major factor enabling the specific recognition is structure. Circular dichroism (CD) spectroscopy is very useful to study secondary structures of nucleic acids, in general, and DNA, in particular. CD sensitively reflects isomerizations among distinct conformational states. The isomerizations may operate as molecular switches regulating various physiological or pathological processes. Here, we review CD spectra of nucleic acids, beginning with early studies on natural DNA molecules through analyses of synthetic polynucleotides to study of selected genomic fragments.

Circular dichroism and guanine quadruplexes.

Circular dichroism (CD) is remarkably sensitive to the conformational states of nucleic acids; therefore, CD spectroscopy has been used to study most features of DNA and RNA structures. Quadruplexes are among the significant noncanonical nucleic acids architectures that have received special attentions recently. This article presents examples on the contribution of CD spectroscopy to our knowledge of quadruplex structures and their polymorphism. The examples were selected to demonstrate the potential of this simple method in the quadruplex field. As CD spectroscopy detects only the global feature of a macromolecule, it should preferably be used in combination with other techniques. On the other hand, CD spectroscopy, often as a pioneering approach, can reveal the formation of particular structural arrangements, to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters and also detect formation of higher order structures. This article aims to show that CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies.

8-oxoguanine in a quadruplex of the human telomere DNA sequence.

8-Oxoguanine is a ubiquitous oxidative base lesion. We report here on the effect of this lesion on the structure and stability of quadruplexes formed by the human telomeric DNA sequence 5'-dG(3)(TTAG(3))(3) in NaCl and KCl. CD, PAGE and absorption-based thermodynamic stability data showed that replacement of any of the tetrad-forming guanines by 8-oxoguanine did not hinder the formation of monomolecular, antiparallel quadruplexes in NaCl. The modified quadruplexes were, however, destabilized in both salts, the extent of this depending on the position of the lesion. These results and the results of previous studies on guanine-to-adenine exchanges and guanine abasic lesions in the same quadruplex show a noticeable trend: it is not the type of the lesion but the position of the modification that determines the effect on the conformation and stability of the quadruplex. The type of lesion only governs the extent of changes, such as of destabilization. Most sensitive sites were found in the middle tetrad of the three-tetrad quadruplex, and the smallest alterations were observed if guanines of the terminal tetrad with the diagonal TTA loop were substituted, although even these substitutions brought about unfavorable enthalpic changes. Interestingly, the majority of these base-modified quadruplexes did not adopt the rearranged folding induced in the unmodified dG(3)(TTAG(3))(3) by potassium ions, an observation that could imply biological relevance of the results.

Quadruplexes of human telomere dG(3)(TTAG(3))(3) sequences containing guanine abasic sites.

This study was performed to evaluate how the loss of a guanine base affects the structure and stability of the three-tetrad G-quadruplex of 5'-dG(3)(TTAG(3))(3), the basic quadruplex-forming unit of the human telomere DNA. None of the 12 possible abasic sites hindered the formation of quadruplexes, but all reduced the thermodynamic stability of the parent quadruplex in both NaCl and KCl. The base loss did not change the Na(+)-stabilized intramolecular antiparallel architecture, based on CD spectra, but held up the conformational change induced in dG(3)(TTAG(3))(3) in physiological concentration of KCl. The reduced stability and the inhibited conformational transitions observed here in vitro for the first time may predict that unrepaired abasic sites in G-quadruplexes could lead to changes in the chromosome's terminal protection in vivo.

Intramolecular and intermolecular guanine quadruplexes of DNA in aqueous salt and ethanol solutions.

DNA guanine quadruplexes are all based on stacks of guanine tetrads, but they can be of many types differing by mutual strand orientation, topology, position and structure of loops, and the number of DNA molecules constituting their structure. Here we have studied a series of nine DNA fragments (G(3)Xn)(3)G(3), where X = A, C or T, and n = 1, 2 or 3, to find how the particular bases and their numbers enable folding of the molecule into quadruplex and what type of quadruplex is formed. We show that any single base between G(3) blocks gives rise to only four-molecular parallel-stranded quadruplexes in water solutions. In contrast to previous models, even two Ts in potential loops lead to tetramolecular parallel quadruplexes and only three consecutive Ts lead to an intramolecular quadruplex, which is antiparallel. Adenines make the DNA less prone to quadruplex formation. (G(3)A(2))(3)G(3) folds into an intramolecular antiparallel quadruplex. The same is true with (G(3)A(3))(3)G(3) but only in KCl. In NaCl or LiCl, (G(3)A(3))(3)G(3) prefers to generate homoduplexes. Cytosine still more interferes with the quadruplex, which only is generated by (G(3)C)(3)G(3), whereas (G(3)C(2))(3)G(3) and (G(3)C(3))(3)G(3) generate hairpins and/or homoduplexes. Ethanol is a more potent DNA guanine quadruplex inducer than are ions in water solutions. It promotes intramolecular folding and parallel orientation of quadruplex strands, which rather corresponds to quadruplex structures observed in crystals.

Ethanol is a better inducer of DNA guanine tetraplexes than potassium cations.

Guanine tetraplexes are a biologically relevant alternative of the Watson and Crick duplex of DNA. It is thought that potassium or other cations present in the cavity between consecutive guanine tetrads are an integral part of the tetraplexes. Here we show using CD spectroscopy that ethanol induces the guanine tetraplexes like or even better than potassium cations. We present examples of ethanol stabilizing guanine tetraplexes even in cases when potassium cations fail to do so. Hence, besides the A-form or Z-form, ethanol stabilizes another conformation of DNA, i.e., the guanine tetraplexes. We discuss the mechanism of the stabilization. Use of ethanol will permit studies of guanine tetraplexes that cannot be induced by potassium cations or other tetraplex-promoting agents. This work demonstrates that a still broader spectrum of nucleotide sequences can fold into guanine tetraplexes than has previously been thought. Aqueous ethanol may better simulate conditions existing in vivo than the aqueous solutions.