Analysis of different therapeutic protocols for osteonecrosis of the jaw associated with oral and intravenous bisphosphonates.

INTRODUCTION: Chemotherapy-associated osteonecrosis of the jaw caused by bisphosphonates is an exposure of necrotic bone with more than eight weeks of evolution that is attributable to bisphosphonates and no prior radiation therapy. Its etiopathogenesis remains unknown, although there are two hypotheses that may explain it: the drug's mechanism of action, and the risk factors that can lead to osteonecrosis. There is a wide range of treatment options for managing chemotherapy-associated osteonecrosis of the jaw, from conservative treatments to surgical procedures of varying levels of invasiveness, which are sometimes supplemented with adjuvant therapies. OBJECTIVE: The objective of this article is to group the therapeutic options for osteonecrosis of the jaw (ONJ) into seven different protocols and to evaluate their effectiveness in relation to stage of ONJ. MATERIAL AND METHODS: A literature review was carried out in PubMed following the PRISMA criteria. A total of 47 were collected after compiling a series of variables that define ONJ, applied treatments, and the clinical results obtained. RESULTS AND DISCUSSION: The 47 articles selected have a low to average estimated risk of bias and are of moderate to good quality. According to the data obtained, Protocol 3 (conservative treatment, clinical and radiological follow-up, minimally invasive surgical treatment, and adjuvant therapies) is the most favorable approach for ONJ lesions caused by oral bisphosphonates. For lesions caused by intravenous bisphosphonates, Protocol 2 (conservative treatment, clinical and radiological follow-up, minimally invasive surgical treatment, and no adjuvant therapies) is the best approach. When comparing the different stages of ONJ, Protocol 1 (conservative treatment, clinical and radiological follow-up) promotes better healing of Stage 1 ONJ lesions caused by orally administered bisphosphonates, and Protocol 3 is recommended for Stage II. For ONJ lesions attributable to intravenous bisphosphonates, Protocol 7 (conservative treatment, clinical and radiological follow-up, and adjuvant therapies) provides the best results in Stage 0; in Stages I, II, and III, Protocol 1 gives better results.

Aplicación del sistema de presión negativa VAC® en dehiscencia postesternotomía media en pacientes neonatos / Use of vacuum-assisted closure therapy (VAC®) in poststernotomy dehiscence in neonates

El tricoepitelioma, descrito por Brooke en 1892 y también llamado epitelioma adenoideo quístico, es una genodermatosis autosómica dominante originada en el complejo pilosebáceo. Existen dos formas clínicas: la solitaria y la múltiple. Algunos autores recomiendan no tratarlo; sin embargo las lesiones múltiples tienden a deformar la anatomía y la resección parcial presenta recidivas así como cicatrices excesivas y en algunos casos tienen un comportamiento agresivo. Presentamos un caso clínico de tricoepitelioma con deformidad severa de la cara en el que se realizó tratamiento radical con restitución de unidades estéticas mediante colgajos locales. Consideramos que los casos agresivos o deformantes deben ser tratados de forma radical, eliminando todo el espesor de la piel para obtener resultados satisfactorios (AU)

Trichoepithelioma, first described by Brooke in 1892, also known as cystic adenoid epithelioma, is a dominantly inherited genodermatosis originated in the follicle bulb. There are two clinical forms, solitary and multiple. Some authors advocate not to treat them, but multiple trichoepithelioma presents a significant cosmetic problem and partial resection can lead to recurrence and excessive scarring, some cases with an aggressive behavior. We present a clinical case of multiple tricoepithelioma with severe deformity of the face in which we realized radical resection with restitution of anatomical units by local flaps. We consider that the multiple cases should be excised with total skin to avoid recurrence and obtain acceptable results (AU)

Comparación de la expansión maxilar en gemelos idénticos obtenida con dos tipos de disyuntor palatino: anclaje esquelético y anclaje dentario / No disponible

Aun siendo la expansión rápida maxilar muy utilizada para pacientes con una discrepancia transversal durante el periodo de crecimiento con una buena predictabilidad, se han observado reacciones adversas como excesivas inclinaciones y orientaciones de los dientes utilizados de anclaje en dicho tipo de aparatologías así como posibles recesiones gingivales. El objetivo de este artículo es comparar el uso de un disyuntor de anclaje esquelético con el uso de un disyuntor habitual cementado a dientes en una pareja de gemelos idénticos. Material & Métodos: dos gemelas monocigóticos de 13 años y 3 meses. La paciente A presenta un maxilar con una discrepancia esquelética transversal y una mordida cruzada en el lado izquierdo. La paciente B presenta un maxilar con una discrepancia esquelética transversal y una mordida cruzada en el lado derecho. No obstante, ambas mordidas cruzadas laterales presentan la misma maloclusión en imagen especular. El resto de las características entre ambas maloclusiones no presentan ninguna diferencia. El disyuntor de anclaje esquelético fue utilizado en la paciente A mientras que el disyuntor habitual cementado a dientes fue instalado en la paciente B. Conclusión: El uso de un disyuntor de anclaje esquelético puede prevenir el volcamiento corono-vestibular debido a la no utilización de piezas dentarias para el anclaje del mismo (AU)

Although rapid palatal expansion is widely used for patients with a transverse discrepancy at their growth period with good predictability, adverse reactions as angulation/orientation of the teeth and gingival recessions can occur. The purpose of this article is to compare the use of skeletal Anchorage RPE and the use of a bonded RPE on a pair of identical twins. Materials & Methods: A 13 year old and 3 months pair of monozigotic twins. Patient A pesented with a narrow maxilla and a cross-bite in the left side. Patient B presented with a narrow maxilla and a cross-bite on the right side. However both cross-bites were a mirror image maloclussion when comparing the patients, any other characteristic of the malocclusions were different. A skeletal anchorage RPE type was placed in patient A and a bonded RPE was installed in patient B. Conclusions: the use of a skeletal anchorage RPE might prevent the tipping of the RPE anchor teeth in patients who presents with a narrow maxilla (AU)

Begomovirus coat protein interacts with a small heat-shock protein of its transmission vector (Bemisia tabaci).

Tomato yellow leaf curl Sardinia virus (TYLCSV) is transmitted from plant to plant by the whitefly Bemisia tabaci in a persistent-circulative manner. The coat protein (CP) plays an important role in this transmission cycle. In this study, the CP was used to screen a Bemisia tabaci cDNA library using the yeast two-hybrid system, in a search for interacting partners. A member of the small heat-shock protein family (termed BtHSP16) was identified and its interaction with the CP was verified by an in vitro pull-down assay. The binding domain was located at the variable N-terminal part of the CP, while full-length BtHSP16 is required for the interaction. The putative role for this interaction in the transmission cycle by the whitefly is discussed.

Adenomatosis hepática / Hepatic adenomatosis

No disponible

Mujer de 74 años con fiebre y dolor abdominal / A 74-year-old woman with severe abdominal pain

No disponible

Mpg1, a fission yeast protein required for proper septum structure, is involved in cell cycle progression through cell-size checkpoint.

Using a yeast two-hybrid screen we isolated a gene from Schizosaccharomyces pombe which corresponds to the previously uncharacterized ORF SPCC1906.01. We have designated this gene as mpg1, based on the putative function of its product as a mannose-1-phosphatase guanyltransferase. Mpg1 shows strong similarity to other GDP-mannose-1-phosphate guanyltransferases involved in the maintenance of cell wall integrity and/or glycosylation. This homology, together with the protein's localization pattern demonstrated in this work, strongly suggests that Mpg1 is involved in cell wall and septum synthesis. Moreover, cells lacking Mpg1 present a defect in glycosylation, are more sensitive to Lyticase, and show an aberrant septum structure from the start of its deposition, indicating that the Mpg1 function is necessary for the correct assembly of the septum. Interestingly, lack of Mpg1 clearly affects cell cycle progression: mpg1 null mutants arrest as septated and bi-nucleated 4C cells, without an actomyosin ring. Wee1 is required for the G2/M arrest induced in the absence of Mpg1, since the blockade is circumvented when Wee1 is inactivated. Wee1 is part of a cell-size checkpoint that prevents entry into mitosis before cells reach a critical size. The results presented in this work demonstrate that the G2/M arrest induced in the absence of Mpg1 is mediated by this cell size checkpoint, since oversized mutant cells enter mitosis. The mpg1 loss-of-function mutant, therefore, provides a good model in which to study how cells coordinate cell growth and cell division.

Pepper (Capsicum annuum) Is a Dead-End Host for Tomato yellow leaf curl virus.

ABSTRACT Tomato yellow leaf curl (TYLC) is one of the most devastating pathogens affecting tomato (Lycopersicon esculentum) worldwide. The disease is caused by a complex of begomovirus species, two of which, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), are responsible for epidemics in Southern Spain. TYLCV also has been reported to cause severe damage to common bean (Phaseolus vulgaris) crops. Pepper (Capsicum annuum) plants collected from commercial crops were found to be infected by isolates of two TYLCV strains: TYLCV-Mld[ES01/99], an isolate of the mild strain similar to other TYLCVs isolated from tomato crops in Spain, and TYLCV-[Alm], an isolate of the more virulent TYLCV type strain, not previously reported in the Iberian Peninsula. In this work, pepper, Nicotiana benthamiana, common bean, and tomato were tested for susceptibility to TYLCV-Mld[ES01/99]and TYLCV-[Alm] by Agrobacterium tumefaciens infiltration, biolistic bombardment, or Bemisia tabaci inoculation. Results indicate that both strains are able to infect plants of these species, including pepper. This is the first time that infection of pepper plants with TYLCV clones has been shown. Implications of pepper infection for the epidemiology of TYLCV are discussed.

Interaction between a geminivirus replication protein and the plant sumoylation system.

Geminiviruses are small DNA viruses that replicate in nuclei of infected plant cells after accumulation of host replication machinery. Tomato golden mosaic virus (TGMV) and Tomato yellow leaf curl Sardinia virus (TYLCSV) encode a protein, RepAC1 (or Rep), that is essential for viral replication. Rep/RepAC1 is an oligomeric protein that binds to double-stranded DNA, catalyzes cleavage and ligation of single-stranded DNA, and is sufficient for host induction. It also interacts with several host proteins, including the cell cycle regulator, retinoblastoma, and essential components of the cell DNA replication machinery, like proliferating nuclear cell antigen (PCNA) and RFC-1. To identify other cellular proteins that interact with Rep/RepAC1 protein, a Nicotiana benthamiana cDNA library was screened with a yeast two-hybrid assay. The host cell sumoylation enzyme, NbSCE1 (N. benthamiana SUMO-conjugating enzyme, homolog to Saccharomyces cerevisiae UBC9), was found to interact specifically with RepAC1. Mapping studies localized the interaction to the N-terminal half of RepAC1. Effects on geminivirus replication were observed in transgenic plants with altered levels of SUMO, the substrate for UBC9.

A New Tomato yellow leaf curl virus Strain in Southern Spain.

Tomato yellow leaf curl disease (TYLCD) has affected tomato crops annually in southern Spain since 1992 when Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) was first described. In 1997, the presence of a different begomovirus species (TYLCV-[ES7297]) was reported in common bean (Phaseolus vulgaris). In 1999, TYLCV-[ES7297] was found in pepper (Capsicum annuum) (2). In September 2002, we observed tomato plants of TYLCD tolerant tomato cultivars (Kampala and Tiway) showing strong TYLCD symptoms (shortened internodes, curling of leaflet margins, and leaf blade reduction). Samples from 90 of these plants were collected from greenhouses located in the Province of Murcia and analyzed by Southern blot using the intergenic region of TYLCSV-ES[2] and TYLCV-[ES7297] as specific probes. Positive signals were obtained for TYLCV-[ES7297] and TYLCSV-ES[2] in 88 and 23 of the plants, respectively. Samples from eight TYLCV single-infected plants (four 'Kampala' and four 'Tiway') were analyzed by polymerase chain reaction using a pair of primers (OTYA7: GCTCCCTGAATGTTCGGATGGA and OTYA8: ATCATGGATTT ACGCACAGGGG) designed to amplify a 1.9-kb fragment of any isolate of TYLCV/TYLCSV. Subsequent restriction fragment length polymorphism analysis of the amplification products yielded a restriction pattern different from that obtained for TYLCV-[ES7297]. Fragments from the eight samples were sequenced and showed 97.9% identity to a TYLCV strain previously reported in Israel (X15656) (1) and only 92.7% identify with TYLCV-[ES7297]. To our knowledge, this is the first report that this strain of TYLCV has been detected in Spain. References: (1) N. Navot et al. Virology 185(1), 151, 1991. (2) J. Reina et al. Plant Dis. 83:1176, 1999.

High Genetic Stability of the Begomovirus Tomato yellow leaf curl Sardinia virus in Southern Spain Over an 8-Year Period.

ABSTRACT The evolution of the plant single-stranded DNA virus Tomato yellow leaf curl Sardinia virus (TYLCSV) (genus Begomovirus, family Geminiviridae) has been monitored for 8 years after its appearance in southern Spain. Variation within three genomic regions of 166 TYLCSV isolates collected from three locations was assessed by single-strand conformation polymorphism (SSCP) analysis. According to SSCP, the intergenic region (IR) was the most variable. Low genetic diversity was found within the population and geographical or temporal differences were not evident. Nucleotide sequences of specific genomic regions of haplotypes identified by SSCP indicated close relationships among them. Therefore, the Spanish TYLCSV population appears to represent a single, undifferentiated population. The analysis of IR sequences for a subsample of 76 randomly chosen isolates confirmed the limited genetic diversity revealed by the SSCP analysis. A tendency to a lineal increase in diversity over time was observed in Málaga and Almería subpopulations; however, no accumulation of mutations in single isolates was evident. Negative selection to variation seems to operate to conserve certain regions of the genome. Thus, the low genetic diversity found in the studied TYLCSV population might be the result of a founder effect with subsequent selection against less fit variants arising by mutation.

The identification of Wos2, a p23 homologue that interacts with Wee1 and Cdc2 in the mitotic control of fission yeasts.

The Wee1 kinase inhibits entry into mitosis by phosphorylation of the Cdc2 kinase. Searching for multicopy suppressors that abolish this inhibition in the fission yeast, we have identified a novel gene, here named wos2, encoding a protein with significant homology to human p23, an Hsp90-associated cochaperone. The deletion mutant has a modest phenotype, being heat-shock sensitive. Using antibodies raised against bacterially produced protein, we determined that Wos2 is very abundant, ubiquitously distributed in the yeast cell, and its expression dropped drastically as cells entered into early stationary phase, indicating that its function is associated with cell proliferation. In proliferating cells, the amount of Wos2 protein was not subjected to cell cycle regulation. However, in vitro assays demonstrated that this Hsp90 cochaperone is potentially regulated by phosphorylation. In addition to suppressing Wee1 activity, overproduction of Wos2 displayed synthetic lethality with Cdc2 mutant proteins, indicating that this Hsp90 cochaperone functionally interacts with Cdc2. The level of Cdc2 protein and its associated H1 kinase activity under synthetic lethal conditions suggested a regulatory role for this Wos2-Cdc2 interaction. Hsp90 complexes are required for CDK regulation; the synergy found between the excess of Wos2 and a deficiency in Hsp90 activity suggests that Wos2 could specifically interfere with the Hsp90-dependent regulation of Cdc2. In vitro analysis indicated that the above genetic interactions could take place by physical association of Wos2 with the single CDK complex of the fission yeast. Expression of the budding yeast p23 protein (encoded by the SBA1 gene) in the fission yeast indicated that Wos2 and Sba1 are functionally exchangeable and therefore that properties described here for Wos2 could be of wide significance in understanding the biological function of cochaperone p23 in eukaryotic cells.

First Report of Capsicum annuum Plants Infected by Tomato Yellow Leaf Curl Virus.

Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.

New Mutants of Phycomyces blakesleeanus for (beta)-Carotene Production.

The accumulation of (beta)-carotene by the zygomycete Phycomyces blakesleeanus is increased by mutations in the carS gene. The treatment of spores of carS mutants with N-methyl-N(prm1)-nitro-N-nitrosoguanidine led to the isolation, at very low frequencies, of mutants that produced higher levels of (beta)-carotene. Strain S556 produced about 9 mg of (beta)-carotene per g of dry mass when it was grown on minimal agar. Crosses involving strain S556 separated the original carS mutation from a new, unlinked mutation, carF. The carF segregants produced approximately as much carotene as did carS mutants, but they were unique in their ability to produce zygospores on mating and in their response to agents that increase carotenogenesis in the wild type. The carotene contents of carF segregants and carF carS double mutants were increased by sexual interaction and by dimethyl phthalate but were not increased by light or retinol. Mixed opposite-sex cultures of carF carS mutants contained up to 33 mg of (beta)-carotene per g of dry mass. Another strain, S444, produced more (beta)-carotene than did S556 but was marred by slow growth, defective morphology, and bizarre genetic behavior. In all the strains tested, the carotene concentration was minimal during the early growth phase and became higher and constant for several days in older mycelia.

Analysis of multiple copies of geminiviral DNA in the genome of four closely related Nicotiana species suggest a unique integration event.

Previously, we discovered multiple direct repeats of geminivirus-related DNA (GRD) sequences clustered at a single chromosomal position in Nicotiana tabacum (tobacco). Here we show that, in addition to tobacco, multiple copies of these elements occur in the genomes of three related Nicotiana species, all in the section Tomentosae: N. tomentosiformis, N. tomentosa and N. kawakamii, but not in 9 other more distantly related Nicotiana species, nor in various other solanaceous and non-solanacous plants. DNA sequence analysis of 18 GRD copies reveal 4 distinct, but highly related, sub-families: GRD5, GRD3 and GRD53 in tobacco; GRD5 in N. tomentosiformis and N. kawakamii; and GRD2 in N. tomentosa. In addition to novel sequences, all elements share significant but varying lengths of DNA sequence similarity with the geminiviral replication origin plus the adjacent rep gene. There is extended sequence similarity to REP protein at the deduced amino acid sequence level, including motifs associated with other rolling circle replication proteins. Our data suggest that all GRD elements descend from a unique geminiviral integration event, most likely in a common ancestor of these Tomentosae species.

Integration of multiple repeats of geminiviral DNA into the nuclear genome of tobacco during evolution.

Integration of viral DNA into the host nuclear genome, although not unusual in bacterial and animal systems, has surprisingly not been reported for plants. We have discovered geminvirus-related DNA (GRD) sequences, in the form of distinct sets of multiple direct repeats comprising three related repeat classes, situated in a unique locus in the Nicotiana tabacum (tobacco) nuclear genome. The organization of these sequences is similar or identical in eight different tobacco cultivars we have examined. DNA sequence analysis reveals that each repeat has sequences most resembling those of the New World geminiviral DNA replication origin plus the adjacent AL1 gene, encoding the viral replication protein. We believe these GRD sequences originated quite recently in Nicotiana evolution through integration of geminiviral DNA by some combination of the processes of illegitimate recombination, amplification, deletions, and rearrangements. These events must have occurred in plant tissue that was subsequently able to contribute to meristematic tissue yielding gametes. GRD may have been retained in tobacco by selection or by random fixation in a small evolving population. Although we cannot detect transcription of these sequences, this does not exclude the possibility that they may originally have been expressed.

Functional analysis of the Drosophila CDC2 Dm gene in fission yeast.

The cdc2+ gene product (p34cdc2) is a protein kinase that regulates entry into mitosis in all eukaryotic cells. The role that p34cdc2 plays in the cell cycle has been extensively investigated in a number of organisms, including the fission yeast Schizosaccharomyces pombe. To study the degree of functional conservation among evolutionarily distant p34cdc2 proteins, we have constructed a S. pombe strain in which the yeast cdc2+ gene has been replaced by its Drosophila homologue CDC2Dm (the CDC2Dm strain). This CDC2Dm S. pombe strain is viable, capable of mating and producing four viable meiotic products, indicating that the fly p34CDC2Dm recognizes all the essential S. pombe cdc2+ substrates, and that it is recognized by cyclin partners and other elements required for its activity. The p34CDC2Dm protein yields a lethal phenotype in combination with the mutant B-type cyclin p56cdc13-117, suggesting that this S. pombe cyclin might interact less efficiently with the Drosophila protein than with its native p34cdc2 counterpart. This CDC2Dm strain also responds to nutritional starvation and to incomplete DNA synthesis, indicating that proteins involved in these signal transduction pathways, interact properly with p34CDC2Dm (and/or that p34cdc2-independent pathways are used). The CDC2Dm gene produces a 'wee' phenotype, and it is largely insensitive to the action of the S. pombe wee1+ mitotic inhibitor, suggesting that Drosophila wee1+ homologue might not be functionally conserved. This CDC2Dm strain is hypersensitive to UV irradiation, to the same degree as wee1-deficient mutants. A strain which co-expresses the Drosophila and yeast cdc2+ genes shows a dominant wee phenotype, but displays a wild-type sensitivity to UV irradiation, suggesting that p34cdc2 triggers mitosis and influences the UV sensitivity by independent mechanisms.