RESUMO
Tomato yellow leaf curl Sardinia virus (TYLCSV) is transmitted from plant to plant by the whitefly Bemisia tabaci in a persistent-circulative manner. The coat protein (CP) plays an important role in this transmission cycle. In this study, the CP was used to screen a Bemisia tabaci cDNA library using the yeast two-hybrid system, in a search for interacting partners. A member of the small heat-shock protein family (termed BtHSP16) was identified and its interaction with the CP was verified by an in vitro pull-down assay. The binding domain was located at the variable N-terminal part of the CP, while full-length BtHSP16 is required for the interaction. The putative role for this interaction in the transmission cycle by the whitefly is discussed.
Assuntos
Begomovirus/metabolismo , Proteínas do Capsídeo/metabolismo , Proteínas de Choque Térmico/metabolismo , Hemípteros/virologia , Insetos Vetores/virologia , Doenças das Plantas/virologia , Sequência de Aminoácidos , Animais , Sequência de Bases , Biblioteca Gênica , Proteínas de Choque Térmico/genética , Immunoblotting , Dados de Sequência Molecular , Oligonucleotídeos/genética , Ligação Proteica , Estrutura Terciária de Proteína , Análise de Sequência de DNA , Técnicas do Sistema de Duplo-HíbridoRESUMO
Using a yeast two-hybrid screen we isolated a gene from Schizosaccharomyces pombe which corresponds to the previously uncharacterized ORF SPCC1906.01. We have designated this gene as mpg1, based on the putative function of its product as a mannose-1-phosphatase guanyltransferase. Mpg1 shows strong similarity to other GDP-mannose-1-phosphate guanyltransferases involved in the maintenance of cell wall integrity and/or glycosylation. This homology, together with the protein's localization pattern demonstrated in this work, strongly suggests that Mpg1 is involved in cell wall and septum synthesis. Moreover, cells lacking Mpg1 present a defect in glycosylation, are more sensitive to Lyticase, and show an aberrant septum structure from the start of its deposition, indicating that the Mpg1 function is necessary for the correct assembly of the septum. Interestingly, lack of Mpg1 clearly affects cell cycle progression: mpg1 null mutants arrest as septated and bi-nucleated 4C cells, without an actomyosin ring. Wee1 is required for the G2/M arrest induced in the absence of Mpg1, since the blockade is circumvented when Wee1 is inactivated. Wee1 is part of a cell-size checkpoint that prevents entry into mitosis before cells reach a critical size. The results presented in this work demonstrate that the G2/M arrest induced in the absence of Mpg1 is mediated by this cell size checkpoint, since oversized mutant cells enter mitosis. The mpg1 loss-of-function mutant, therefore, provides a good model in which to study how cells coordinate cell growth and cell division.
Assuntos
Nucleotidiltransferases/genética , Proteínas de Schizosaccharomyces pombe/genética , Schizosaccharomyces/citologia , Schizosaccharomyces/genética , Sequência de Aminoácidos , Sequência de Bases , Ciclo Celular , Proteínas de Ciclo Celular/genética , Proteínas de Ciclo Celular/metabolismo , Parede Celular/enzimologia , Citoplasma/enzimologia , DNA Fúngico/genética , Perfilação da Expressão Gênica , Genes Fúngicos , Dados de Sequência Molecular , Mutação , Proteínas Nucleares/genética , Proteínas Nucleares/metabolismo , Nucleotidiltransferases/metabolismo , Proteínas Tirosina Fosfatases/genética , Proteínas Tirosina Fosfatases/metabolismo , Proteínas Tirosina Quinases/genética , Proteínas Tirosina Quinases/metabolismo , Schizosaccharomyces/enzimologia , Proteínas de Schizosaccharomyces pombe/metabolismo , Homologia de Sequência de Aminoácidos , Técnicas do Sistema de Duplo-HíbridoRESUMO
ABSTRACT Tomato yellow leaf curl (TYLC) is one of the most devastating pathogens affecting tomato (Lycopersicon esculentum) worldwide. The disease is caused by a complex of begomovirus species, two of which, Tomato yellow leaf curl Sardinia virus (TYLCSV) and Tomato yellow leaf curl virus (TYLCV), are responsible for epidemics in Southern Spain. TYLCV also has been reported to cause severe damage to common bean (Phaseolus vulgaris) crops. Pepper (Capsicum annuum) plants collected from commercial crops were found to be infected by isolates of two TYLCV strains: TYLCV-Mld[ES01/99], an isolate of the mild strain similar to other TYLCVs isolated from tomato crops in Spain, and TYLCV-[Alm], an isolate of the more virulent TYLCV type strain, not previously reported in the Iberian Peninsula. In this work, pepper, Nicotiana benthamiana, common bean, and tomato were tested for susceptibility to TYLCV-Mld[ES01/99]and TYLCV-[Alm] by Agrobacterium tumefaciens infiltration, biolistic bombardment, or Bemisia tabaci inoculation. Results indicate that both strains are able to infect plants of these species, including pepper. This is the first time that infection of pepper plants with TYLCV clones has been shown. Implications of pepper infection for the epidemiology of TYLCV are discussed.
RESUMO
Geminiviruses are small DNA viruses that replicate in nuclei of infected plant cells after accumulation of host replication machinery. Tomato golden mosaic virus (TGMV) and Tomato yellow leaf curl Sardinia virus (TYLCSV) encode a protein, RepAC1 (or Rep), that is essential for viral replication. Rep/RepAC1 is an oligomeric protein that binds to double-stranded DNA, catalyzes cleavage and ligation of single-stranded DNA, and is sufficient for host induction. It also interacts with several host proteins, including the cell cycle regulator, retinoblastoma, and essential components of the cell DNA replication machinery, like proliferating nuclear cell antigen (PCNA) and RFC-1. To identify other cellular proteins that interact with Rep/RepAC1 protein, a Nicotiana benthamiana cDNA library was screened with a yeast two-hybrid assay. The host cell sumoylation enzyme, NbSCE1 (N. benthamiana SUMO-conjugating enzyme, homolog to Saccharomyces cerevisiae UBC9), was found to interact specifically with RepAC1. Mapping studies localized the interaction to the N-terminal half of RepAC1. Effects on geminivirus replication were observed in transgenic plants with altered levels of SUMO, the substrate for UBC9.
Assuntos
Geminiviridae/fisiologia , Nicotiana/virologia , Enzimas de Conjugação de Ubiquitina/metabolismo , Proteínas Virais/metabolismo , Sequência de Aminoácidos , Sequência de Bases , Geminiviridae/metabolismo , Geminiviridae/patogenicidade , Dados de Sequência Molecular , Plantas Geneticamente Modificadas , Análise de Sequência de DNA , Nicotiana/genética , Técnicas do Sistema de Duplo-Híbrido , Enzimas de Conjugação de Ubiquitina/genética , Proteínas Virais/genética , Replicação ViralRESUMO
Tomato yellow leaf curl disease (TYLCD) has affected tomato crops annually in southern Spain since 1992 when Tomato yellow leaf curl Sardinia virus (TYLCSV-ES) was first described. In 1997, the presence of a different begomovirus species (TYLCV-[ES7297]) was reported in common bean (Phaseolus vulgaris). In 1999, TYLCV-[ES7297] was found in pepper (Capsicum annuum) (2). In September 2002, we observed tomato plants of TYLCD tolerant tomato cultivars (Kampala and Tiway) showing strong TYLCD symptoms (shortened internodes, curling of leaflet margins, and leaf blade reduction). Samples from 90 of these plants were collected from greenhouses located in the Province of Murcia and analyzed by Southern blot using the intergenic region of TYLCSV-ES[2] and TYLCV-[ES7297] as specific probes. Positive signals were obtained for TYLCV-[ES7297] and TYLCSV-ES[2] in 88 and 23 of the plants, respectively. Samples from eight TYLCV single-infected plants (four 'Kampala' and four 'Tiway') were analyzed by polymerase chain reaction using a pair of primers (OTYA7: GCTCCCTGAATGTTCGGATGGA and OTYA8: ATCATGGATTT ACGCACAGGGG) designed to amplify a 1.9-kb fragment of any isolate of TYLCV/TYLCSV. Subsequent restriction fragment length polymorphism analysis of the amplification products yielded a restriction pattern different from that obtained for TYLCV-[ES7297]. Fragments from the eight samples were sequenced and showed 97.9% identity to a TYLCV strain previously reported in Israel (X15656) (1) and only 92.7% identify with TYLCV-[ES7297]. To our knowledge, this is the first report that this strain of TYLCV has been detected in Spain. References: (1) N. Navot et al. Virology 185(1), 151, 1991. (2) J. Reina et al. Plant Dis. 83:1176, 1999.
RESUMO
ABSTRACT The evolution of the plant single-stranded DNA virus Tomato yellow leaf curl Sardinia virus (TYLCSV) (genus Begomovirus, family Geminiviridae) has been monitored for 8 years after its appearance in southern Spain. Variation within three genomic regions of 166 TYLCSV isolates collected from three locations was assessed by single-strand conformation polymorphism (SSCP) analysis. According to SSCP, the intergenic region (IR) was the most variable. Low genetic diversity was found within the population and geographical or temporal differences were not evident. Nucleotide sequences of specific genomic regions of haplotypes identified by SSCP indicated close relationships among them. Therefore, the Spanish TYLCSV population appears to represent a single, undifferentiated population. The analysis of IR sequences for a subsample of 76 randomly chosen isolates confirmed the limited genetic diversity revealed by the SSCP analysis. A tendency to a lineal increase in diversity over time was observed in Málaga and Almería subpopulations; however, no accumulation of mutations in single isolates was evident. Negative selection to variation seems to operate to conserve certain regions of the genome. Thus, the low genetic diversity found in the studied TYLCSV population might be the result of a founder effect with subsequent selection against less fit variants arising by mutation.
RESUMO
The Wee1 kinase inhibits entry into mitosis by phosphorylation of the Cdc2 kinase. Searching for multicopy suppressors that abolish this inhibition in the fission yeast, we have identified a novel gene, here named wos2, encoding a protein with significant homology to human p23, an Hsp90-associated cochaperone. The deletion mutant has a modest phenotype, being heat-shock sensitive. Using antibodies raised against bacterially produced protein, we determined that Wos2 is very abundant, ubiquitously distributed in the yeast cell, and its expression dropped drastically as cells entered into early stationary phase, indicating that its function is associated with cell proliferation. In proliferating cells, the amount of Wos2 protein was not subjected to cell cycle regulation. However, in vitro assays demonstrated that this Hsp90 cochaperone is potentially regulated by phosphorylation. In addition to suppressing Wee1 activity, overproduction of Wos2 displayed synthetic lethality with Cdc2 mutant proteins, indicating that this Hsp90 cochaperone functionally interacts with Cdc2. The level of Cdc2 protein and its associated H1 kinase activity under synthetic lethal conditions suggested a regulatory role for this Wos2-Cdc2 interaction. Hsp90 complexes are required for CDK regulation; the synergy found between the excess of Wos2 and a deficiency in Hsp90 activity suggests that Wos2 could specifically interfere with the Hsp90-dependent regulation of Cdc2. In vitro analysis indicated that the above genetic interactions could take place by physical association of Wos2 with the single CDK complex of the fission yeast. Expression of the budding yeast p23 protein (encoded by the SBA1 gene) in the fission yeast indicated that Wos2 and Sba1 are functionally exchangeable and therefore that properties described here for Wos2 could be of wide significance in understanding the biological function of cochaperone p23 in eukaryotic cells.
Assuntos
Proteínas Fúngicas/genética , Mitose , Schizosaccharomyces/citologia , Sequência de Aminoácidos , Primers do DNA , Proteínas Fúngicas/química , Proteínas Fúngicas/metabolismo , Regulação Fúngica da Expressão Gênica , Proteínas de Choque Térmico HSP90/antagonistas & inibidores , Humanos , Dados de Sequência Molecular , Schizosaccharomyces/metabolismo , Homologia de Sequência de AminoácidosRESUMO
Infection of tomato crops by tomato yellow leaf curl virus (TYLCV) has occurred annually in southern Spain since 1992. In 1997, TYLCV also was reported in common bean (Phaseolus vulgaris) (2) in southern Spain. During the summer of 1999, we observed pepper plants (Capsicum annuum) from a greenhouse in Almería (Spain) exhibiting clear leaf internervial and marginal chlorosis and upward curling of the leaflet margin. Total nucleic acids were extracted from five plants with symptoms and analyzed by Southern blot hybridization and polymerase chain reaction (PCR). As a probe, we used a plasmid (pSP72/97) encompassing the complete genome of the Spanish isolate of TYLCV-IS (1). A positive signal was obtained from three samples. A pair of primers (OTYA3/OTYA6) designed to amplify TYLCV was used for detection in samples (OTYA3: GGGTCGACGTCATCAATGACG; OTYA6: CTACATGAGAATGGGGAACC). Using PCR, we were able to obtain fragments of the expected sizes (649 bp for OTYA3/OTYA6) from four of five samples analyzed. Amplified fragments were later analyzed by restriction fragment length polymorphism with three cutter enzymes (AluI, RsaI, and HinfI). The restriction pattern obtained in all cases corresponded with the Spanish isolate of TYLCV-IS. One of the fragments amplified with OTYA3/OTYA6 was fully sequenced. The sequence was 100% identical to that previously reported for the Spanish isolate of TYLCV-IS. This is the first report of TYLCV infection in C. annuum, which is one of the most important commercial crops in southeastern Spain. Work is in progress to determine whether the presence of TYLCV-IS in pepper plants is responsible for the symptoms described here. References: (1) J. Navas-Castillo et al. Plant Dis. 81:1461, 1997. (2) J. Navas-Castillo et al. Plant Dis. 83:29, 1999.
RESUMO
Previously, we discovered multiple direct repeats of geminivirus-related DNA (GRD) sequences clustered at a single chromosomal position in Nicotiana tabacum (tobacco). Here we show that, in addition to tobacco, multiple copies of these elements occur in the genomes of three related Nicotiana species, all in the section Tomentosae: N. tomentosiformis, N. tomentosa and N. kawakamii, but not in 9 other more distantly related Nicotiana species, nor in various other solanaceous and non-solanacous plants. DNA sequence analysis of 18 GRD copies reveal 4 distinct, but highly related, sub-families: GRD5, GRD3 and GRD53 in tobacco; GRD5 in N. tomentosiformis and N. kawakamii; and GRD2 in N. tomentosa. In addition to novel sequences, all elements share significant but varying lengths of DNA sequence similarity with the geminiviral replication origin plus the adjacent rep gene. There is extended sequence similarity to REP protein at the deduced amino acid sequence level, including motifs associated with other rolling circle replication proteins. Our data suggest that all GRD elements descend from a unique geminiviral integration event, most likely in a common ancestor of these Tomentosae species.
Assuntos
DNA Viral/análise , Geminiviridae/genética , Dosagem de Genes , Nicotiana/genética , Nicotiana/virologia , Plantas Tóxicas , Integração Viral/genética , Sequência de Aminoácidos , DNA de Plantas/análise , Genoma de Planta , Dados de Sequência Molecular , Sequências Repetitivas de Ácido Nucleico , Alinhamento de Sequência , Homologia de Sequência do Ácido Nucleico , Especificidade da EspécieRESUMO
The accumulation of (beta)-carotene by the zygomycete Phycomyces blakesleeanus is increased by mutations in the carS gene. The treatment of spores of carS mutants with N-methyl-N(prm1)-nitro-N-nitrosoguanidine led to the isolation, at very low frequencies, of mutants that produced higher levels of (beta)-carotene. Strain S556 produced about 9 mg of (beta)-carotene per g of dry mass when it was grown on minimal agar. Crosses involving strain S556 separated the original carS mutation from a new, unlinked mutation, carF. The carF segregants produced approximately as much carotene as did carS mutants, but they were unique in their ability to produce zygospores on mating and in their response to agents that increase carotenogenesis in the wild type. The carotene contents of carF segregants and carF carS double mutants were increased by sexual interaction and by dimethyl phthalate but were not increased by light or retinol. Mixed opposite-sex cultures of carF carS mutants contained up to 33 mg of (beta)-carotene per g of dry mass. Another strain, S444, produced more (beta)-carotene than did S556 but was marred by slow growth, defective morphology, and bizarre genetic behavior. In all the strains tested, the carotene concentration was minimal during the early growth phase and became higher and constant for several days in older mycelia.
RESUMO
Integration of viral DNA into the host nuclear genome, although not unusual in bacterial and animal systems, has surprisingly not been reported for plants. We have discovered geminvirus-related DNA (GRD) sequences, in the form of distinct sets of multiple direct repeats comprising three related repeat classes, situated in a unique locus in the Nicotiana tabacum (tobacco) nuclear genome. The organization of these sequences is similar or identical in eight different tobacco cultivars we have examined. DNA sequence analysis reveals that each repeat has sequences most resembling those of the New World geminiviral DNA replication origin plus the adjacent AL1 gene, encoding the viral replication protein. We believe these GRD sequences originated quite recently in Nicotiana evolution through integration of geminiviral DNA by some combination of the processes of illegitimate recombination, amplification, deletions, and rearrangements. These events must have occurred in plant tissue that was subsequently able to contribute to meristematic tissue yielding gametes. GRD may have been retained in tobacco by selection or by random fixation in a small evolving population. Although we cannot detect transcription of these sequences, this does not exclude the possibility that they may originally have been expressed.
Assuntos
Evolução Biológica , Geminiviridae/genética , Nicotiana/genética , Plantas Tóxicas , Sequências Repetitivas de Ácido Nucleico , Integração Viral/genética , Sequência de Aminoácidos , Sequência de Bases , Núcleo Celular/genética , DNA de Plantas/genética , DNA Viral/genética , Genoma de Planta , Dados de Sequência Molecular , Hibridização de Ácido Nucleico , Análise de Sequência de DNA , Homologia de Sequência de Aminoácidos , Nicotiana/virologia , Proteínas Virais/genéticaRESUMO
The cdc2+ gene product (p34cdc2) is a protein kinase that regulates entry into mitosis in all eukaryotic cells. The role that p34cdc2 plays in the cell cycle has been extensively investigated in a number of organisms, including the fission yeast Schizosaccharomyces pombe. To study the degree of functional conservation among evolutionarily distant p34cdc2 proteins, we have constructed a S. pombe strain in which the yeast cdc2+ gene has been replaced by its Drosophila homologue CDC2Dm (the CDC2Dm strain). This CDC2Dm S. pombe strain is viable, capable of mating and producing four viable meiotic products, indicating that the fly p34CDC2Dm recognizes all the essential S. pombe cdc2+ substrates, and that it is recognized by cyclin partners and other elements required for its activity. The p34CDC2Dm protein yields a lethal phenotype in combination with the mutant B-type cyclin p56cdc13-117, suggesting that this S. pombe cyclin might interact less efficiently with the Drosophila protein than with its native p34cdc2 counterpart. This CDC2Dm strain also responds to nutritional starvation and to incomplete DNA synthesis, indicating that proteins involved in these signal transduction pathways, interact properly with p34CDC2Dm (and/or that p34cdc2-independent pathways are used). The CDC2Dm gene produces a 'wee' phenotype, and it is largely insensitive to the action of the S. pombe wee1+ mitotic inhibitor, suggesting that Drosophila wee1+ homologue might not be functionally conserved. This CDC2Dm strain is hypersensitive to UV irradiation, to the same degree as wee1-deficient mutants. A strain which co-expresses the Drosophila and yeast cdc2+ genes shows a dominant wee phenotype, but displays a wild-type sensitivity to UV irradiation, suggesting that p34cdc2 triggers mitosis and influences the UV sensitivity by independent mechanisms.
Assuntos
Proteína Quinase CDC2/genética , Ciclo Celular/genética , Drosophila/genética , Schizosaccharomyces/genética , Animais , Drosophila/citologia , Expressão Gênica , Regulação Fúngica da Expressão Gênica , Técnicas de Transferência de Genes , Schizosaccharomyces/citologiaRESUMO
Transgenic tobacco plants expressing an antisense RNA targeted against tomato golden mosaic virus (TGMV) show reduced/no symptoms and viral DNA accumulation upon TGMV infection [5]. The targeted region includes the AL1 gene, encoding an essential viral replication protein. This DNA sequence is conserved in various other geminiviruses, suggesting they too might show inhibition of replication in these plants. We infected leaf material with African cassava mosaic virus (ACMV) and beet curly top virus (BTCV) and saw a 4-fold reduction of BCTV, but not ACMV, DNA accumulation, compared to controls. The equivalent regions of BCTV and ACMV show similar overall homology to the TGMV target (63% and 64% respectively), but within this, BCTV displays a 280 nucleotide region of high homology (82%). In contrast, for ACMV, the homology is more dispersed. This indicates that a critical stretch of good complementarity is needed to block expression of the target mRNA, that is effective even within along antisense transcript. These studies indicate the potential for developing a multifunctional antisense cassette.
Assuntos
Geminiviridae/genética , RNA Antissenso/biossíntese , Vírus do Mosaico do Tabaco/genética , Southern Blotting , Clonagem Molecular , Geminiviridae/fisiologia , Plantas Geneticamente Modificadas , Plantas Tóxicas , RNA Viral/biossíntese , Nicotiana/microbiologia , Replicação Viral/genéticaRESUMO
Light, chemicals, and mutations that affect the carotene content of the fungus Phycomyces blakesleeanus had practically no effect on the ergosterol content. Lovastatin, a specific inhibitor of hydroxymethylglutaryl coenzyme A reductase, blocked growth at 1 microM; sodium DL-mevalonate (10 mM) fully reversed this inhibition. In the presence of [14C]mevalonate, a carS mutant accumulated 16 times more beta-carotene than the wild-type with a specific radioactivity five times lower. The specific radioactivity of ergosterol was different from that of beta-carotene, even when calculated in terms of the constituent isoprene units, and unaffected by the carS mutation. The carotene and sterol pathways of Phycomyces are independently regulated and physically separated in different subcellular compartments.
Assuntos
Carotenoides/metabolismo , Ergosterol/metabolismo , Phycomyces/metabolismo , Carotenoides/genética , Luz , Ácido Mevalônico/farmacologia , Mutação , Ácidos Ftálicos/farmacologia , Phycomyces/efeitos dos fármacos , Phycomyces/genética , Phycomyces/efeitos da radiaçãoAssuntos
Regulação da Expressão Gênica no Desenvolvimento/efeitos da radiação , Regulação da Expressão Gênica de Plantas/efeitos da radiação , Desenvolvimento Vegetal , Plantas/genética , Arabidopsis/genética , Arabidopsis/crescimento & desenvolvimento , Arabidopsis/efeitos da radiação , Genes de Plantas , Luz , Mutação , Fotossíntese , Plantas/efeitos da radiação , Seleção Genética , Transdução de Sinais/efeitos dos fármacosRESUMO
Transgenic tobacco plants carrying a genetic cassette including an antisense DNA sequence of the virally encoded AL1 gene of the geminivirus tomato golden mosaic virus (TGMV) were constructed; AL1 encodes a protein absolutely required for TGMV DNA replication. These genetic cassettes also contained, on the same transcription unit, a gene encoding hygromycin resistance, which allowed selection for concomitant expression of the antisense gene. In transgenic lines, RNA transcripts of the predicted size and strand specificity were detected in antisense plants and sense controls. After infection of plants with TGMV, by agroinoculation, the frequency of symptom development was very significantly reduced in a number of antisense lines and correlated, broadly, with the abundance of antisense RNA transcript and with a reduction in viral DNA harvested from infected leaf tissue. We used an in vitro assay to study viral DNA replication in the absence of cell-to-cell spread; no replication was seen in five of the six antisense lines studied, in contrast to controls.
Assuntos
Vírus de DNA/genética , DNA Viral/genética , Genes Virais , Vírus do Mosaico/genética , Nicotiana/genética , Plantas Tóxicas , Transformação Genética , DNA Antissenso , DNA Viral/análise , Engenharia Genética , Plasmídeos , Mapeamento por Restrição , Nicotiana/microbiologiaRESUMO
The existence and the mode of operation of certain enzyme aggregates may be established from the concentrations of intermediates measured in the presence of specific inhibitors. beta-Carotene, the most abundant carotenoid pigment in the fungus Phycomyces blakesleeanus, arises from ring formation at both ends of lycopene. The inhibitors nicotine, imidazole, alpha-picoline, and 2-(4-chlorophenylthio)triethylamine lead to the simultaneous accumulation of lycopene, beta-carotene, and the one-ring intermediate gamma-carotene. The quantitative analytical values obey precise mathematical relationships: those expected from the operation of an enzyme aggregate with two cyclases equally sensitive to the inhibitors. The intermediates lycopene and gamma-carotene rejected by chemically inhibited enzymes may be readmitted to other cyclases in the wild type but not in heterokaryons containing a carA mutation. We have calculated the fraction of inhibited cyclase under each condition, the affinity constant of each inhibitor for the cyclase, and the probability that a rejected intermediate molecule will be readmitted and further metabolized. The probabilities for lycopene and gamma-carotene are identical and independent of the inhibitor responsible for the rejection. Our calculations suggest that each rejected intermediate molecule is readmitted to the enzyme aggregates two or three times on the average.
Assuntos
Carotenoides/biossíntese , Complexos Multienzimáticos/metabolismo , Phycomyces/enzimologia , Etilaminas/farmacologia , Imidazóis/farmacologia , Cinética , Modelos Teóricos , Nicotina/farmacologia , Phycomyces/efeitos dos fármacos , Picolinas/farmacologia , beta CarotenoRESUMO
Blue light stimulates the accumulation of beta-carotene (photocarotenogenesis) in the fungus Phycomyces blakesleeanus. To be effective, light must be given during a defined period of development, which immediately precedes the cessation of mycelial growth and the depletion of the glucose supply. The competence periods for photocarotenogenesis and photomorphogenesis in Phycomyces are the same when they are tested in the same mycelium. Photocarotenogenesis exhibits a two-step dependence on exposure, as if it resulted from the additon of two separate components with different thresholds and amplitudes. The low-exposure component produces a small beta-carotene accumulation, in comparison with that of dark-grown mycelia. The high-exposure component has a threshold of about 100 J· m(-2) blue light and produces a large beta-carotene accumulation, which is not saturated at 2·10(6) J·m(-2). Exposure-response curves were obtained at 12 wavelengths from 347 to 567 nm. The action spectra of the two components share general similarities with one another and with those of other Phycomyces photoresponses. The small, but significant differences in the action spectra of the two components imply that the respective photosystems are not identical. Light stimulates the carotene pathway in the carB mutants, which contain the colourless precursor phytoene, but not beta-carotene. Carotenogenesis is not photoinducible in carA mutants, independently of their carotene content. This and other observations on various car mutants indicate that light prevents the normal inhibition of the pathway by the carA and carS gene products. The chromophore(s) for photocarotenogenesis are presumably flavins, and not carotenes.