RESUMO
PURPOSE: To study the kinetics of growth and the phenotype of cells cultured from human limbal explants in a cholera toxin-free medium with no feeder cell layer. METHODS: Human organ-cultured corneas were used to prepare limbal explants (full-thickness and superficial limbal explants) and corneal stromal explants. Cell growth kinetics and phenotypes were assessed by cultivating explants in cholera toxin-free Green medium. Epithelial and progenitor cell markers were assessed by immunocytochemistry, flow cytometry, and Reverse Transcription and Polymerase Chain Reaction (RT-PCR). RESULTS: The successful epithelial cell growth rates from full thickness limbal explant and superficial limbal explant tissues were 41 and 86%, respectively (p=0.0001). The mean cell area and the percentage of small cells in superficial and full-thickness explant cultures were, respectively, 317 µm(2) and 429 µm(2), and 8.9% and 1.7% (p<0.001). The percentage of positive cells in superficial and full-thickness limbal explant cultures as assessed by immunocytochemistry were the following: broad spectrum cytokeratins (cytokeratins 4, 5, 6, 8, 10, 13, and 18 [MNF116]), 82%/37% (p=0.01); cytokeratin 3 (CK3), 74%/25% (p=0.009); cytokeratin 19 (CK19), 46%/25% (p=0.19); vimentin, 56%/53% (p=0.48); delta N p63α, 54%/0% (p<0.001); and ABCG2, 5%/0% (p=0.1). Flow cytometry showed a higher percentage of small cells, a higher percentage of MNF116+ cells, and stronger expression of progenitor-associated markers in superficial than in full-thickness explant cultures. For superficial limbal explant cultures, analysis of the expression profiles for various mRNAs at the end of 21 days of culture showed high levels of expression of the mRNAs encoding CK3, vimentin, and CK19. The expression of mRNA of delta N p63α and ABCG2 was weaker. Cultures obtained from full-thickness limbal explants featured no expression of mRNA of CK19, delta N p63α, and ABCG2, whereas mRNAs encoding CK3 and vimentin were detected. Human corneal stromal explants cultured with the same medium featured late cell growth, large mean cell area (2,529 µm(2)), no expression of cytokeratins, delta N p63α, and ABCG2, and high expression of vimentin. CONCLUSIONS: Superficial limbal explants appear to be superior to full-thickness limbal explants for growing human limbal epithelial cells. Preparation of explants using surgical facilities (i.e., operating microscope and microsurgical blades) led to a dramatic increase in the percentage of successful cultures, higher epithelial cell growth, decreased fibroblast contamination, and better preservation of limbal epithelial progenitors.
Assuntos
Córnea/patologia , Células Epiteliais/citologia , Limbo da Córnea/patologia , Adulto , Idoso , Idoso de 80 Anos ou mais , Células Cultivadas , Toxina da Cólera/química , Córnea/metabolismo , Transplante de Córnea , Citometria de Fluxo/métodos , Humanos , Imuno-Histoquímica/métodos , Cinética , Limbo da Córnea/metabolismo , Microscopia Confocal/métodos , Pessoa de Meia-Idade , Fenótipo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , Células-Tronco/citologiaRESUMO
INTRODUCTION: Bacteriological testing is aimed to reduce the risk of transmission of infections. However, the detection of Bacteria by culture requires from 18hours to 14 days and may produce erroneous results for fastidious species. The goal of this work was to design and validate a new tool for bacterial testing. METHODS: The test is based on the fast real-time PCR (frt PCR). The DNA extracted from samples containing internal controls are introduced into four tubes containing primers and probes for the frt PCR. The cycling program consists in 1×at 95°C for 10min and 45×(15s at 95°C, 8s) at 52°C and 10s at 72°C. RESULTS: The frt PCR detects 0,01 CFU/µl of Bacteria and identifies eight Genera without interferences from the environment or from fungi and with no need for melting curve analysis or additional sequencing. DISCUSSION: The frt PCR detects and quantifies Bacteria identifying and assessing the load of Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria. CONCLUSION: Cultures require at least 24hours but the new frt PCR reduces the time to 90minutes. Larger series of samples are necessary to confirm the usefulness of this new test for routine bacterial sterility controls.
Assuntos
Bactérias/isolamento & purificação , Reação em Cadeia da Polimerase em Tempo Real/métodos , Bactérias/classificação , Bactérias/genética , DNA Bacteriano/análise , Humanos , Fatores de TempoRESUMO
BACKGROUND: Acanthamoeba keratitis (AK) is a sight-threatening infection, and none of the current diagnosis tests are able to detect in one reaction low levels of the vast majority of strains associated with pathology. The goal of this work was to validate a new tool for the detection of the American Type Cell Collection (ATCC) referenced Acanthamoeba monitoring simultaneously DNA extraction yields and PCR inhibitors. Performances were assessed on corneal scrapings. METHODS: Primers were selected in a region bracketing a 41 591 bp of the A castellanii mitochondrion gene. DNA extraction and PCR inhibitors were monitored by adding an internal control (virus). Acanthamoeba were detected and quantified by the real-time fast-duplex TaqMan PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green real-time PCR. RESULTS: The f-d-real-t PCR detects 0.1 cyst/microl or less of the 10 referenced strains (sensitivity slightly lower for A astronyxis). Bacteria, fungi and herpesviruses do not cross-react. The specificity and sensitivity of the f-d-real-t PCR were higher than culture and other real-time PCR on 20 keratitis samples. CONCLUSION: The f-d-real t PCR detects in less than 2 h the Acanthamoeba strains available from the ATCC with a higher sensitivity and specificity than techniques previously reported. Larger trials are necessary to validate its usefulness for disease management and environmental studies.
Assuntos
Ceratite por Acanthamoeba/diagnóstico , Acanthamoeba/isolamento & purificação , Acanthamoeba/classificação , Acanthamoeba/genética , Ceratite por Acanthamoeba/parasitologia , Animais , Primers do DNA , DNA de Protozoário/análise , Genótipo , Humanos , Parasitologia/métodos , Reação em Cadeia da Polimerase/métodos , Sensibilidade e EspecificidadeRESUMO
BACKGROUND: Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE. METHODS: The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared. RESULTS: The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/microl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative. CONCLUSION: The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.
Assuntos
Endoftalmite/diagnóstico , Humor Aquoso/microbiologia , Técnicas de Tipagem Bacteriana/métodos , DNA Bacteriano/análise , Endoftalmite/microbiologia , Humanos , Reação em Cadeia da Polimerase/métodos , Sensibilidade e Especificidade , Corpo Vítreo/microbiologiaRESUMO
BACKGROUND: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). MATERIAL AND METHODS: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube. RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.