The alkaloid cryptolepine as a source of polyadenylate targeting therapeutic agent: Induction of self-assembly in the polyadenylate moiety.

RNAs have become a well-known target for chemotherapeutic agents in the recent years. The tails of most eukaryotic m-RNA are characterized by the presence of a long polyadenylate sequence which plays an important role in its growth and maturation. This lays emphasis on development of molecular probes that target the polyadenylate sequence. Cryptolepine (hereafter, CRP) is an indoloquinoline alkaloid well known for its anti-malarial activities. A series of spectroscopic experiments namely absorption studies, fluorimetric studies and circular dichroism studies show that cryptolepine binds with single-stranded polyriboadenylic acid (hereafter, ss-poly (rA)) with a binding constant of ∼5 × 103 M-1 at 25 °C. Moreover thermal denaturation experiments show that the bound form of polyriboadenylic acid shows a characteristic transition profile. Such a profile is indicative of the ability of cryptolepine to induce self-assembly in the polyriboadenylic acid sequence on binding to it. Such ability of CRP to modulate the structural conformation of poly (rA), which in turn may cause functional aspects of the RNA to change, may give us a chance to develop effective alkaloid based chemotherapeutic agents.

Comparative binding studies on the interaction of the indoloquinoline alkaloid cryptolepine with the B and the non-canonical protonated form of DNA: A spectroscopic insight.

BACKGROUND: Low pH induced nucleic acid polymorphism and the interaction of naturally occurring small molecules with different polymorphic forms of DNA have been the focus in developing new drugs. Recent studies have revealed that low pH plays an active role in growth and development of cancer cells. Our target is to find whether and how the indoloquinoline alkaloid cryptolepine (CRP) interact with different polymorphic forms of natural DNA, in hope to explore this group of alkaloids as new therapeutics. METHODS: Multiple spectroscopic techniques that include UV-visible absorption spectrophotometry, fluorimetry, CD spectroscopy along with thermal melting studies were employed to characterize the interaction between the alkaloid cryptolepine with the B and protonated forms of DNA. RESULTS & CONCLUSIONS: Cryptolepine has been found to interact with either forms of DNA. The nature of binding is non-cooperative in both cases. Data show that the affinity of CRP to B form of DNA is relatively higher than that for the protonated form of DNA. Circular dichroic studies reveal that the alkaloid converts the left handed protonated DNA into bound right handed form. Fluorescence quenching experiments reveal that cryptolepine intercalates within the DNA base pairs. Thermal melting studies show that the alkaloid stabilises the DNA structures. GENERAL SIGNIFICANCE: Such non-B DNA structures are often present at the 'mutation hotspots' that are associated with genetic instability related diseases such as cancer. The ability of cryptolepine to interact to such non-B DNA structures makes it a useful substrate in the designing of potential chemotherapeutic agents.

Influence of position of hydroxyl group of flavonoids on their binding with single stranded polyriboadenylic acid: A spectroscopic evaluation.

Single stranded polyriboadenylic acid [poly (rA)] has been accepted widely as a suitable drug target owing to its vital role in the development of cancer since it controls gene expression during cell growth and differentiation. The biological properties of poly (rA) depend on its structural morphology. Pharmacologically active flavonoids can act as suitable binders to poly (rA) and significantly change its biophysical properties. Different factors favour flavonoid-poly (rA) binding. In our present work we have explored the role played by the position of hydroxyl groups in the flavonoids namely 3, 5, 6 and 7 hydroxyflavones in their course of interaction with poly (rA). A range of spectroscopic experiments reveal that 3HF binds best to poly (rA) among the four chosen flavonoids. This is probably due to the presence of a hydroxyl group in '3' position that enables it to exhibit ESIPT phenomenon which is missing for the other used flavonoids.

In-depth investigation of the binding of flavonoid taxifolin with bovine hemoglobin at physiological pH: Spectroscopic and molecular docking studies.

The use of bioactive flavonoids as drugs has long mesmerized the scientific world. Their small size and planar structure enables them to interact with limitless substrates especially biomolecules. Taxifolin is a flavonoid well known for its anti-oxidizing and metal chelating properties. Its interaction with a few biomolecules has been studied so far to exploit its pharmacological activities. Hemoglobin, an iron containing macromolecule acts as a major carrier protein and is also associated with the occurrence of many diseases. Our present study lays emphasis on the interaction of flavanonol taxifolin with bovine hemoglobin at physiological pH. This was achieved by monitoring the changes in the absorbance, fluorescence, anisotropic, lifetime and circular dichroic spectra. Benesi-Hildebrand plot determined a binding constant value of 20.0 × 103 M-1 at 25 °C. Stern-Volmer quenching studies reveal that the binding is associated with a static mode of quenching. The complexation is thermodynamically favored as indicated by the negative value of enthalpy and positive value of entropy changes seen from the van't Hoff plot. Theoretical DFT calculations were used to find out an optimized geometry and HOMO-LUMO energy gap for taxifolin. Molecular docking studies revealed the location of taxifolin inside the hemoglobin moiety.

Elucidation of the association of potential chemotherapeutic alkaloid chelerythrine with bovine hemoglobin by experimental probing and molecular docking simulation.

Chelerythrine (CHL) is a pharmacologically important molecule that appears in positively charged iminium and neutral alkanolamine form on varying the pH. Association of bovine hemoglobin (BHb) with iminium and alkanolamine forms of CHL is explored employing several spectroscopic and theoretical tools. Our results revealed that iminium form of CHL shows greater binding affinity than the neutral alkanolamine form, with nearly one binding site on the protein for both forms. Thermodynamic data showed that the iminium binding to BHb was characterized by negative enthalpy and positive entropy changes while the association of the alkanolamine CHL was accompanied with both positive enthalpy and entropy changes. Both forms of CHL have been found to quench the intrinsic fluorescence of BHb. From Förster's resonance energy transfer (FRET) studies, the binding distance between the energy acceptor (CHL) and donor (ß-Trp 37 of BHb) was found to be optimum for fluorescence quenching to occur. The conformational transformation of BHb induced by CHL complexation showed greater unfolding of the protein architecture for the iminium interaction from CD spectroscopy. Molecular docking study revealed that both iminium and alkanolamine form of CHL reside near ß-Trp 37 at the α1ß2 interface of BHb.

Molecular insight into the binding aspects of benzo[c]phenanthridine alkaloid nitidine with bovine hemoglobin: A biophysical exploration.

The association of a putative bioactive alkaloid nitidine (NIT) with blood protein bovine hemoglobin (BHb) was investigated by employing various biophysical and molecular docking techniques. NIT binding to BHb was first characterized by hypochromic effect on the Soret band absorption of BHb from spectrophotometric studies. Spectrofluorimetric titration and unchanged fluorescence lifetime of BHb confirmed ground state complexation followed by the static nature of the emission quenching mechanism of the protein induced by NIT. Substantial conformational changes in the protein structure were established from circular dichroism study. Conformational perturbation results a lowering in the α-helical organization of the tetrameric protein structure. Thermodynamics of the binding suggest that the binding is exothermic with a favourable small positive entropy change and negative enthalpy change making a sense of electrostatic interaction as the major acting force. Experimentally calculated free energy change for the NIT-BHb interaction was found to be -7.50 kcal mol-1 which is in well agreement to the theoretical docking energy value of -6.36 kcal mol-1. AutoDock based molecular docking suggests the internal cavity of BHb as the preferred binding position of NIT. Overall this manuscript depicts consequences on the molecular interaction of NIT with BHb from structural and energetic standpoints providing a profound insight into protein-ligand association.

Targeting human telomeric DNA quadruplex with novel berberrubine derivatives: insights from spectroscopic and docking studies.

Study on bioactive molecules, capable of stabilizing G-Quadruplex structures is considered to be a potential strategy for anticancer drug development. Berberrubine (BER) and two of its analogs bearing alkyl phenyl and biphenyl substitutions at 13-position were studied for targeting human telomeric G-quadruplex DNA sequence. The structures of berberrubine and analogs were optimized by density functional theory (DFT) calculations. Time-dependent DFT (B3LYP) calculations were used to establish and understand the nature of the electronic transitions observed in UV-vis spectra of the alkaloid. The interaction of berberrubine and its analogs with human telomeric G-quadruplex DNA sequence 5'-(GGGTTAGGGTTAGGGTTAGGG)-3' was investigated by biophysical techniques and molecular docking study. Both the analogs were found to exhibit higher binding affinity than natural precursor berberrrubine. 13-phenylpropyl analog (BER1) showed highest affinity [(1.45 ± 0.03) × 105 M-1], while the affinity of the 13-diphenyl analog (BER2) was lower at (1.03 ± 0.05) × 105 M-1, and that of BER was (0.98 ± 0.03) × 105 M-1. Comparative fluorescence quenching studies gave evidence for a stronger stacking interaction of the analog compared to berberrubine. The thiazole orange displacement assay has clearly established that the analogs were more effective in displacing the end stacked dye in comparison to berberrubine. Molecular docking study showed that each alkaloid ligand binds primarily at the G rich regions of hTelo G4 DNA which makes them G specific binder towards hTelo G4 DNA. Isothermal titration calorimetry studies of quadruplex-berberrubine analog interaction revealed an exothermic binding that was favored by both enthalpy and entropy changes in BER in contrast to the analogs where the binding was majorly enthalpy dominated. A 1:1 binding stoichiometry was revealed in all the systems. This study establishes the potentiality of berberrubine analogs as a promising natural product based compounds as G-quadruplex-specific ligands.

Spectroscopic, photophysical and theoretical insight into the chelation properties of fisetin with copper (II) in aqueous buffered solutions for calf thymus DNA binding.

Fisetin (FTN) and its metal chelates are critically important since this bioflavonoid possesses wide range of pharmacological properties. Usually, metal binding property enhances the pharmaceutical activity of FTN. Thus in this report, we investigated the complexation of FTN with biologically essential metal ion Cu2+ and further examined the effect of such complexation on calf thymus DNA (CT DNA) binding in comparison with free FTN. We have characterized the complex formation of FTN with Cu2+ using UV-visible, fluorimetric and FTIR studies. Within our experimental concentration range we found that, FTN forms a 2:1 complex with Cu2+ in terms of FTN:Cu2+. Spectroscopic analysis revealed that both FTN and FTN2-Cu2+ complex bind with CT DNA and the binding constant is higher for free FTN. Perturbation of circular dichroism spectrum of CT DNA was observed in presence of free FTN due to structural alteration in DNA double helix. Viscometric, thermal melting and fluorescence quenching study confirm that FTN intercalates in between the base pairs of CT DNA while its Cu (II) complex acts as a groove binder. Molecular docking study further confirms that FTN intercalates into AT rich region of CT DNA while its Cu (II) complex binds at the minor groove.

Structural alteration of low pH, low temperature induced protonated form of DNA to the canonical form by the benzophenanthridine alkaloid nitidine: Spectroscopic exploration.

Polymorphism of DNA plays a very important part of research relating to the drug-DNA interactions. Here main focus of our investigation is to monitor the interaction of the benzophenanthridine plant alkaloid, nitidine (NIT) with two different forms of DNA i.e. B-DNA and protonated form of DNA maintaining proper temperatures and buffer conditions. Binding interaction of NIT was ascertained from the UV-Visible spectroscopic and spectrofluorimetric titration experiments. Binding constants of the interactions of NIT with different polymorphic forms were calculated from UV-absorption study. The binding constants were 3.8 × 105 M-1 and 1.3 × 105 M-1 for B-DNA and protonated DNA respectively. Red shift in the absorption maxima of NIT on binding with DNA, comparatively greater relative quenching of fluorescence intensity of free NIT than bound NIT, perturbation in the CD spectrum of DNA in presence of NIT confirmed the mode of binding as intercalation. Moreover, spectropolarimetric experiment confirms that left handed protonated form of DNA gets partially converted to the canonical B form of DNA while binds with NIT. Besides the CD experiment, thermal melting experiment also showed that on binding with NIT stabilization of protonated DNA was increased to an appreciable extent.

Self-structure assembly in single stranded polyriboadenylic acid by benzophenanthridine alkaloid: Spectroscopic and calorimetric exploration.

Present study allows us a better understanding of the interaction of nitidine, a benzophenanthridine alkaloid with single stranded polyriboadenylic acid [ss-poly (rA)]. The interaction leads to self-structure induction in ss-poly (rA) under the experimental condition of pH 7.0. Interaction of nitidine with ss-poly (rA) was ascertained by monitoring the change in absorbance, fluorescence intensity and circular dichroism values. Binding mode of nitidine with ss-poly (rA) was observed to be intercalation as confirmed from the quenching and viscometric studies. The association was characterized by both negative enthalpy and entropy changes accompanying with a moderately high binding constant of 5.10×105M-1. Nitidine induced double helical organization in single stranded poly (rA) under the experimental pH.

Domain-Specific Association of a Phenanthrene-Pyrene-Based Synthetic Fluorescent Probe with Bovine Serum Albumin: Spectroscopic and Molecular Docking Analysis.

In this report, the interaction between a phenanthrene-pyrene-based fluorescent probe (PPI) and bovine serum albumin (BSA), a transport protein, has been explored by steady-state emission spectroscopy, fluorescence anisotropy, far-ultraviolet circular dichroism (CD), time-resolved spectral measurements, and molecular docking simulation study. The blue shift along with emission enhancement indicates the interaction between PPI and BSA. The binding of the probe causes quenching of BSA fluorescence through both static and dynamic quenching mechanisms, revealing a 1:1 interaction, as delineated from Benesi-Hildebrand plot, with a binding constant of ∼105 M-1, which is in excellent agreement with the binding constant extracted from fluorescence anisotropy measurements. The thermodynamic parameters, ΔH°, ΔS°, and ΔG°, as determined from van't Hoff relationship indicate the predominance of van der Waals/extensive hydrogen-bonding interactions for the binding phenomenon. The molecular docking and site-selective binding studies reveal the predominant binding of PPI in subdomain IIA of BSA. From the fluorescence resonance energy transfer study, the average distance between tryptophan 213 of the BSA donor and the PPI acceptor is found to be 3.04 nm. CD study demonstrates the reduction of α-helical content of BSA protein on binding with PPI, clearly indicating the change of conformation of BSA.

Role of hydroxyl groups in the B-ring of flavonoids in stabilization of the Hoogsteen paired third strand of Poly(U).Poly(A)*Poly(U) triplex.

We have reported the interaction of two flavonoids namely quercetin (Q) and morin (M) with double stranded poly(A).poly(U) (herein after A.U) and triple stranded poly(U).poly(A)*poly(U) (herein after U.A*U, dot represents the Watson-Crick and asterisk represents Hoogsteen base pairing respectively) in this article. It has been observed that relative positions of hydroxyl groups on the B-ring of the flavonoids affect the stabilization of RNA. The double strand as well as the triple strand of RNA-polymers become more stabilized in presence of Q, however both the duplex and triplex remain unaffected in presence of M. The presence of catechol moiety on the B-ring of Q is supposed to be responsible for the stabilization. Moreover, after exploiting a series of biophysical experiments, it has been found that, triple helical RNA becomes more stabilized over its parent duplex in presence of Q. Fluorescence quenching, viscosity measurement and helix melting results establish the fact that Q binds with both forms of RNA through the mode of intercalation while M does not bind at all to either forms of RNA.

Multispectroscopic and Theoretical Exploration of the Comparative Binding Aspects of Bioflavonoid Fisetin with Triple- and Double-Helical Forms of RNA.

The interactions of RNA triplex (U.A*U) and duplex (A.U) with naturally occurring flavonoid fisetin (FTN) have been examined at pH 7.0 using various spectroscopic, viscometric, and theoretical studies. Experimental observations showed that the ligand binds with both double- and triple-helical forms of RNA, although the binding affinity is greater for the triplex structure (5.94 × 106 M-1) compared to that for the duplex counterpart (1.0 × 105 M-1). Thermal melting experiments revealed that the Hoogsteen base-paired third strand of triplex was stabilized to a greater extent (∼14 °C) compared with the Watson-Crick base-paired second strand (∼4 °C) in the presence of FTN. From fluorimetric study, we observed that U.A*U and A.U primarily bind to the photoproduced tautomer of FTN in the excited state. Steady-state and time-resolved anisotropy measurements illustrate considerable modulations of the spectroscopic properties of the tautomeric FTN within the RNA environment. Viscometric, fluorescence quenching, and thermal melting studies all together support the mode of binding to be intercalation. Theoretical study explains the experimental absorption and emission (dual fluorescence) behavior of FTN along with the excited-state intramolecular proton transfer process.

Third strand stabilization of poly(U)·poly(A)* poly(U) triplex by the naturally occurring flavone luteolin: A multi-spectroscopic approach.

Naturally occurring flavonoid luteolin (LTN) was found to interact with double stranded poly(A).poly(U) and triple stranded poly(U)·poly(A)*poly(U) with association constants of the order of 104M-1. The association was monitored by various spectroscopic and viscometric techniques. Non-cooperative binding was observed for the association of LTN with two different polymorphic forms of RNA. Intercalation mode of binding was confirmed by fluorescence quenching and viscometric experiments. Thermal melting profiles indicated greater stabilization of the Hoogsteen base paired third strand (∼16°C) compared to Watson-Crick double strand (∼5°C) of RNA by LTN. Since the interaction of naturally occurring small molecules with RNA is an active area of research, this study has led to great openings to explore LTN as RNA targeted therapeutic agent.

Spectroscopic study on the binding of chelerythrine with duplex poly (rA): A model of RNA intercalation.

Here we have reported a detail study on the interaction of the benzophenanthridine alkaloid chelerythrine (CHL) with double stranded polyriboadenylic acid [ds poly (rA)] by exploiting various spectroscopic techniques. The alkaloid shows high binding affinity (binding constant is 1.10×105M-1) towards the double stranded RNA as revealed from Scatchard plot. The binding was confirmed by hypochromic effect in the UV-vis spectrum of CHL, increase in fluorescence intensity of CHL and perturbations of the circular dichroism (CD) spectrum of ds poly (rA). Later fluorescence quenching, cooperative CD melting transition, viscometric and molecular modeling studies establish the fact that the alkaloid binds to the ds poly (rA) by the mechanism of intercalation. Thermodynamic parameters obtained from the isothermal titration calorimetric (ITC) study show that the binding is favoured by negative enthalpy and small positive entropy changes. This report may be a model for intercalation of small molecule like CHL to the double stranded RNA.

Micelle assisted structural conversion with fluorescence modulation of benzophenanthridine alkaloids.

In this study we have reported the anionic surfactant (Sodium dodecyl sulfate, SDS) driven structural conversion of two benzophenanthridine plant alkaloids namely Chelerythrine (herein after CHL) and Sanguinarine (herein after SANG). Both the alkaloids exist in two forms: the charged iminium and the neutral alkanolamine form. The iminium form is stable at low pH (<6.5) and the alkanolamine form exists at higher pH (>10.1). The fluorescence intensity of the alkanolamine form is much stronger than the iminium form. The iminium form of both the alkaloids remains stable whereas the alkanolamine form gets converted to the iminium form in the SDS micelle environment. The iminium form possesses positive charge and it seems that electrostatic interaction between the positively charged iminium and negatively charged surfactant leads to the stabilization of the iminium form in the Stern layer of the anionic micelle. Whereas the conversion of the alkanolamine form into the iminium form takes place and that can be monitored in naked eye since the iminium form is orange in colour and the alkanolamine form has blue violet emission. Such a detail insight about the photophysical properties of the benzophenanthridine alkaloids would be a valuable addition in the field of alkaloid-surfactant interaction.

Inhibitory effects of the dietary flavonoid quercetin on the enzyme activity of zinc(II)-dependent yeast alcohol dehydrogenase: Spectroscopic and molecular docking studies.

A multispectroscopic exploration was employed to investigate the interaction between the metallo-enzyme alcohol dehydrogenase (ADH) from yeast with bioflavonoid quercetin (QTN). Here, we have characterized the complex formation between QTN and Zn2+ in aqueous solution and then examined the effect of such complex formation on the enzymatic activity of a zinc(II)-dependent enzyme alcohol dehydrogenase from yeast. We have observed an inhibition of enzymatic activity of ADH in presence of QTN. Enzyme inhibition kinetic experiments revealed QTN as a non-competitive inhibitor of yeast ADH. Perturbation of Circular dichroic (CD) spectrum of ADH in presence of QTN is observed due to the structural changes of ADH on complexation with the above flavonoid. Our results indicate a conformational change of ADH due to removal of Zn2+ present in the enzyme by QTN. This was further established by molecular modeling study which shows that the flavonoid binds to the Zn2+ ion which maintains the tertiary structure of the metallo-enzyme. So, QTN abstracts only half of the Zn2+ ions present in the enzyme i.e. one Zn2+ ion per monomer. From the present study, the structural alteration and loss of enzymatic activity of ADH are attributed to the complex formation between QTN and Zn2+.

An overview on the interaction of phenazinium dye phenosafranine to RNA triple and double helices.

Triple helical nucleic acids or triplex are formed from the combination of three oligonucleotides. In the double stranded form the base pairs are joined through Watson-Crick base pairing while the third strand of the triplex is joined through Hoogsteen base pairing. The Hoogsteen base paired strands are less stable compare to the Watson-Crick strands. Thus stabilization of the Hoogsteen strand gains importance due to the implication of stable triplexes in various biological processes. For this reason here we have monitored the effect of phenosafranine, a phenazinium dye on the structure of poly(U).poly(A)*poly(U) triplex. Our data revealed that the dye has higher binding affinity to the RNA triplex (K'=3.7 × 10(5) M(-1)) compared to the parent duplex (K'=1.9 × 10(5) M(-1)) form. Through a series of spectroscopic and viscometric study we have found that the dye binds to triplex or duplex through the mechanism of intercalation and it stabilizes the Watson-Crick strand while the Hoogsteen strand remains unaffected.

Molecular Aspects of the Interaction of Iminium and Alkanolamine Forms of the Anticancer Alkaloid Chelerythrine with Plasma Protein Bovine Serum Albumin.

The interaction between a quaternary benzophenanthridine alkaloid chelerythrine (herein after, CHL) and bovine serum albumin (herein after, BSA) was probed by employing various spectroscopic tools and isothermal titration calorimetry (ITC). Fluorescence studies revealed that the binding affinity of the alkanolamine form of the CHL is higher compared to the iminium counterpart. This was further established by fluorescence polarization anisotropy measurement and ITC. Fluorescence quenching study along with time-resolved fluorescence measurements establish that both forms of CHL quenched the fluorescence intensity of BSA through the mechanism of static quenching. Site selective binding and molecular modeling studies revealed that the alkaloid binds predominantly in the BSA subdomain IIA by electrostatic and hydrophobic forces. From Forster resonance energy transfer (FRET) studies, the average distances between the protein donor and the alkaloid acceptor were found to be 2.71 and 2.30 nm between tryptophan (Trp) 212 (donor) and iminium and alkanolamine forms (acceptor), respectively. Circular dichroism (CD) study demonstrated that the α-helical organization of the protein is reduced due to binding with CHL along with an increase in the coiled structure. This is indicative of a small but definitive partial unfolding of the protein. Thermodynamic parameters obtained from ITC experiments revealed that the interaction is favored by negative enthalpy change and positive entropy change.

Exploring the comparative binding aspects of benzophenanthridine plant alkaloid chelerythrine with RNA triple and double helices: a spectroscopic and calorimetric approach.

A comparative study on the interaction of a benzophenanthridine alkaloid chelerythrine (CHL) with RNA triplex poly(U).poly(A)*poly(U) (hereafter U.A*U, .(dot) and *(asterisk) represent Watson-Crick and Hoogsteen base pairing respectively) and its parent duplex poly(A).poly(U) (A.U) was carried out by using a combination of various spectroscopic, viscometric and calorimetric techniques. The interaction was characterized by hypochromic and bathochromic effects in the absorption spectrum, the increase of thermal melting temperature, enhancement in solution viscosity, and perturbation in the circular dichroic spectrum. The binding constant calculated by using spectrophotometric data was in the order of 10(5) for both forms of RNA, but it was greater for triplex RNA (30.2 × 10(5) M(-1)) than duplex RNA (3.6 × 10(5) M(-1)). Isothermal titration calorimetric data are in good agreement with the spectrophotometric data. The data indicated stronger binding of CHL to the triplex structure of RNA compared to the native duplex structure. Thermal melting studies indicated greater stabilization of the Hoogsteen base paired third strand of the RNA triplex compared to its Watson-Crick strands. The mode of binding of CHL to both U.A*U and A.U was intercalation as revealed from fluorescence quenching, viscosity measurements and sensitization of the fluorescence experiment. Thermodynamic data obtained from isothermal calorimetric measurements revealed that association was favoured by both a negative enthalpy change and a positive entropy change. Taken together, our results suggest that chelerythrine binds and stabilizes the RNA triplex more strongly than its respective parent duplex. The results presented here may be useful for formulating effective antigene strategies involving benzophenanthridine alkaloids and the RNA triplex.