Targeting Chromatin Remodeling in Inflammation and Fibrosis.

Mucosal surfaces of the human body are lined by a contiguous epithelial cell surface that forms a barrier to aerosolized pathogens. Specialized pattern recognition receptors detect the presence of viral pathogens and initiate protective host responses by triggering activation of the nuclear factor κB (NFκB)/RelA transcription factor and formation of a complex with the positive transcription elongation factor (P-TEFb)/cyclin-dependent kinase (CDK)9 and Bromodomain-containing protein 4 (BRD4) epigenetic reader. The RelA·BRD4·P-TEFb complex produces acute inflammation by regulating transcriptional elongation, which produces a rapid genomic response by inactive genes maintained in an open chromatin configuration engaged with hypophosphorylated RNA polymerase II. We describe recent studies that have linked prolonged activation of the RelA-BRD4 pathway with the epithelial-mesenchymal transition (EMT) by inducing a core of EMT corepressors, stimulating secretion of growth factors promoting airway fibrosis. The mesenchymal state produces rewiring of the kinome and reprogramming of innate responses toward inflammation. In addition, the core regulator Zinc finger E-box homeodomain 1 (ZEB1) silences the expression of the interferon response factor 1 (IRF1), required for type III IFN expression. This epigenetic silencing is mediated by the Enhancer of Zeste 2 (EZH2) histone methyltransferase. Because of their potential applications in cancer and inflammation, small-molecule inhibitors of NFκB/RelA, CDK9, BRD4, and EZH2 have been the targets of medicinal chemistry efforts. We suggest that disruption of the RelA·BRD4·P-TEFb pathway and EZH2 methyltransferase has important implications for reversing fibrosis and restoring normal mucosal immunity in chronic inflammatory diseases.

The journey of antiphospholipid antibodies from cellular activation to antiphospholipid syndrome.

Pathogenic antiphospholipid antibodies (aPL) are the driving factors of recurrent pregnancy loss and thrombosis that characterize antiphospholipid syndrome (APS). Current evidence indicates that aPL induce a procoagulant phenotype in the vasculature and abnormal cellular proliferation and differentiation in placental tissues to cause the typical clinical features; however, the molecular mechanisms underlying these processes remain incompletely understood. Inflammation serves as a necessary link between the observed procoagulant phenotype and actual thrombus development and is an important mediator of the placental injury in APS patients. However, the underlying mechanisms for these events have also not been fully elucidated. In this review, we will outline the available data that give us our current understanding of the pathophysiology of APS, especially as it relates to the development of thromboembolic and obstetric pathological phenomena in these patients. We will also describe the intracellular signaling pathways activated by aPL in various cellular subtypes and outline the current evidence linking these pathways to clinical phenotypes. Finally, we will discuss the implications of distinct molecular patterns defining clinical phenotypes of APS patients.

Mathematical model of NF-kappaB regulatory module.

The two-feedback-loop regulatory module of nuclear factor kappaB (NF-kappaB) signaling pathway is modeled by means of ordinary differential equations. The constructed model involves two-compartment kinetics of the activators IkappaB (IKK) and NF-kappaB, the inhibitors A20 and IkappaBalpha, and their complexes. In resting cells, the unphosphorylated IkappaBalpha binds to NF-kappaB and sequesters it in an inactive form in the cytoplasm. In response to extracellular signals such as tumor necrosis factor or interleukin-1, IKK is transformed from its neutral form (IKKn) into its active form (IKKa), a form capable of phosphorylating IkappaBalpha, leading to IkappaBalpha degradation. Degradation of IkappaBalpha releases the main activator NF-kappaB, which then enters the nucleus and triggers transcription of the inhibitors and numerous other genes. The newly synthesized IkappaBalpha leads NF-kappaB out of the nucleus and sequesters it in the cytoplasm, while A20 inhibits IKK converting IKKa into the inactive form (IKKi), a form different from IKKn, no longer capable of phosphorylating IkappaBalpha. After parameter fitting, the proposed model is able to properly reproduce time behavior of all variables for which the data are available: NF-kappaB, cytoplasmic IkappaBalpha, A20 and IkappaBalpha mRNA transcripts, IKK and IKK catalytic activity in both wild-type and A20-deficient cells. The model allows detailed analysis of kinetics of the involved proteins and their complexes and gives the predictions of the possible responses of whole kinetics to the change in the level of a given activator or inhibitor.

Inhibition of proteasome activity blocks the ability of TNF alpha to down-regulate G(i) proteins and stimulate lipolysis.

Prolonged treatment of rat adipocytes with TNF alpha increases lipolysis through a mechanism mediated, in part, by down-regulation of inhibitory G proteins (G(i)). Separately, down-regulation of G(i) by prolonged treatment with an A(1)-adenosine receptor agonist, N(6)-phenylisopropyl adenosine (PIA) increases lipolysis. To investigate the role of proteolysis in TNF alpha and PIA-mediated G(i) down-regulation and stimulation of lipolysis, we used the protease inhibitors lactacystin (proteasome inhibitor) and calpeptin (calpain inhibitor). Rat adipocytes were preincubated for 1 h with lactacystin (10 microM) or calpeptin (50 microM), before 30-h treatment with either TNF alpha (50 ng/ml) or PIA (300 nM). We then measured lipolysis (glycerol release), abundance of alpha-subunits of G(i)1 and G(i)2 in plasma membranes (Western blotting) and protease activities (in specific fluorogenic assays). TNF alpha and PIA stimulated lipolysis approximately 2-fold and caused G(i) down-regulation. Although neither lactacystin nor calpeptin affected basal lipolysis, lactacystin completely inhibited both TNF alpha and PIA-stimulated lipolysis (the 50% inhibitory concentration was approximately 2 microM), whereas calpeptin had no effect. Similarly, lactacystin but not calpeptin blocked both PIA and TNF alpha-induced G(i) down-regulation. These findings provide further evidence that the chronic lipolytic effect of TNF alpha and PIA is secondary to G(i) down-regulation and suggest that the mechanism involves proteolytic degradation mediated through the proteasome pathway.

Expression of respiratory syncytial virus-induced chemokine gene networks in lower airway epithelial cells revealed by cDNA microarrays.

The Paramyxovirus respiratory syncytial virus (RSV) is the primary etiologic agent of serious epidemic lower respiratory tract disease in infants, immunosuppressed patients, and the elderly. Lower tract infection with RSV is characterized by a pronounced peribronchial mononuclear infiltrate, with eosinophilic and basophilic degranulation. Because RSV replication is restricted to airway epithelial cells, where RSV replication induces potent expression of chemokines, the epithelium is postulated to be a primary initiator of pulmonary inflammation in RSV infection. The spectrum of RSV-induced chemokines expressed by alveolar epithelial cells has not been fully investigated. In this report, we profile the kinetics and patterns of chemokine expression in RSV-infected lower airway epithelial cells (A549 and SAE). In A549 cells, membrane-based cDNA macroarrays and high-density oligonucleotide probe-based microarrays identified inducible expression of CC (I-309, Exodus-1, TARC, RANTES, MCP-1, MDC, and MIP-1 alpha and -1 beta), CXC (GRO-alpha, -beta, and -gamma, ENA-78, interleukin-8 [IL-8], and I-TAC), and CX(3)C (Fractalkine) chemokines. Chemokines not previously known to be expressed by RSV-infected cells were independently confirmed by multiprobe RNase protection assay, Northern blotting, and reverse transcription-PCR. High-density microarrays performed on SAE cells confirmed a similar pattern of RSV-inducible expression of CC chemokines (Exodus-1, RANTES, and MIP-1 alpha and -1 beta), CXC chemokines (I-TAC, GRO-alpha, -beta, and -gamma, and IL-8), and Fractalkine. In contrast, TARC, MCP-1, and MDC were not induced, suggesting the existence of distinct genetic responses for different types of airway-derived epithelial cells. Hierarchical clustering by agglomerative nesting and principal-component analyses were performed on A549-expressed chemokines; these analyses indicated that RSV-inducible chemokines are ordered into three related expression groups. These data profile the temporal changes in expression by RSV-infected lower airway epithelial cells of chemokines, chemotactic proteins which may be responsible for the complex cellular infiltrate in virus-induced respiratory inflammation.

NF-kappaB/RelA transactivation is required for atypical protein kinase C iota-mediated cell survival.

In chronic myelogenous leukemia (CML), the oncogene bcr-abl encodes a dysregulated tyrosine kinase that inhibits apoptosis. We showed previously that human erythroleukemia K562 cells are resistant to antineoplastic drug (taxol)-induced apoptosis through the atypical protein kinase C iota isozyme (PKC iota), a kinase downstream of Bcr-Abl. The mechanism(s) by which PKC iota mediates cell survival to taxol is unknown. Here we demonstrate that PKC iota requires the transcription factor nuclear factor-kappaB (NF-kappaB) to confer cell survival. At apoptosis-inducing concentrations, taxol weakly induces IkappaB(alpha) proteolysis and NF-kappaB translocation in K562 cells, but potently induces its transcriptional activity. Inhibition of NF-kappaB activity (by blocking IkappaB(alpha) degradation) significantly sensitizes cells to taxol-induced apoptosis. Likewise, K562 cells expressing antisense PKC iota mRNA or kinase dead PKC iota (PKC iota-KD) are sensitized to taxol; these cells are rescued from apoptosis by NF-kappaB overexpression. Expression of constitutively active PKC iota (PKC iota-CA) upregulates NF-kappaB transactivation and rescues cells from apoptosis in the absence of Bcr-Abl tyrosine kinase activity. Using a chimeric GAL4-RelA transactivator, we find that taxol potently activates GAL4-RelA-dependent transcription. This activation was further upregulated by expression of PKC iota-CA and inhibited by expression of PKC iota-KD. Our results indicate that RelA transactivation is an important downstream target of the PKC iota-mediated Bcr-Abl signaling pathway and is required for resistance to taxol-induced apoptosis.

Multiple cis regulatory elements control RANTES promoter activity in alveolar epithelial cells infected with respiratory syncytial virus.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normally T-cell expressed and presumably secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study, we analyzed the mechanism of RSV-induced RANTES promoter activation in human type II alveolar epithelial cells (A549 cells). Promoter deletion and mutagenesis experiments indicate that RSV requires the presence of five different cis regulatory elements, located in the promoter fragment spanning from -220 to +55 nucleotides, corresponding to NF-kappaB, C/EBP, Jun/CREB/ATF, and interferon regulatory factor (IRF) binding sites. Although site mutations of the NF-kappaB, C/EBP, and CREB/AP-1 like sites reduce RSV-induced RANTES gene transcription to 50% or less, only mutations affecting IRF binding completely abolish RANTES inducibility. Supershift and microaffinity isolation assays were used to identify the different transcription factor family members whose DNA binding activity was RSV inducible. Expression of dominant negative mutants of these transcription factors further established their central role in virus-induced RANTES promoter activation. Our finding that the presence of multiple cis regulatory elements is required for full activation of the RANTES promoter in RSV-infected alveolar epithelial cells supports the enhanceosome model for RANTES gene transcription, which is absolutely dependent on binding of IRF transcription factors. The identification of regulatory mechanisms of RANTES gene expression is fundamental for rational design of inhibitors of RSV-induced lung inflammation.

NF-kappa B-inducible BCL-3 expression is an autoregulatory loop controlling nuclear p50/NF-kappa B1 residence.

NF-kappa B is a transcription factor whose nuclear residence is controlled by I kappa B family members. In the NF-kappa B-I kappa B autoregulatory loop, activated (nuclear) Rel A.NF-kappa B1 induces the resynthesis of I kappa B alpha recapturing nuclear Rel A back into the cytoplasm within 1 h of stimulation. In contrast, NF-kappa B1 subunits redistribute more slowly into the cytoplasm (from 6 to 12 h). Here we examine the role of inducible cytoplasmic BCL-3 expression in terminating nuclear NF-kappa B1. Although BCL-3 is a nuclear protein in B lymphocytes, surprisingly, BCL-3 is primarily a cytoplasmic protein in HepG2 cells. Cytoplasmic BCL-3 abundance is induced 6-12 h after tumor necrosis factor-alpha stimulation where it complexes with NF-kappa B1 homodimers. Moreover, BCL-3 mRNA and protein expression are induced by NF-kappa B-activating agents. Two observations are interpreted to indicate that bcl-3 is transactivated by NF-kappa B/Rel A: 1) expression of a dominant negative NF-kappa B inhibitor blocks tumor necrosis factor-alpha-induced BCL-3 expression and 2) expression of constitutively active Rel A is sufficient to induce BCL-3 expression. In gene transfer studies, we identify two high affinity NF-kappa B-binding sites, kappa B1 (located at -872 to -861 nucleotides) and kappa B2 (-106 to -96 nucleotides), and although both bind with high affinity to Rel A, only kappa B2 is required for NF-kappa B-dependent induction of the native BCL-3 promoter. Down-regulation of BCL-3 induction results in prolonged, enhanced NF-kappa B1 binding and increased NF-kappa B-dependent transcription. Together, these data suggest the presence of an NF-kappa B-BCL-3 autoregulatory loop important in terminating NF-kappa B1 action and that individual NF-kappa B isoforms are actively terminated through coordinate induction of inhibitory I kappa B molecules to restore cellular homeostasis.

Oxidant tone regulates RANTES gene expression in airway epithelial cells infected with respiratory syncytial virus. Role in viral-induced interferon regulatory factor activation.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part, through its ability to induce chemokine synthesis in infected airway epithelial cells. RANTES (regulated upon activation, normal T-cells expressed and secreted) is a CC chemokine which recruits and activates monocytes, lymphocytes, and eosinophils, all cell types present in the lung inflammatory infiltrate induced by RSV infection. In this study we investigated the role of reactive oxygen species in the induction of RANTES gene expression in human type II alveolar epithelial cells (A549), following RSV infection. Our results indicate that RSV infection of airway epithelial cells rapidly induces reactive oxygen species production, prior to RANTES expression, as measured by oxidation of 2',7'-dichlorofluorescein. Pretreatment of airway epithelial cells with the antioxidant butylated hydroxyanisol (BHA), as well a panel of chemically unrelated antioxidants, blocks RSV-induced RANTES gene expression and protein secretion. This effect is mediated through the ability of BHA to inhibit RSV-induced interferon regulatory factor binding to the RANTES promoter interferon-stimulated responsive element, that is absolutely required for inducible RANTES promoter activation. BHA inhibits de novo interferon regulator factor (IRF)-1 and -7 gene expression and protein synthesis, and IRF-3 nuclear translocation. Together, these data indicates that a redox-sensitive pathway is involved in RSV-induced IRF activation, an event necessary for RANTES gene expression.

Role of signal transducers and activators of transcription 1 and -3 in inducible regulation of the human angiotensinogen gene by interleukin-6.

The circulating level of angiotensinogen (AGT) is dynamically regulated as an important determinant of blood pressure and electrolyte homeostasis. Because the mechanisms controlling the regulated expression of human angiotensinogen (hAGT) are unknown, we investigated the inducible regulation of the hAGT gene in well differentiated HepG2 cells. Interleukin-6 (IL-6) stimulation produced a 3.2-fold increase in hAGT mRNA peaking at 96 h after stimulation. Deletional mutagenesis of the hAGT promoter in transient transfection assays identified an IL-6 response domain between nucleotides -350 and -122 containing three reiterated motifs, termed human acute phase response elements (hAPREs). Although mutation of each site individually caused a fall in IL-6-inducible luciferase activity, mutation of all three sites was required to block the IL-6 effect. Electrophoretic mobility shift assay (EMSA), supershift, and microaffinity DNA binding assays indicate IL-6-inducible high-affinity binding of signal transducers and activators of transcription 1 and -3 (STAT1 and -3) to hAPRE1 and -3 but only low-affinity binding to hAPRE2. Expression of a dominant-negative form of STAT3, but not STAT1, produced a concentration-dependent reduction in IL-6-induced hAGT transcription and endogenous mRNA expression. These data indicate that STAT3 plays a major role in hAGT gene induction through three functionally distinct hAPREs in its promoter and suggest a mechanism for its up-regulation during the acute-phase response.

IFN-beta mediates coordinate expression of antigen-processing genes in RSV-infected pulmonary epithelial cells.

Major histocompatibility complex (MHC) class I-restricted cytotoxic T lymphocytes (CTLs) clear respiratory tract infections caused by the pneumovirus respiratory syncytial virus (RSV) and also mediate vaccine-induced pulmonary injury. Herein we examined the mechanism for RSV-induced MHC class I presentation. Like infectious viruses, conditioned medium from RSV-infected cells (RSV-CM) induces naive cells to coordinately express a gene cluster encoding the transporter associated with antigen presentation 1 (TAP1) and low molecular mass protein (LMP) 2 and LMP7. Neutralization of RSV-CM with antibodies to interferon (IFN)-beta largely blocked TAP1/LMP2/LMP7 expression, whereas anti-interleukin-1 antibodies were without effect, and recombinant IFN-beta increased TAP1/LMP2/LMP7 expression to levels produced by RSV-CM. LMP2, LMP7, and TAP1 expression were required for MHC class I upregulation because the irreversible proteasome inhibitor lactacystin or transfection with a competitive TAP1 inhibitor blocked inducible class I expression. We conclude that RSV infection coordinately increases MHC class I expression and proteasome activity through the paracrine action of IFN-beta to induce expression of the TAP1/LMP2/LMP7 locus, an event that may be important in the initiation of CTL-mediated lung injury.

Nonisotopic assays for reporter gene activity.

This unit describes two nonisotopic systems for reporter gene activity in cells transfected with the firefly luciferase expression plasmid or the beta-galactosidase expression plasmid. Both of these chemiluminescent assays have the advantages of high sensitivity and broad linear range. In the chemiluminescent detection procedures given in this unit, both luciferase activity and beta-galactosidase activity can be measured with either a luminometer or a scintillation counter.

A nalysis of Transcriptional Control Mechanisms I : Techniques for Characterization ofcis-Regulatory Elements.

Transcriptional control, the process controlling when and how much RNA is produced from a DNA template, is a major determinant of gene expression in eukaryotic cells. This process, intensely studied over the last few decades, is under control of specific DNA sequences (cis elements) that function by virtue of their ability to be recognized by sequence-specific DNA-binding proteins (trans-acting elements). Both of these elements function in concert to control the rate and location of RNA transcript formation. Therefore, identification of these cis- and trans- acting elements provides important mechanistic insight into gene expression control. These studies are relevant to understanding aspects of the renin-angiotensin system. For example, a large body of evidence has shown that angiotensinogen (AGT) is a highly inducible gene, regulated by a variety of physiological hormone systems. Because AGT circulates close to its Michaelis-Menten constant (Km) for renin, changes in AGT concentration influence the long-term activity of the RAS [Reviewed in (1)].

Analysis of Transcriptional Control Mechanisms II Techniques for Characterization of trans-Acting Factors.

cis-Acting DNA control elements, enhancers and promoters, function to control gene expression by acting as targets for specific DNA-binding proteins (trans-acting factors). trans-acting factors are sequence-specific DNA-binding proteins that recognize specific signatures in base composition of the DNA, and upon binding, are able to influence transcriptional activity of the core promoter by multiple diverse mechanisms. These mechanisms include direct interaction with the preinitiation complex, recruitment of additional bridging proteins (coactivators), or induction of chromatin remodeling (such as altering nucleosomal phasing). These mechanisms are coordinated to result in changes in gene expression that control critical events in cellular differentiation and responses to extracellular signals or stressors.

Nonisotopic assays for reporter gene activity.

This unit describes two nonisotopic systems for reporter gene activity in cells transfected with the firefly luciferase.

Angiotensin II induces gene transcription through cell-type-dependent effects on the nuclear factor-kappaB (NF-kappaB) transcription factor.

The vasopressor octapeptide, angiotensin II (Ang II), exerts homeostatic responses in cardiovascular tissues, including the heart, blood vessel wall, adrenal cortex and liver (a major source of circulating plasma proteins). One of the effects of Ang II is to induce expression of regulatory, structural and cytokine genes that play important roles in long-term control of blood pressure, vascular remodeling, cardiac hypertrophy and inflammation. The identification of nuclear signaling pathways and target transcription factors has provide important insight into cellular responses and the spectrum of genes controlled by Ang II. Here we will review how Ang II activates the transcription factors, Activator Protein 1 (AP-1), Signal Transducer and Activator of Transcription (STATs), and Nuclear Factor-kappaB (NF-kappaB). NF-kappaB is of particular interest because it is an important mediator of resynthesis of the Ang II precursor, angiotensinogen AGT. Through this positive feedback loop, long-term changes in the activity of the renin angiotensin system occur. Although NF-kappaB is ubiquitously expressed, surprisingly the mechanism for Ang II-inducible NF-kappaB regulation differs between aortic smooth muscle cells (VSMCs) and hepatocytes. In VSMC, Ang II induces nuclear translocation of cytoplasmic transactivatory NF-kappaB proteins through proteolysis of its inhibitor, IkappaB. By contrast, in hepatocytes, Ang II induces large nuclear isoforms of NF-kappaB1 to bind DNA through a mechanism independent of changes in IkappaB turnover. NF-kappaB activation depends upon the activity of DAG-sensitive PKC isoforms and ROS signaling pathway. These observations indicate that significant differences exist in Ang II signaling depending upon cell-type involved and suggest the possibility that tissue-selective modulation of Ang II effects is possible in the cardiovascular system.

A novel glucocorticoid receptor binding element within the murine c-myc promoter.

In the course of analyzing the murine c-myc promoter response to glucocorticoid, we have identified a novel glucocorticoid response element that does not conform to the consensus glucocorticoid receptor-binding sequence. This c-myc promoter element has the sequence CAGGGTACATGGCGTATGTGTG, which has very little sequence similarity to any known response element. Glucocorticoids activate c-myc/reporter constructs that contain this element. Deletion of these sequences from the c-myc promoter increases basal activity of the promoter and blocks glucocorticoid induction. Insertion of this element into SV40/reporters inhibits basal reporter gene activity in the absence of glucocorticoids. Glucocorticoids stimulate activity of reporters that contain this element. Recombinant glucocorticoid receptor binds to this element in vitro. An unidentified cellular repressor also binds to this element. The activated glucocorticoid receptor displaces this protein(s). We conclude that the glucocorticoid receptor binds to the c-myc promoter in competition with this protein, which is a repressor of transcription. To our knowledge, no glucocorticoid response element with such properties has ever been reported.

Requirement of a novel upstream response element in respiratory syncytial virus-induced IL-8 gene expression.

Respiratory syncytial virus (RSV) produces intense pulmonary inflammation, in part, through its ability to induce chemokine synthesis in infected airway epithelial cells. In this study, we compare mechanisms for induction of the CXC chemokine IL-8, in human type II alveolar (A549) cells by RSV infection and by stimulation with the cytokine TNF. Promoter deletion and mutagenesis experiments indicate that although the region from -99 to -54 nt is sufficient for TNF-induced IL-8 transcription, this region alone is not sufficient for RSV-induced IL-8 transcription. Instead, RSV requires participation of a previously unrecognized element, spanning from -162 to -132 nt, that we term the RSV response element (RSVRE), and a previously characterized element at -132 to -99 nt, containing an AP-1 binding site. RSV infection of A549 cells induces increased RSVRE- and AP-1-binding activities and increased synthesis of IFN regulatory factor-1 protein, which is present in the RSVRE-binding complex. These data confirm that the IL-8 gene enhancers are controlled in a stimulus-specific fashion and participation of distinct promoter elements is required to activate gene transcription. These observations are important for rational design of inhibitors of RSV-induced lung inflammation.

Angiotensin II induces nuclear factor (NF)-kappaB1 isoforms to bind the angiotensinogen gene acute-phase response element: a stimulus-specific pathway for NF-kappaB activation.

The vasopressor angiotensin II (AII) activates transcriptional expression of its precursor, angiotensinogen. This biological "positive feedback loop" occurs through an angiotensin receptor-coupled pathway that activates a multihormone-responsive enhancer of the angiotensinogen promoter, termed the acute-phase response element (APRE). Previously, we showed that the APRE is a cytokine [tumor necrosis factor-alpha (TNFalpha)]- inducible enhancer by binding the heterodimeric nuclear factor-kappaB (NF-kappaB) complex Rel A x NF-kappaB1. Here, we compare the mechanism for NF-kappaB activation by the AII agonist, Sar1 AII, with TNFalpha in HepG2 hepatocytes. Although Sar1 AII and TNFalpha both rapidly activate APRE-driven transcription within 3 h of treatment, the pattern of inducible NF-kappaB binding activity in electrophoretic mobility shift assay is distinct. In contrast to the TNFalpha mechanism, which strongly induces Rel A x NF-kappaB1 binding, Sar1 AII selectively activates a heterogenous pattern of NF-kappaB1 binding. Using a two-step microaffinity DNA binding assay, we observe that Sar1 AII recruits 50-, 56-, and 96-kDa NF-kappaB1 isoforms to bind the APRE. Binding of all three NF-kappaB1 isoforms occurs independently of changes in their nuclear abundance or proteolysis of cytoplasmic IkappaB inhibitors. Phorbol ester-sensitive protein kinase C (PKC) isoforms are required because PKC down-regulation completely blocks AII-inducible transcription and inducible NF-kappaB1 binding. We conclude that AII stimulates the NF-kappaB transcription factor pathway by activating latent DNA-binding activity of NF-kappaB subunits through a phorbol ester-sensitive (PKC-dependent) mechanism.

Nuclear factor-kappaB-dependent induction of interleukin-8 gene expression by tumor necrosis factor alpha: evidence for an antioxidant sensitive activating pathway distinct from nuclear translocation.

Tumor necrosis factor alpha (TNFalpha) is a pluripotent activator of inflammation by inducing a proinflammatory cytokine cascade. This phenomenon is mediated, in part, through inducible expression of the CXC chemokine, interleukin-8 (IL-8). In this study, we investigate the role of TNFalpha-inducible reactive oxygen species (ROS) in IL-8 expression by "monocyte-like" U937 histiocytic lymphoma cells. TNFalpha is a rapid activator of IL-8 gene expression by U937, producing a 50-fold induction of mRNA within 1 hour of treatment. In gene transfection assays, the effect of TNFalpha requires the presence of an inducible nuclear factor-kappaB (NF-kappaB) (Rel A) binding site in the IL-8 promoter. TNFalpha treatment induces a rapid translocation of the 65 kD transcriptional activator NF-kappaB subunit, Rel A, whose binding in the nucleus occurs before changes in intracellular ROS. Pretreatment (or up to 15 minutes posttreatment) relative to TNFalpha with the antioxidant dimethyl sulfoxide (DMSO) (2% [vol/vol]) blocks 80% of NF-kappaB-dependent transcription. Surprisingly, however, DMSO has no effect on inducible Rel A binding. Similar selective effects on NF-kappaB transcription are seen with the unrelated antioxidants, N-acetylcysteine (NAC) and vitamin C. These data indicate that TNFalpha induces a delayed ROS-dependent signalling pathway that is required for NF-kappaB transcriptional activation and is separable from that required for its nuclear translocation. Further definition of this pathway will yield new insights into inflammation initiated by TNFalpha signalling.