Three distinct isoforms of ATP synthase subunit c are expressed in T. brucei and assembled into the mitochondrial ATP synthase complex.

One striking feature of the biology of trypanosomes is the changes in mitochondrial structure and function that occur as these parasites transition from one life cycle stage to another. Our laboratory has been interested in the role the mitochondrial ATP synthase plays in mitochondrial changes through the life cycle. Analysis of the recently completed T. brucei genome suggested that there may be multiple putative genes encoding ATP synthase subunit c. While homologous in their 3' ends, these genes differ in their 5' ends and, if expressed, would result in three distinct proteins. Our analysis showed that all three of the possible transcripts were detected in both procyclic and bloodstream stages, although the c-3 transcript was less abundant than that for c-1 or c-2. The three isoforms of subunit c are produced in both the bloodstream and procyclic stages and their mature protein products possess distinct N-terminal regions of the protein as found within mitochondria. All three isoforms are also incorporated into the assembled ATP synthase complex from procyclic cells. Although multiple subunit c genes have been found in other organisms, they produce identical polypeptides and the finding of significant differences in the mature proteins is unique to T. brucei.

Relevance of pharmacokinetic and pharmacodynamic modeling to clinical care of critically ill patients.

Efficacious therapy is of utmost importance to save lives and prevent bacterial resistance in critically ill patients. This review summarizes pharmacokinetic (PK) and pharmacodynamic (PD) modeling methods to optimize clinical care of critically ill patients in empiric and individualized therapy. While these methods apply to all therapeutic areas, we focus on antibiotics to highlight important applications, as emergence of resistance is a significant problem. Nonparametric and parametric population PK modeling, multiple-model dosage design, Monte Carlo simulations, and Bayesian adaptive feedback control are the methods of choice to optimize therapy. Population PK can estimate between patient variability and account for potentially increased clearances and large volumes of distribution in critically ill patients. Once patient- specific PK data become available, target concentration intervention and adaptive feedback control algorithms can most precisely achieve target goals such as clinical cure of an infection or resistance prevention in stable and unstable patients with rapidly changing PK parameters. Many bacterial resistance mechanisms cause PK/PD targets for resistance prevention to be usually several-fold higher than targets for near-maximal killing. In vitro infection models such as the hollow fiber and one-compartment infection models allow one to study antibiotic-induced bacterial killing and emergence of resistance of mono- and combination therapies over clinically relevant treatment durations. Mechanism-based (and empirical) PK/PD modeling can incorporate effects of the immune system and allow one to design innovative dosage regimens and prospective validation studies. Mechanism-based modeling holds great promise to optimize mono- and combination therapy of anti-infectives and drugs from other therapeutic areas for critically ill patients.

Attenuation of colistin bactericidal activity by high inoculum of Pseudomonas aeruginosa characterized by a new mechanism-based population pharmacodynamic model.

Colistin is increasingly being utilized against Gram-negative pathogens, including Pseudomonas aeruginosa, resistant to all other antibiotics. Since limited data exist regarding killing by colistin at different initial inocula (CFUo), we evaluated killing of Pseudomonas aeruginosa by colistin at several CFUo and developed a mechanism-based mathematical model accommodating a range of CFUo. In vitro time-kill experiments were performed using >or=8 concentrations up to 64 x the MIC of colistin against P. aeruginosa PAO1 and two clinical P. aeruginosa isolates at CFUo of 10(6), 10(8), and 10(9) CFU/ml. Serial samples up to 24 h were simultaneously modeled in the NONMEM VI (results shown) and S-ADAPT software programs. The mathematical model was prospectively "validated" by additional time-kill studies assessing the effect of Ca(2+) and Mg(2+) on killing of PAO1 by colistin. Against PAO1, killing of the susceptible population was 23-fold slower at the 10(9) CFUo and 6-fold slower at the 10(8) CFUo than at the 10(6) CFUo. The model comprised three populations with different second-order killing rate constants (5.72, 0.369, and 0.00210 liters/h/mg). Bacteria were assumed to release signal molecules stimulating a phenotypic change that inhibits killing. The proposed mechanism-based model had a good predictive performance, could describe killing by colistin for all three studied strains and for two literature studies, and performed well in a prospective validation with various concentrations of Ca(2+) and Mg(2+). The extent and rate of killing of P. aeruginosa by colistin were markedly decreased at high CFUo compared to those at low CFUo. This was well described by a mechanism-based mathematical model, which should be further validated using dynamic in vitro models.

Two trypanosome-specific proteins are essential factors for 5S rRNA abundance and ribosomal assembly in Trypanosoma brucei.

We have previously identified and characterized two novel nuclear RNA binding proteins, p34 and p37, which have been shown to bind 5S rRNA in Trypanosoma brucei. These two proteins are nearly identical, with one major difference, an 18-amino-acid insert in the N-terminal region of p37, as well as three minor single-amino-acid differences. Homologues to p34 and p37 have been found only in other trypanosomatids, suggesting that these proteins are unique to this ancient family. We have employed RNA interference (RNAi) studies in order to gain further insight into the interaction between p34 and p37 with 5S rRNA in T. brucei. In our p34/p37 RNAi cells, decreased expression of the p34 and p37 proteins led to morphological alterations, including loss of cell shape and vacuolation, as well as to growth arrest and ultimately to cell death. Disruption of a higher-molecular-weight complex containing 5S rRNA occurs as well as a dramatic decrease in 5S rRNA levels, suggesting that p34 and p37 serve to stabilize 5S rRNA. In addition, an accumulation of 60S ribosomal subunits was observed, accompanied by a significant decrease in overall protein synthesis within p34/p37 RNAi cells. Thus, the loss of the trypanosomatid-specific proteins p34 and p37 correlates with a diminution in 5S rRNA levels as well as a decrease in ribosome activity and an alteration in ribosome biogenesis.

ATP synthase is responsible for maintaining mitochondrial membrane potential in bloodstream form Trypanosoma brucei.

The mitochondrion of Trypanosoma brucei bloodstream form maintains a membrane potential, although it lacks cytochromes and several Krebs cycle enzymes. At this stage, the ATP synthase is present at reduced, although significant, levels. To test whether the ATP synthase at this stage is important for maintaining the mitochondrial membrane potential, we used RNA interference (RNAi) to knock down the levels of the ATP synthase by targeting the F1-ATPase alpha and beta subunits. RNAi-induced cells grew significantly slower than uninduced cells but were not morphologically altered. RNAi of the beta subunit decreased the mRNA and protein levels for the beta subunit, as well as the mRNA and protein levels of the alpha subunit. Similarly, RNAi of alpha subunit decreased the alpha subunit transcript and protein levels, as well as the beta-subunit transcript and protein levels. In contrast, alpha and beta RNAi knockdown resulted in a 60% increase in the F0 complex subunit 9 protein levels without a significant change in the steady-state transcript levels of this subunit. The F0-32-kDa subunit protein expression, however, remained stable throughout induction of RNAi for alpha or beta subunits. Oligomycin-sensitive ATP hydrolytic and synthetic activities were decreased by 43 and 44%, respectively. Significantly, the mitochondrial membrane potential of alpha and beta RNAi cells was decreased compared to wild-type cells, as detected by MitoTracker Red CMXRos fluorescence microscopy and flow cytometry. These results support the role of the ATP synthase in the maintenance of the mitochondrial membrane potential in bloodstream form T. brucei.

3' UTR signals necessary for expression of the Plasmodium gallinaceum ookinete protein, Pgs28, share similarities with those of yeast and plants.

During metazoan development, 3' UTR signals mediate the time and place of gene expression. For protozoan Plasmodium parasites, the formation of ookinetes from gametes in the mosquito midgut is an analogous developmental process. Previous studies of the 3' UTR signals necessary for expression of Pgs28, the major surface protein of Plasmodium gallinaceum ookinetes, suggested that a 3' UTR T-rich region and DNA sequences containing an ATTAAA eukaryotic polyadenylation consensus motif were necessary for its expression. During metazoan development, U-rich elements may function in conjunction with eukaryotic polyadenylation consensus signals to mediate developmental protein expression. To define whether the putative Plasmodium elements were mediators of Pgs28 expression mutations of these nucleotide sequences were made in plasmid constructs. The effect of the mutations on Pgs28 expression was tested by the transient gene transfection of sexual stage P. gallinaceum parasites. These studies reveal that two different mutations of the ATTAAA motif, which alter gene expression in higher eukaryotes and yeast, do not alter the expression of Pgs28. However, the U-rich element, adjacent nucleotides UUUACAAAAUUGUUUUAACU and downstream nucleotides UAUAUAAAA are able to mediate expression to varying degrees. The organization and overlapping function of these elements appears to more closely resemble that of yeasts or plants than those of metazoans.