Ovule-specific MADS-box proteins have conserved protein-protein interactions in monocot and dicot plants.

OsMADS13 is a rice MADS-box gene that is specifically expressed in developing ovules. The amino acid sequence of OsMADS13 shows 74% similarity to those of FLORAL BINDING PROTEIN 7 (FBP7) and FBP11, the products of two MADS-box genes that are necessary and sufficient to determine ovule identity in Petunia. To assess whether OsMADS13, the putative rice ortholog of FBP7 and FBP11, has an equivalent function, several analyses were performed. Ectopic expression of FBP7 and FBP11 in Petunia results in ectopic ovule formation on sepals and petals. Here we show that ectopic expression of OsMADS13 in rice and Arabidopsis does not result in the formation of such structures. Furthermore, ectopic expression of FBP7 and FBP11 in Arabidopsis also fails to induce ectopic ovule formation. To determine whether protein-protein interactions involving putative class D MADS-box proteins have been conserved, yeast two-hybrid assays were performed. These experiments resulted in the identification of three putative partners of OsMADS13, all of them encoded by AGL2-like genes. Interestingly the Petunia FBP7 protein also interacts with AGL2-like proteins. The evolutionary conservation of the MADS-box protein partners of these ovule-specific factors was confirmed by exchange experiments which showed that the protein partners of OsMADS13 interact with FBP7 and vice versa.

Changes in mRNA abundance within Heterodera schachtii-infected roots of Arabidopsis thaliana.

Gene expression changes in plant roots infected by plant-parasitic cyst nematodes are involved in the formation of nematode feeding sites. We analyzed mRNA abundance changes within roots of Arabidopsis thaliana during the early compatible interaction with Heterodera schachtii, the sugarbeet cyst nematode. Approximately 1,600 root sections, each containing a single parasitic nematode and its feeding site, and 1,600 adjacent, nematode-free root sections were excised from aseptic A. thaliana cultures 3 to 4 days after inoculation with H. schachtii. These tissue samples were termed infected and uninfected, respectively. Preparasitic nematodes were added to the uninfected tissue sample to maintain the nematode to plant tissue proportion. mRNA extracted from these two tissue samples was subjected to differential display analysis. Thirty-six cDNA clones corresponding to mRNA species with different abundance between both tissue samples were isolated. Of these clones, 24 were of A. thaliana origin and 12 were from H. schachtii. Differential display data predicted that the A. thaliana cDNA clones corresponded to 13 transcripts that were more abundant in the infected root sections and 11 transcripts that were more abundant in the uninfected root sections. H. schachtii cDNA clones were predicted to correspond to four transcripts that were more abundant in parasitic nematodes and to eight transcripts that were more abundant in preparasitic nematodes. In situ hybridization experiments confirmed the mRNA abundance changes in A. thaliana roots predicted by the differential display analyses for two A. thaliana clones.

Arabidopsis STERILE APETALA, a multifunctional gene regulating inflorescence, flower, and ovule development.

A recessive mutation in the Arabidopsis STERILE APETALA (SAP) causes severe aberrations in inflorescence and flower and ovule development. In sap flowers, sepals are carpelloid, petals are short and narrow or absent, and anthers are degenerated. Megasporogenesis, the process of meiotic divisions preceding the female gametophyte formation, is arrested in sap ovules during or just after the first meiotic division. More severe aberrations were observed in double mutants between sap and mutant alleles of the floral homeotic gene APETALA2 (AP2) suggesting that both genes are involved in the initiation of female gametophyte development. Together with the organ identity gene AGAMOUS (AG) SAP is required for the maintenance of floral identity acting in a manner similar to APETALA1. In contrast to the outer two floral organs in sap mutant flowers, normal sepals and petals develop in ag/sap double mutants, indicating that SAP negatively regulates AG expression in the perianth whorls. This supposed cadastral function of SAP is supported by in situ hybridization experiments showing ectopic expression of AG in the sap mutant. We have cloned the SAP gene by transposon tagging and revealed that it encodes a novel protein with sequence motifs, that are also present in plant and animal transcription regulators. Consistent with the mutant phenotype, SAP is expressed in inflorescence and floral meristems, floral organ primordia, and ovules. Taken together, we propose that SAP belongs to a new class of transcription regulators essential for a number of processes in Arabidopsis flower development.

[Molecular characteristics of chalcone synthase gene families from two cotton species using the polymerase chain reaction]. / Molekuliarnaia kharakteristika semeistva genov khalkonsintazy dvukh vidov khlopchatnika s pomoshch'iu metoda polimeraznoi tsepnoi reaktsii.

Using partial sequence data from a genomic clone and the fact of evolutionary conservation of chalcone synthase genes, two primers, corresponding to C-terminal peptides GGAACTCCCTTTTCTGGATAGCTCACC and CCTGGTCCGAACCCAAACAGGACGCCCC, were used to amplify, via polymerase chain reaction, genomic sequences from two Gossypium species, a diploid Gossypium herbaceum, and a tetraploid Gossypium hirsutum cv. 108F. Amplified DNA was separated into individual sequences by cloning into an M13 vector. Six different sequences were identified in each species. From each set of six, one sequence was found to be identical to the genomic sequence, which we have isolated from a subgenomic library of 108F DNA in lambda NM1149. Comparison of other sequences has allowed to find another pair of identical sequences, as well as to get an evidence, that the set isolated from the tetraploid cotton contained preferentially members of only one of the two subfamilies, probably due to primer specificity in amplification reaction. Comparison of specific amino acid substitutions in homologous sequences of cotton, peanut and soybean also suggested that all of the sequences isolated from cotton are more likely to code for chalcone synthase, that for a similar enzyme resveratrol synthetase.