RESUMO
The first neutron fibre diffraction studies of an amyloid system are presented. The techniques used to prepare the large samples needed are described, as well as the procedures used to isotopically replace H2O in the sample by D2O. The results demonstrate the feasibility of this type of approach for the pursuit of novel structural analyses that will strongly complement X-ray fibre diffraction studies and probe aspects of amyloid structure that to date have remained obscure. The approach is demonstrated using an amyloid form of the peptide NSGAITIG, but is equally applicable for the study of other systems such as Alzheimer's Aß peptide.
Assuntos
Amiloide/química , Deutério/química , Isótopos/química , Difração de Nêutrons/métodos , Água/química , Modelos Moleculares , Estrutura Secundária de Proteína , Difração de Raios X/métodosRESUMO
Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)(2), showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.
Assuntos
DNA Forma A/química , Difração de Nêutrons , Nêutrons , Telômero/química , Difração de Raios X , Acridinas/química , Acridinas/metabolismo , Cristalização , DNA Forma A/metabolismo , Humanos , Modelos Moleculares , Cloreto de Potássio/farmacologia , Espalhamento a Baixo Ângulo , Cloreto de Sódio/farmacologia , Soluções , Telômero/genética , Telômero/metabolismoRESUMO
The influence of ionic strength and of the chemical nature of cations on the protein-protein interactions in ovalbumin solution was studied using small-angle X-ray and neutron scattering (SAXS/SANS). The globular protein ovalbumin is found in dimeric form in solutions as suggested by SANS/SAXS experiments. Due to the negative charge of the proteins at neutral pH, the protein-protein interactions without any salt addition are dominated by electrostatic repulsion. A structure factor related to screened Coulombic interactions together with an ellipsoid form factor was used to fit the scattering intensity. A monovalent salt (NaCl) and a trivalent salt (YCl(3)) were used to study the effect of the chemical nature of cations on the interaction in protein solutions. Upon addition of NaCl, with ionic strength below that of physiological conditions (150 mM), the effective interactions are still dominated by the surface charge of the proteins and the scattering data can be understood using the same model. When yttrium chloride was used, a reentrant condensation behavior, i.e., aggregation and subsequent redissolution of proteins with increasing salt concentration, was observed. SAXS measurements reveal a transition from effective repulsion to attraction with increasing salt concentration. The solutions in the reentrant regime become unstable after long times (several days). The results are discussed and compared with those from bovine serum albumin (BSA) in solutions.
