17beta-Estradiol transcriptionally represses human insulin receptor gene expression causing cellular insulin resistance.

In this study, we demonstrate that 17beta-estradiol (E(2)) inhibits human insulin receptor (IR) gene expression in a dose- and time-dependent manner in U-937 human promonocytic cells. Using cells transfected with the -1819 to -271 bp fragment of the human IR promoter (wild type promoter) and treated with E(2), we show that this repression is regulated at the transcriptional level. The steroid was also found to diminish the insulin responsiveness of the cells in terms of cell survival, DNA synthesis, glucose transport, and glucose oxidation, this last effect possibly involving reduced phosphatidylinositol 3-kinase (PI3-kinase) activity. These data provide new information on the molecular mechanisms of estrogen-inducing insulin resistance in human cells.

Identification of a Vitamin D response element in the human insulin receptor gene promoter.

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.