RESUMO
In an investigation of diseases from plant-parasitizing nematodes in Henan Province, a cyst nematode was found on tobacco roots and in rhizosphere soil. We identified this strain as a new cyst nematode subspecies, Heterodera glycines sbsp.n. tabacum. The cysts and second-stage juveniles (J2s) parasitizing Henan tobacco were larger than those of H. glycines. A single 345-bp fragment was amplified from H. glycines sbsp.n. tabacum, whereas the 345- and 181-bp fragments were amplified from the soybean cyst nematode. Thus, H. glycines sbsp.n. tabacum was distinct from H. glycines. There were base transversions at 504 sites and base transitions at 560, 858, 920, and 921 sites in the rDNA-ITS sequences of H. glycines sbsp.n. tabacum compared with H. glycines, and there were base transitions at 41, 275, 278, and 380 sites in the mtDNA-COI sequences. In the phylogenetic tree based on the rDNA-ITS and mtDNA-COI regions, H. glycines sbsp.n. tabacum was clustered on a single branch. Based on the randomly amplified polymorphic DNA (RAPD) technique, sequence characterized amplified region (SCAR)-PCR primers were designed. A single 1,113-bp fragment was amplified by specific primers (HtF1/HtR1) from H. glycines sbsp.n. tabacum, while no fragments were obtained from H. glycines. The H. glycines sbsp.n. tabacum can infect soybean plants but cannot complete its life cycle on soybean. Eleven tested tobacco cultivars were infected, with an average reproduction factor (Rf) of 9.74 and a maximum of 64.2 in 'K326'. The cumulative egg hatching rate of H. glycines sbsp.n. tabacum in the presence of tobacco root exudates was 42.6% at 32 days posthatching, which was significantly greater than that in the presence of soybean root exudates (30.3%) or sterile water (33.1%). In summary, the cyst nematode population parasitizing Henan tobacco was identified as a new subspecies, H. glycines sbsp.n. tabacum.
RESUMO
Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L) â¯= 609.0⯠±â¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0 ⯱⯠28.6 µm (329.7 to 436.1 µm); stylet length â¯=⯠17.0 ⯱⯠1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =⯠3.3 ⯱⯠0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n⯠=⯠20) were measured (mean ± SD; range) as follows: L â¯=⯠401.2⯠±â¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W â¯= 28.6⯠±â¯ 1.0 (26.7 to 30.4); stylet length =⯠10.3 ⯱⯠0.6 µm (9.1 to 11.2 µm); DGO⯠=⯠2.4 ⯱⯠0.1 µm (2.1 to 2.6 µm); and tail length â¯= â¯49.3⯠± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.
RESUMO
FeS nanoparticles loaded on nitrogen-doped biochar (FeS/BNC) were fabricated by pyrolyzing coffee husks pretreated with Mohr's salt. The nitrogen doping and FeS loading of biochar are simultaneously achieved in one-pot pyrolysis. The elemental analysis, SEM, TEM, XRD, XPS, Raman, FTIR and N2 adsorption-desorption technologies were used to characterize the composition and structure of FeS/NBC. The appraisement for removing aqueous Cr(VI) testified that FeS/NBC offered a synergistic scavenging effect of Cr(VI) by FeS and NBC. The effect of crucial experimental conditions (FeS/NBC dosage, foreign ions, initial pH and concentration of Cr(VI) solution) were investigated. The Cr(VI) removal capacity was as high as 211.3 ± 26 mg g-1 under the optimized condition. The practicability of FeS/NBC was examined by using simulated actual samples from tap water and lake water. The mechanism examination showed that surface adsorption/reduction and solution reduction were implicated in the removal of Cr(VI). The current work introduces a novel FeS/NBC composite prepared by an in situ pyrolysis method with excellent potential for chromium pollution remediation.
Assuntos
Poluentes Químicos da Água , Adsorção , Carvão Vegetal/química , Cromo/análise , Compostos Ferrosos , Nitrogênio/análise , Água , Poluentes Químicos da Água/análiseRESUMO
Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027â³ and E113° 39' 059â³) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.
RESUMO
Three of the cereal cyst nematodes, Heterodera avenae, H. filipjevi and H. latipons are considered to be the most economically important cyst nematodes that affect cultivated cereals around the world. H. filipjevi was first detected in China from Xuchang, Henan Province in 2010 (Peng et al. 2010) and now has been recorded in the Central China of Henan, Shandong and Anhui provinces and the Northwest China of Xinjiang Uygur Autonomous Region (Cui et al. 2020). In June 2019, 42 samples consisting of roots and soil were collected from winter wheat fields in Hebei Province of North China. Cysts were detected in 37 soil samples with a mean of 6.4 ± 1.67 cysts per 100 ml of soil. Cysts and second-stage juveniles (J2s) were extracted from root and soil following Cobb's sieving gravity method. Morphological and molecular studies of J2s and cysts confirmed its identity with H. filipjevi in 5 samples from Handan (N36°10'052" and E114°35'056"; N36°37'054" and E114°22'052"), Xingtai (N36°53'060" and E114°30'011") and Shijiazhuang (N 37°26'048" and E 116°05'039") in Hebei Province, China. Morphologically, the cysts are lemon-shaped, light or dark brown in color. The vulval cone is bifenestrate with horseshoe-shaped semifenestrae, strongly globular bullae, and well-developed underbridge. Measurements (mean +_ sd (range)) of cysts (n=10), body length not including neck is 743.0 ± 36.1 µm (665 - 780 µm), body width is 559.0 ± 50.0 µm (455 - 639 µm), length / width ratio is 1.33 ± 0.07 (1.20 - 1.46); neck length is 99.3 ± 8.8 µm (85 - 122 µm); fenestrae length is 56.8 ± 5.0 µm (49 - 65 µm) and width is 25.5 ± 1.8 µm (21.1 - 27.8 µm); underbridge length is 84.0 ± 8.1 µm (62 - 93 µm); and vulval slit length is 8.6 ± 0.5 µm (7.2 - 9.1 µm). Measurements of J2s (n = 12), body length is 541 ± 11.4 µm (490 - 578 µm); stylet length is 22.3 ± 0.5 µm (22.0 - 25.0 µm) with anchor-shaped basal knobs; tail length is 57.7 ± 3.7 µm (52.7 - 65.2 µm), and hyaline tail terminal length is 36.5 ± 2.8 µm (32 - 39.8 µm). The tail had a sharp terminus. Morphology of the cysts and J2s were consistent with the record of H. filipjevi (Peng et al. 2010; Subbotin et al. 2010). The amplifications of rDNA-internal transcribed spacer (ITS) fragments were generated with a PCR fragment of 1054 bp from single cysts of each population, using primers TW81 and AB28 (Joyce et al. 1994). The PCR tests for each sample were repeated five times. The PCR product was purified and sequenced. All nucleotide sequences of ITS-rDNA were submitted to GenBank under accession numbers MW282843-6. Sequences from the ITS region were more than 99.5% identical to those of H. filipjevi from Egypt (KF225725), Turkey (KR704308, KR704293 and MN848333) and China (KT314234, MT254744 and KY448473). These results from ITS supported its identity as H. filipjevi. The results were also confirmed by species specific sequence characterized amplified region primers of H. filipjevi (Peng et al. 2013). Pathogenicity of the H. filipjevi was confirmed by infection of winter wheat (Triticum aestivum L cv. 'Aikang58') and examination of the nematode development and reproduction. Wheat seeds were germinated in petri dishes and then transplanted into five polyvinyl chloride tubs (3 cm in diameter, 25 cm in length) that contained 150 cm3 of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 252.0 eggs/cyst). Plants were grown in an artificial climate box for one week at 14/18°C, two weeks at 16/20°C, five weeks at 18/25°C and two weeks at 22/30°C, under 8 h of darkness/16 h light and normal culturing practices (Cui et al. 2015). The parasitic J2s, third and fourth-stage juveniles, and adult females were observed in roots stained with acid fuchsin at 10, 20, 30, and 50 days after inoculation (DAI), and an average of 32.0 cysts per tubes were extracted 70 DAI. The new cyst' morphological and molecular characteristics were identical to the H. filipjevi cysts from the original soil samples. Three other tubes without cysts were set as control and there were no newly formed cysts. Heterodera avenae and H. filipjevi had been detected in a total of 16 wheat-producing provinces in China, which resulted in losses of 1.9 billion CNY year-1 (Cui et al. 2015). To our knowledge, this is the first report of H. filipjevi in Hebei Province of North China. Cereal cyst nematodes are easily transferred to non-infested areas by many avenues, resulting in increased species and pathotype complexity (Cui et al. 2020). Once H. filipjevi continues to spread in main wheat producing area of China, it could become be a new threat to cereals production. It is time to take effective control methods to prevent H. filipjevi further dispersal, especially through the farming machinery transmission. Hebei Province is one of the most important major grain-producing areas, our findings will be very beneficial for H. filipjevi management and further research on winter wheat in Hebei Province, North China.
RESUMO
From June 2018 to November 2019, a survey for cyst-forming nematodes was conducted in rice fields in Henan Province of central China. Cysts were recovered from two rice fields (N32° 14' 048â³8 and E115° 4' 008â³) at Huangchuan County, leading to more intensive sampling. A further 25 soil samples were then collected with a valve bag from each of these two locations. Cysts and second-stage juveniles (J2) were recovered from roots and soil following Cobb's gravity sieving method. Live cysts were detected in all soil samples with a mean of 6.7±1.5 cysts per 100 ml of soil. Morphologically, the cysts were spherical to lemon-shaped, light to dark brown in color with subcrystalline layer. The vulval cone was well developed, cone terminus with a few large, peripheral, dark brown bullae lacking finger-like projections, and the ambifenestrae were almost rounded with two semifenestrae; width and length of the semifenestrae were similar. The vulval bridge was narrow, with a medium sized underbridge. Cyst measurements (n = 8) determined a mean body length of 431.1 ± 47.23 (351.0 - 516.0) µm, body width 304.3 ± 47.40 (240.0 - 381.0) µm; body length to width ratio 1.42 ± 0.10 (1.2 to 1.6); fenestrae length 39.4 ± 7.06 (26.0 - 47.0) µm; fenestrae width 36.5 ± 5.96 (25.0 - 43.0) µm; vulva slit length 37.1 ± 3.62 (30.0 - 42.0) µm; and the mean underbridge length 75.0 ± 3.39 (70.0 - 81.0) µm. Morphometric J2 measurements (n = 10) included a body length of 432.3 ± 53.26 (379.0 - 512.0) µm; stylet length 20.8 ± 1.87 (18.0 - 24) µm with rounded knobs; tail length 63.1 ± 7.92 (52.0 - 75.0) µm with a hyaline terminal tail length of 35.8 ± 6.14 (28.0 - 45.0) µm. The key morphometrics of this isolate were intermediate to those of the Japanese isolates (Nobbs et al. 1992.) and Chinese isolates (Ding et al. 2012), and other morphological character values were within the range of those reported for Heterodera elachista (Nobbs et al. 1992; Tanha Maafi et al. 2003). Amplification of DNA from single cysts (n = 7) was conducted using the protocol described by Ding et al. (2012). rDNA - ITS sequences were amplified with the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR product was purified and sequenced. The ITS sequences were submitted to GenBank under accession numbers MT579616. Comparisons showed a sequence identity of more than 99.9% for H. elachista sequence MN720080 from Korea and 99.5% for H. elachista sequences JN864884 and JN202916 from China. Species identification was also confirmed using sequence characterized amplified region (SCAR) methods with H. elachista-specific primers He-F/He-R (Qi, 2012). An expected PCR fragment of approximately 434 bp was obtained, which was consistent with those previously reported for H. elachista. Pathogenicity was confirmed by infection and reproduction on rice (Oryza sativa cv. 'Nipponbare'). Seeds were sown into three tubes containing 150 ml of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 185 eggs/cyst) and cultivated in an artificial climate box at 25/30°C, under a 12-h dark/12-h light cycle. Three other tubes without cysts were set as control. Two weeks after sowing, stunting and reduction of leaf length were observed and third- and fourth-stage juveniles were observed in roots stained with acid fuchsin. On average, 142 cysts per 150 ml soil were recovered at 5 weeks after sowing. The newly formed cysts corresponded morphologically and molecularly to the cysts from the original soil samples. The globally recognized and economically important rice-damaging cyst nematodes include H. oryzae, H. oryzicola, H. elachista, H. sacchari and H. graminophila (Zhuo et al. 2014). Ohshima (1974) first reported H. elachista, which was originally recorded as H. oryzae in Japan by Luc and Brizuela (1961). H. elachista was then detected from a rice field at Mazandaran Province in Iran (Tanha Maafi et al., 2003), and in upland rice fields in Hunan (Ding et al., 2012) and Guangxi, China (Zhuo et al. 2014). To the best of our knowledge, this is the first report of H. elachista as a pathogen on rice in Henan Province, in central China. According to our field observations, H. elachista was much more serious in direct-seeded rice field than in the transplanted rice fields. H. elachista was also reported attacking corn (Xiao et al., 2019). Henan is the most important corn-producing province in China, thus H. elachista is a potential threat to corn production in Henan. Our findings will be very beneficial for H. elachista management and further research on direct-seeded rice and corn in Henan Province, central China.
RESUMO
A series of V(III) complexes of varying coordination number (5, 6, and 7) all containing the PS3 ligand (PS3 = trianion of tris(2-thiophenyl)phosphine and its derivatives with other phenyl substituents) has been prepared and structurally characterized. The complexes have general formula [V(PS3)L(n)](0,-), where n = 1 (from L = Cl(-), 1-Me-Im, N(3)(-)), 2 (from L = 2,2'-bpy; counting each N of the bidentate ligand), and 3 (from L = 1-Me-Im, N(2)H(4)). The complexes have also been investigated by direct current (DC) magnetic susceptibility and high-frequency and -field electron paramagnetic resonance (HFEPR). HFEPR, supported by magnetometry, has provided accurate spin Hamiltonian parameters that describe the S = 1 spin ground state of the complexes. Of particular interest are the zero-field splitting (zfs) parameters which, together with structural data, are the empirical starting point for detailed computational studies. The computational methods included density functional theory (DFT), which was only marginally successful, and more advanced ab initio methods (CASSCF and SORCI). The zfs in these complexes is relatively small in magnitude (|D| approximately 1 cm(-1)) and is the result of multiple, often counteracting, spin-orbit coupling (SOC) and spin-spin coupling (SSC) contributions. The specific origin of each of these contributions is described in detail. The results indicate the level of electronic structure calculation possible for transition metal complexes even with multiple unpaired electrons and highly covalent, heavier atom donor ligands.
Assuntos
Simulação por Computador , Modelos Químicos , Nitrogenase/química , Compostos Organometálicos/química , Compostos Organometálicos/síntese química , Teoria Quântica , Cristalografia por Raios X , Espectroscopia de Ressonância de Spin Eletrônica , Elétrons , Modelos Moleculares , Estrutura Molecular , Nitrogenase/metabolismo , Compostos de Sulfidrila/química , Vanádio/químicaRESUMO
Aminocarboxylate complexes of vanadium(III) are of interest as models for biologically and medicinally relevant forms of this interesting and somewhat neglected ion. The V(III) ion is paramagnetic, but not readily suited to conventional EPR, due to its integer-spin ground state (S=1) and associated large zero-field splitting (zfs). High-frequency and -field EPR (HFEPR), however, has the ability to study such systems effectively. Three complexes, all previously structurally characterized: Na[V(trdta)].3H(2)O, Na[V(edta)(H(2)O)].3H(2)O, and [V(nta)(H(2)O)(3)].4H(2)O (where trdta stands for trimethylenediamine-N,N,N',N'-tetraacetate and nta stands for nitrilotriacetate) were studied by HFEPR. All the investigated complexes produced HFEPR responses both in the solid state, and in aqueous solution, but those of [V(nta)(H(2)O)(3)].4H(2)O were poorly interpretable. Analysis of multi-frequency HFEPR spectra yielded a set of spin Hamiltonian parameters (including axial and rhombic zfs parameters: D and E, respectively) for these first two complexes as solids: Na[V(trdta)].3H(2)O: D=5.60 cm(-1), E=0.85 cm(-1), g=1.95; Na[V(edta)(H(2)O)].3H(2)O: D=1.4 cm(-1), E=0.14 cm(-1), g=1.97. Spectra in frozen solution yielded similar parameters and showed multiple species in the case of the trdta complex, which are the consequence of the flexibility of this ligand. The EPR spectra obtained in frozen aqueous solution are the first, to our knowledge, of V(III) in solution in general and show the applicability of HFEPR to these systems. In combination with very insightful previous studies of the electronic absorption of these complexes which provided ligand-field parameters, it has been possible to describe the electronic structure of V(III) in [V(trdta)](-) and [V(edta)(H(2)O)](-); the quality of data for [V(nta)(H(2)O)(3)] does not permit analysis. Qualitatively, six-coordinate V(III) complexes with O,N donor atoms show no electronic absorption band in the NIR region, and exhibit relatively large magnitude zfs (D5 cm(-1)), while analogous seven-coordinate complexes do have a NIR absorption band and show relatively small magnitude zfs (D<2 cm(-1)).