Iodine-doped TiO2 nanotube coatings: a technique for enhancing the antimicrobial properties of titanium surfaces against Staphylococcus aureus.

BACKGROUND: Implant-related infections are a challenging complication of orthopedic surgery, primarily due to the formation of bacterial biofilms on the implant surface. An antibacterial coating for titanium implants was developed to provide novel insights into the prevention and treatment of implant-related infections. METHODS: Titanium plates were coated with TiO2 nanotubes by anodization, and iodine was doped onto the coating via electrophoretic deposition. The obtained plates were characterized using a range of analytical techniques. Subsequently, Staphylococcus aureus was inoculated onto the surfaces of untreated titanium plates (control group), TiO2-nanocoated titanium plates (TiO2 group), and iodine-doped TiO2-nanocoated titanium plates (I-TiO2 group) to compare their antibacterial properties. RESULTS: Twenty-four hour in vitro antimicrobial activity test of the I-TiO2 group against Staphylococcus aureus was superior to those of the other groups, and this difference was statistically significant (P < 0.05). CONCLUSIONS: This coating technology provides a new theoretical basis for the development of anti-infective implants against Staphylococcus aureus in orthopedics.

High serum lactate dehydrogenase and dyspnea: Positive predictors of adverse outcome in critical COVID-19 patients in Yichang.

BACKGROUND: Coronavirus disease 2019 (COVID-19) caused by the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) outbreak in China, constitutes a Public Health Emergency of International Concern. It is well known that COVID-19 patients may have increased serum lactate dehydrogenase (LDH) levels in the early stage. The clinical changes in LDH may have predictive value in disease evolution and prognosis in critically ill COVID-19 patients. AIM: To examine serum LDH and clinical characteristics in patients with COVID-19 and their predictive value for prognosis. METHODS: This retrospective study analyzed the clinical data of forty-seven critical COVID-19 patients in the intensive care unit of the Third People's Hospital of Yichang City from January 27 to March 25, 2020 and divided them into survivors and non-survivors. The patients were diagnosed according to the World Health Organization interim guidance and critical cases met any one of the following criteria: Respiratory failure and required mechanical ventilation, the occurrence of shock, and the combined failure of other organs that required intensive care unit monitoring and treatments, according to the diagnostic criteria of critical COVID-19. Clinical data including symptoms, detection of SARS-CoV-2, chest computed tomography (CT) images, changes in serum LDH in different clinical phases, and prognosis were collected. Statistical analysis of the data was performed. Continuous variables were expressed as median (interquartile range) and compared with the Mann-Whitney U test. Categorical variables were compared with the Chi-square test. Survival data were analyzed using Kaplan-Meier survival curves and log-rank tests. RESULTS: According to chest CT images, we observed the alveolitis and fibrosis stages in all critical patients in this study. Most non-survivors died in the fibrosis stage. Non-survivors had fewer days of hospitalization, shorter disease duration, shorter duration of alveolitis and fibrosis, and had dyspnea symptoms at disease onset (P = 0.05). Both first and lowest LDH values in the alveolitis stage were more pronounced in non-survivors than in survivors (449.0 U/L vs 288.0 U/L, P = 0.0243; 445.0 U/L vs 288.0 U/L, P = 0.0199, respectively), while the first, lowest and highest values of serum LDH in non-survivors were all significantly increased compared to survivors in the fibrosis phase (449.0 U/L vs 225.5 U/L, P = 0.0028; 432.0 U/L vs 191.0 U/L, P = 0.0007; 1303.0 U/L vs 263.5 U/L, P = 0.0001, respectively). The cut-off points of first LDH values in the alveolitis and fibrosis phase for distinction of non-survivors from survivors were 397.0 U/L and 263.0 U/L, respectively. In the fibrosis stage, non-survivors had more days with high LDH than survivors (7.0 d vs 0.0 d, P = 0.0002). Importantly, patients with high LDH had a significantly shorter median survival time than patients with low LDH in the alveolitis phase (22.0 d vs 36.5 d, P = 0.0002), while patients with high LDH also had a significantly shorter median survival time than patients with low LDH in the fibrosis phase (27.5 d vs 40.0 d, P = 0.0008). The proportion of non-survivors with detectable SARS-CoV-2 until death in the alveolitis stage was significantly increased compared with that in the fibrosis stage (100% vs 35.7%, P = 0.0220). CONCLUSION: High LDH and dyspnea symptoms were positive predictors of an adverse outcome in critical COVID-19. The rapid progressive fibrosis stage was more perilous than the alveolitis stage, even if SARS-CoV-2 is undetectable.

Antibodies to Type IV Collagen Induce Type 1 Autoimmune Pancreatitis.

Type 1 autoimmune pancreatitis (AIP) is prototypic autoantibody-mediated diseases. Sclerosis accompanied by fiber deposition is generally regarded as the primary lesion in the development of obliterative vasculitis. However, why collagens or their antibodies play a crucial role in the pathogenesis of AIP has not been demonstrated. This study was performed to investigate if anti-collagen type IV antibodies (ACIVAbs) are the key factor of fiber deposition and recruit leukocytes, resulting in obliterative vasculitis in pancreas. Enzyme-linked immunosorbent analyses (ELISA) were used to measure the expression of Col IV and ACIVAbs in serum of patients with and without AIP. In vitro, adhesion and proliferation were determined by human lymphocytes incubated with Col IV and ACIVAbs. In vivo, C57BL0/6 mice were immunized with IgG-ACIVAbs, followed by analysis of clinical phenotype. IgG-ACIVAbs were recognized by the serum specimens from 12 of 22 patients with type 1 AIP, 3 of 9 patients with Crohn's disease, and 2 of 18 patients with pancreatic cancer, but not in healthy controls and acute pancreatitis. In patient's biopsy, ACIVAb staining increased and co-localized with subepithelial IgG4 deposits along the capillary walls and surrounding nerve fibers. In vitro, recombinant IgG-ACIVAbs increased leukocyte adhesion and proliferation. What is more, AIP could be induced in mice by immunization with IgG-ACIVAbs into adult mice.

Upregulation of long non-coding RNA TUG1 correlates with poor prognosis and disease status in osteosarcoma.

The pathogenesis of osteosarcoma involves complex genetic and epigenetic factors. This study was to explore the impact and clinical relevance of long non-coding RNA (lncRNA), Taurine up-regulated gene 1 (TUG1) on patients with osteosarcoma. Seventy-six osteosarcoma tissues and matched adjacent normal tissues were included for analysis. The plasma samples were obtained from 29 patients with osteosarcoma at pre-operation and post-operation, 42 at newly diagnosed, 18 who experienced disease progression or relapse, 45 post-treatment, 36 patients with benign bone tumor, and 20 healthy donors. Quantitative real-time reverse transcript polymerase chain reactions were used to assess the correlation of the expression levels of TUG1 with clinical parameters of osteosarcoma patients. TUG1 was significantly overexpressed in the osteosarcoma tissues compared with matched adjacent normal tissues (P < 0.01) and was closely correlated with tumor size, post-operative chemotherapy, and Enneking surgical stage. Upregulation of TUG1 strongly correlated with poor prognosis and was an independent prognostic indicator for overall survival (HR = 2.78, 95% CI = 1.29-6.00, P = 0.009) and progression-free survival (HR = 1.81, 95% CI = 1.01-3.54, P = 0.037). Our constructed nomogram containing TUG1 had more predictive accuracy than that without TUG1 (c-index 0.807 versus 0.776, respectively). In addition, for plasma samples, TUG1 expression levels were obviously decreased in post-operative patients (mean ΔCT -4.98 ± 0.22) compared with pre-operation patients (mean ΔCT -6.09 ± 0.74), and the changes of TUG1 expression levels were significantly associated with disease status. Receiver operating characteristic (ROC) curve analysis demonstrated that TUG1 could distinguish patients with osteosarcoma from healthy individuals compared with alkaline phosphatase (ALP) (the area under curve 0.849 versus 0.544). TUG1 was overexpressed in patients with osteosarcoma and strongly correlated with disease status. In addition, TUG1 may serve as a molecular indicator in maintaining surveillance and forecasting prognosis.

Danggui sini decoction ameliorates myelosuppression in animal model by upregulating Thrombopoietin expression.

Danggui Sini decoction (DSD), a famous Chinese medicine, has been used therapeutically in various diseases. In this study, we tried to investigate whether and how DSD could ameliorate myelosuppression in an animal model, in which myelosuppression is induced by cyclophosphamide treatment. The myelosuppression model was established by intraperitoneal injection of 100 mg/kg cyclophosphamide in mice. Flow cytometry was used to assess cell numbers and evaluate the bone marrow cell cycle distribution. Spleen samples were collected, and the mRNA expression levels of thrombopoietin (TPO) and c-Mpl were analyzed by RT-PCR. Our results demonstrated that DSD could significantly elevate the level of bone marrow hematopoietic stem progenitor cells in myelosuppression mice model. DSD also accelerated cell proliferation by switching cell cycles from G0/G1 phase to S and G2/M phase. Moreover, DSD significantly elevated the mRNA expression level of TPO, but not c-Mpl in spleen. Overall, the present results indicated that DSD is a promising Chinese medicine that is highly potent to ameliorate myelosuppression induced by chemotherapy by upregulating TPO expression.

Expression of FGF-2 and IGF-1 in diabetic rats with fracture.

OBJECTIVE: To observe the change of fibroblast growth factor-2 (FGF-2), insulin-like growth factor-1 (IGF-1) in serum and bone callus after fracture in diabetic rats, and to explore molecular biological mechanism of healing of diabetic fracture. METHODS: Thirty male SD rats were designed into normal (n=15) and control (n=15) groups randomly. Venous blood was extracted on the lst, 2nd, 4th, 6th, 8th week after surgery. It was certificated and the serum was obtained. Left lower extremity was observed by X- ray. Bone callus at broken ends was observed under light microscope. Expressions of FGF-2 and IGF-1 in tissue were detected by immunohistochemistry method, and ELISA was used to detect expression of FGF-2 and IGF-1 in serum. RESULTS: The results showed a significant increase in the density and area of newly formed bone in the distraction gaps of normal rats compared to control rats. Increased cell proliferation was also found in the distraction gaps of normal rats versus control rats. There was significant difference in serum levels of FGF-2 and IGF-1 between two groups. CONCLUSIONS: The decrease of FGF-2 and IGF-1 both in the serum and in the fracture region is one of the reasons for bad bone healing or delayed union in rats' fracture with diabetes. There are some synergistic effects possibly between FGF-2 and IGF-1.

Multiple gene mutations in patients with type 2 autoimmune pancreatitis and its clinical features.

BACKGROUND: It is now clear that there are two histological types (type 1 and type 2) of autoimmune pancreatitis (AI P). The histological substance of type 1 AI P is known as lymphoplasmacytic sclerosing pancreatitis (LPSP) or traditional AIP, and type 2 AIP is characterized by distinct histology called idiopathic duct centric pancreatitis (IDCP). Serum IgG4 increase is considered as a marker for type 1 AI P. Far less is known about type 2 and it lacks predicting markers, so it easily leads to missed diagnosis and misdiagnosis. THE AIM OF THIS STUDY: The aim of this study was to describe multi-gene mutations in patients with type 2 AI P and its clinical features. MATERIAL AND METHODS: Three unrelated patients with type 2 AI P, 10 cases with type 1 AIP, 15 cases with other chronic pancreatitis and 120 healthy individuals were studied. The mutations and polymorphisms of 6 genes involved in chronic pancreatitis or pancreatic cancer - PRSS1, SPINK1, CFTR, MEN1, PKHD1, and mitochondrial DNA - were sequenced. Information of clinical data was collected by personal interview using a structured questionnaire. RESULTS: Novel mutations were found in the genes encoding for MEN1 (p.546 Ala > The) and PKHD1 (c. 233586 A > G and c. 316713 C > T) from patients with type 2 AIP. What is more, the serum TCR (T cell receptor) level is relatively higher in patients with type 2 AIP than in patients with type 1 AIP and other chronic pancreatitis or normal controls. Weight loss was the major manifestation and no patients had extrapancreatic involvement in type 2 AIP. CONCLUSIONS: Type 2 AIP may occur with multi-gene mutations. For screening purposes, it is more reasonable to evaluate TCR levels in serum.

Increased plasma level of asymmetric dimethylarginine in hypertensive rats facilitates platelet aggregation: role of plasma tissue factor.

This study was designed to explore the role of asymmetric dimethylarginine (ADMA), an endogenous inhibitor of nitric oxide synthesis, in platelet aggregation in hypertension and its possible mechanisms. Spontaneously hypertensive rats (SHR) and L-NAME-induced hypertensive rats were orally administered with L-arginine (1 g/(kg·day) for 14 days. Systolic blood pressure, platelet aggregation, and plasma tissue factor (TF) level and activity were measured. The plasma concentration of ADMA in SHR was determined. In vitro, platelet-rich plasma isolated from Wistar rats was prepared in order to observe the effect of exogenous ADMA on platelet aggregation and TF level and (or) activity in platelet-rich plasma. In both types of hypertensive rats, systolic blood pressure, platelet aggregation, and the level and activity of plasma TF were elevated compared with corresponding control animals. Plasma ADMA level was also increased in SHR. Treatment with L-arginine, a competitor of ADMA, lowered blood pressure and inhibited platelet aggregation concomitantly with a decrease in plasma TF level and activity in both types of hypertensive rats. We also found that exogenous ADMA promoted platelet aggregation and increased TF level and (or) activity in platelet-rich plasma, an effect that was inhibited by pretreatment with L-arginine. Importantly, the enhanced platelet aggregation induced by exogenous ADMA was reduced by pretreatment with anti-TF antibody. The results suggest that endogenous ADMA may be involved in platelet hyperaggregation status in hypertension, and the facilitation of platelet aggregation by ADMA is related to upregulation of the level and activity of plasma TF.

[Two novel mutations of FBN1 gene in the patients with MFS among Han population].

To detect the mutations of fibrillin-1 (FBN1) gene in the patients with Marfan syndrome (MFS), polymerase chain reaction (PCR) and denaturing high-performance liquid chromatography (DHPLC) were conducted to screen for the mutations in FBN1 gene. Sequence analyses were carried out when the DNA amplification fragments of the DHPLC elution profiles showed difference from the corresponding normal elution profile. Two novel mutations were detected in two families with MFS, respectively. One was a multiplex mutation in exon 55 containing a deletion mutation c.6862_6871delGGCTGTGTAG (p.Gly2288MetfsX109), a synonymous mutation (c.6861A>G) and an intronic mutation c.[6871+1_6871+11delGTAAGAGGATC; 6871+34dupCATCAGAAGTGACAGTGGACA], and the other was a missense mutation in exon 20 c.2462G>A (p.Cys821Tyr). The results indicated that the deletion mutation c.[6862_6871delGGCTGT GTAG; 6871+1_6871+11delGTAAGAGGATC] (p.Gly2288MetfsX109) and the missense mutation c.2462G>A (p.Cys821Tyr) of FBN1 gene may cause the two family patients with MFS respectively.

Facile synthesis of spirocyclic aromatic hydrocarbon derivatives based on o-halobiaryl route and domino reaction for deep-blue organic semiconductors.

Conventional o-halobiaryl and one-pot tandem protocols have been developed to synthesize naphthalene- and pyrene-containing spirofluorenes. Two pyrene substituents were installed using a Suzuki cross-coupling reaction to produce a series of spirofluorene-functionalized polycyclic aromatic hydrocarbon derivatives, DPSBFF, DPSIPF, DPSDBXF, and DPSFX. A preliminary spin-coated device based on DPSFX:PVK blends exhibits a low turn-on voltage of 4.3 V and deep-blue emission with a current efficiency of 1.1 cd/A.

Decrease in the synthesis and release of calcitonin gene-related peptide in dorsal root ganglia of spontaneously hypertensive rat: role of nitric oxide synthase inhibitors.

Calcitonin gene-related peptide (CGRP), the major transmitter in capsaicin-sensitive sensory nerves, and asymmetric dimethylarginine (ADMA), an endogenous inhibitor of nitric oxide synthase, participate in the regulation of blood pressure. In the present study, we tested the relationship between CGRP and ADMA in spontaneously hypertensive rats (SHRs). For the in vivo study, SHRs were treated with or without L-arginine for 2 weeks, and Wistar Kyoto (WKY) rats were used as controls. Systolic arterial pressure was measured, and the levels of CGRP, ADMA, and NO were analyzed. For the in vitro study, neural cells from dorsal root ganglia were treated with NO inhibitor or donor. Synthesis and release of CGRP were measured. Compared with WKY rats, serum concentration of ADMA in SHRs increased while CGRP and NO level decreased. Treatment with L-arginine significantly decreased blood pressure, concomitantly with an increase in the level of NO and the synthesis and release of CGRP in SHRs, but it did not affect ADMA levels. In cultured neural cells, ADMA reduced the level of NO and inhibited the synthesis and release of CGRP in a concentration-dependent manner. The effects of ADMA were reversed by L-arginine. Treatment with NOC-18, a donor of NO, increased the release and synthesis of CGRP in neural cells in a concentration-dependent manner. Decreased synthesis and release of CGRP is related to a reduction in NO levels, and corresponds to the increased concentrations of ADMA in spontaneously hypertensive rats.

Transient receptor potential vanilloid 1-mediated expression and secretion of endothelial cell-derived calcitonin gene-related peptide.

Calcitonin gene-related peptide (CGRP), the principal transmitter in sensory nerves, could also be expressed in vascular endothelium. Transient receptor potential vanilloid 1(TRPV1), which modulates the synthesis and release of CGRP in sensory nerves, is also present in endothelial cells. The present study tested whether TRPV1 modulates the release and synthesis of CGRP in endothelial cells, and evaluated the protective effect of endothelial cell-derived CGRP. Human umbilical vein endothelial cells (HUVECs) were treated with capsaicin or hyperthermia. The level of CGRP mRNA was detected by RT-PCR, and protein level was measured by radioimmunoassay. Endothelial cell injury was induced by lysophosphatidylcholine, and evaluated by cell viability and lactate dehydrogenase activity. HUVECs expressed CGRP, both alpha- and beta-subtype. Capsaicin increased the level of CGRP in the culture medium, and up-regulated the expression of CGRP in endothelial cells. Hyperthermia also increased the level of CGRP mRNA. These effects were abolished by capsazepine, a competitive antagonist of TRPV1. Capsaicin significantly attenuated the endothelial cell damage induced by LPC, which was prevented and aggravated by capsazepine or CGRP(8-37,) antagonist of CGRP receptor. These results indicate that TRPV1 also regulates the expression and secretion of endothelial cell-derived CGRP, which affords protective effects on endothelial cells.

Calcitonin gene-related peptide-mediated cardioprotection of postconditioning in isolated rat hearts.

Previous studies have demonstrated that endogenous calcitonin gene-related peptide (CGRP) plays an important role in mediation of ischemic preconditioning. In the present study, we tested whether CGRP is also involved in mediation of the protective effects of postconditioning in isolated rat hearts. Sixty minutes of left coronary artery occlusion and followed by 60 min of reperfusion caused a significant decrease in cardiac function and a significant increase in creatine kinase (CK) release and infarct size. Postconditioning with three cycles of 1-min ischemia and 1-min reperfusion produced a marked improvement of cardiac function and decreased CK release and infarct size, concomitantly with an increase in the release of CGRP release in coronary effluent. However, the cardioprotection afforded by postconditioning was abolished by CGRP 8-37 (10(-7) M), a selective CGRP receptor antagonist, or pretreatment with capsaicin (50 mg/kg, s.c.), which depletes transmitters in sensory nerves. Exogenous CGRP (5 x 10(-9) M) administration of CGRP reappeared postconditioning-like cardioprotection in the rats pretreated with capsaicin. These results suggest that the protective effects of ischemic postconditioning are related to stimulation of endogenous CGRP release in rat hearts.

Calcitonin gene-related Peptide-mediated depressor effect and inhibiting vascular hypertrophy of rutaecarpine in renovascular hypertensive rats.

Calcitonin gene-related peptide (CGRP), the predominant neurotransmitter in capsaicin-sensitive sensory nerves, is a potent vasodilator and inhibits proliferation of vascular smooth muscle cells. Previous investigations have demonstrated that the hypotensive effect of rutaecarpine (Rut) is associated to stimulation of CGRP synthesis and release via activation of the vanilloid receptor subtype 1 (VR1) in the phenol-induced hypertensive rat. This study tested whether the depressor effect and inhibiting vascular hypertrophy of Rut is mediated by endogenous CGRP in 2-kidney, 1-clip (2K1C) hypertensive rats. Systolic blood pressure (SBP) was measured by tail-cuff method in conscious. Mesenteric arteries were isolated for examination of morphological changes. The concentration of CGRP in the plasma and the expression of CGRP mRNA in dorsal root ganglia (DRG) were measured. Chronic administration of Rut (10, 20, or 40 mg/kg/day, respectively) for 4 weeks caused a depressor effect and significantly regressed the lumen diameter and decreased the medium thickness of mesenteric arteries in hypertensive rats concomitantly with an increase in the plasma concentration of CGRP and the expression of CGRP mRNA in DRG. In conclusion, chronic administration of Rut can reduce blood pressure and relieve mesenteric artery hypertrophy in the 2K1C hypertensive rats, and the effects of Rut may be related to stimulation of CGRP synthesis and release.

Role of asymmetric dimethylarginine in homocysteine-induced apoptosis of vascular smooth muscle cells.

Homocysteine (Hcy) could induce apoptosis of vascular smooth muscle cells (VSMC). Asymmetric dimethylarginine (ADMA) has been thought as a novel risk factor for cardiovascular diseases. We hypothesized that ADMA mediates homocysteine-induced apoptosis of VSMC. In this experiment the level of ADMA in the medium measured by high-performance liquid chromatography (HPLC) was elevated when the apoptosis of T/G HA-VSMC was induced by Hcy which was detected by Hoechst33342 staining or flow cytometry (FCM) with Annecin V+Propidium Iodide (PI). Exogenous ADMA induced the apoptosis of VSMC. At the same time, ADMA elevated the level of intracellular reactive oxidative species (ROS) determined by fluorescent ROS detection kit. The activation of JNK and p38MAPK contributed to ADMA-induced apoptosis of VSMC. The present results suggest that endogenous ADMA is involved in apoptosis of VSMC induced by Hcy, and the effects of ADMA is related to elevation of intracellular ROS and activation of JNK/p38MAPK signaling pathways.

Biphasic effect of aspirin on apoptosis of bovine vascular endothelial cells and its molecular mechanism.

AIM: To investigate the effect of aspirin on the apoptosis of cultured bovine aortic endothelial cells (BAEC) and the signal pathways involved in this process. METHODS: BAEC were cultured and passaged in Dulbecco's modified Eagle's medium culture medium. Morphologic changes and quantification of apoptotic cells were determined using fluorescence microscope after staining the cells with Hoechst 33258. Cell viability was measured by 3-[4,5-dimethylthiazol-2-yl]-2,5- diphenyltetrazolium bromide (MTT) method. DNA fragmentation was visualized by agarose gel electrophoresis. Phospho-p38 mitogen-activated protein kinase (MAPK) expression was detected by Western blotting. RESULTS: Aspirin at low concentrations from 1X10( -10) mol/L to 1X10( -8) mol/L decreased the apoptosis and p38 MAPK phosphorylation induced by H2O2 in BAEC, while high doses of aspirin (1X10( -7)-1X10( -4) mol/L) induced typical apoptotic changes in BAEC and stimulated the expression of phospho-p38 MAPK in a concentration-dependent manner. SB203580, a specific p38 MAPK inhibitor, blocked such effects. CONCLUSION: Aspirin exhibits a biphasic effect on the apoptosis in BAEC, reducing apoptosis at low concentration and inducing apoptosis at high concentration. p38 MAPK may be an important signal molecule mediating the effects of aspirin.

Microwave-enhanced multiple Suzuki couplings toward highly luminescent starburst monodisperse macromolecules.

A facile and powerful microwave-enhanced multiple Suzuki coupling methodology has been developed and a novel series of highly luminescent six-arm monodisperse macromolecules have thus been prepared with high yield and purity.

[Experimental study on bacteriostasis of chitosan and sodium hyaluronate].

OBJECTIVE: To compare the effect and coverage of bacteriostasis of chitosan and sodium hyaluronate. METHODS: Each of the five bacteria, Proteus mirabilis, Escherichia coli, Candida albicans, Pseudomonas aeruginosa, Staphylococcus aureus, was cultivated for 33 tubes of broth culture. Leaving three tubes each group as control group, ploidy diluted concentration of high relative molecular weight chitosan, low relative molecular weight chitosan and sodium hyaluronate were added respectively in the broth culture. All the tubes were cultivated for 18 hours at 37 degrees C with homeothermia. Then the growth of bacteria was observed. RESULTS: The minimal inhibitory concentrations (MIC) of high relative molecular weight chitosan were: Proteus mirabilis 0.031%, Escherichia coli 0.063%, Candida albicans 0.063%, Pseudomonas aeruginosa 0.063%, Staphylococcus aureus 0.063%; and the MIC of low relative molecular weight chitosan were: Proteus mirabilis 0.125%, Escherichia coli 0.025%, Candida albicans 0.25%, Pseudomonas aeruginosa 0.25%, Staphylococcus aureus 0.125%; bacteria grew well in each tube of sodium hyaluronate group and control group. CONCLUSION: The above results show that sodium hyaluronate has no bacteriostasis, while chitosan has bacteriostasis on broad spectrum and high relative molecular weigh: chitosan has stronger effect.

VEGF protects bovine aortic endothelial cells from TNF-alpha- and H2O2-induced apoptosis via co-modulatory effects on p38-and p42/p44-CCDPK signaling.

AIM: To investigate the effect of VEGF on TNF-alpha- or H2O2-induced apoptosis in cultured bovine aortic endothelial cells (BAEC) and the underlied signal transduction mechanisms related to Ca2+-calmodulin dependent protein kinase (CCDPK). METHODS: BAEC were cultured and passaged in DMEM. Morphologic changes and quantification of apoptotic cells were determined under fluorescence microscope with Hoechst 33258 staining. Cell viability was detected with MTT method. DNA fragmentation was visualized by agarose gel electrophoresis. The expression of phospho-p38 and phospho-p42/p44 CCDPK was measured by Western blotting. RESULTS: TNF-alpha 5000 kU/L and H2O2 300 micromol/L elicited DNA fragmentation in BAEC. Vascular endothelial growth factor (VEGF) 100 microg/L significantly protected BAEC from apoptosis induced by TNF-alpha or H2O2, as shown in cell viability assay and apoptotic cell counting. DNA fragmentation induced by TNF-alpha or H2O2 was also reduced by VEGF 100 microg/L. VEGF enhanced TNF-alpha and H2O2 stimulated expression of phospho-p42/p44 CCDPK, simultaneously inhibited TNF-alpha- and H2O2-induced activation of phospho-p38 CCDPK. Both the VEGF-induced up-regulation of phospho-p42/p44 CCDPK and its anti-apoptotic action were prevented by the specific p42/p44 CCDPK inhibitor U0126. CONCLUSION: VEGF protects BAEC from apoptosis induced by TNF-alpha and H2O2, and its co-modulatory effects by activation of p42/p44 CCDPK signaling together with inhibition of p38 CCDPK signaling appear to be an important mechanism for its survival effect on endothelial cells.