Identification by whole-exome sequencing of new single-nucleotide polymorphisms associated with molar-incisor hypomineralisation among the Lebanese population.

OBJECTIVE: Molar-incisor hypomineralization (MIH) is a developmental qualitative enamel defect, causing a worldwide challenging dental problem. The etiology of this defect remains unclear. Here we identify by whole-exome sequencing (WES) new single-nucleotide polymorphisms (SNPs) in genes expressed during enamel mineralization and in those modulating prenatal, natal and postnatal risk factors among the Lebanese MIH children: immune system and xenobiotic detoxification. DESIGN: Dental examination for MIH was performed based on the MIH index for diagnostic criteria. Saliva samples were collected from 37 non-related, MIH-diagnosed subjects for DNA extraction. WES was performed on the Illumina HiSeq2000 platform. The χ2 test and Fisher's exact test were used to determine relationship between SNPs frequencies and MIH. OR and its 95% CI were used to report the strength of association. The significance threshold was set at 0.05. RESULTS: Among the Lebanese population, 37 SNPs presented a significant association with MIH in the following genes: AMTN, MMP-20, STIM1, STIM2, ORAI1, SLC34A2, SLC34A3, VDR, PVALB, HSP90B1, TRPM7, SLC24A4, CA6, SLC4A2, TNFRSF11A, IL10RB, ARNT, ESR1 and CYP1B1. CONCLUSION: This is the first WES study conducted in patients with MIH. Yet, interactions between polymorphisms in different gene categories are to be investigated for a better assessment of MIH susceptibility.

Relation between molar-incisor hypomineralization (MIH) occurrence and war pollutants in bombarded regions: Epidemiological pilot study in Lebanon.

BACKGROUND: Molar-incisor hypomineralization (MIH), a developmental enamel defect affecting one or more first permanent molars (FPMs) and sometimes incisors (PIs), is one of the most common pandemic health problems in the world. MIH etiology is still unclear and has been suggested to be related to exposure to environmental toxicants during enamel mineralization. AIMS: To assess the susceptibility to MIH occurrence in regards to war pollutants through the investigation of the prevalence and the clinical characteristics of MIH in a group of Lebanese children whose FPMs and PIs enamel mineralization coincides with the 2006 Lebanese war. PATIENTS AND METHODS: This cross-sectional study was performed in schools from different regions of Lebanon. Schoolchildren born in 2004, 2005, 2006, and 2007 were examined for MIH. Clinical status, lesion type, extension, and severity were recorded using the short form chart of the MIH index. Pearson's Chi-square or Fischer's exact test were used to determine if there is a significant relationship between categorical variables. RESULTS: An overall MIH prevalence of 22.93% has been reported. Forty-seven point seventy-five per cent had both molars and incisors affected. Demarcated opacities were the most frequently observed clinical status. Most of the MIH FPMs and PIs were mildly affected with lesions extended on less than the third of the tooth surface. CONCLUSIONS: MIH prevalence among children born around 2006 Lebanese war is high. The hypothesis of a relation between MIH susceptibility and war pollutants in bombarded regions is legible but requires to be elucidated via additional in vitro and in vivo studies for accurate risk assessment.

Deciphering balanced translocations in infertile males by next-generation sequencing to identify candidate genes for spermatogenesis disorders.

Male infertility affects about 7% of the general male population. Balanced structural chromosomal rearrangements are observed in 0.4-1.4% of infertile males and are considered as a well-established cause of infertility. However, underlying pathophysiological mechanisms still need to be clarified. A strategy combining standard and high throughput cytogenetic and molecular technologies was applied in order to identify the candidate genes that might be implicated in the spermatogenesis defect in three male carriers of different balanced translocations. Fluorescence in situ hybridization (FISH) and whole-genome paired-end sequencing were used to characterize translocation breakpoints at the molecular level while exome sequencing was performed in order to exclude the presence of any molecular event independent from the chromosomal rearrangement in the patients. All translocation breakpoints were characterized in the three patients. We identified four variants: a position effect on LACTB2 gene in Patient 1, a heterozygous CTDP1 gene disruption in Patient 2, two single-nucleotide variations (SNVs) in DNAH5 gene and a heterozygous 17q12 deletion in Patient 3. The variants identified in this study need further validation to assess their roles in male infertility. This study shows that beside the mechanical effect of structural rearrangement on meiosis, breakpoints could result in additional alterations such as gene disruption or position effect. Moreover, additional SNVs or copy number variations may be fortuitously present and could explain the variable impact of chromosomal rearrangements on spermatogenesis. In conclusion, this study confirms the relevance of combining different cytogenetic and molecular techniques to investigate patients with spermatogenesis disorders and structural rearrangements on genomic scale.

Molar-incisor hypomineralisation in Lebanon: association with prenatal, natal and postnatal factors.

BACKGROUND: Molar-incisor hypomineralisation is an enamel developmental defect highly prevalent in Lebanon. Literature suggests that perinatal conditions and childhood illnesses might be potential aetiological factors for this affection. AIMS: This case-control study aimed to investigate the association of MIH with prenatal, natal and postnatal factors amongst 7-9 years Lebanese children and to end up with recommendations to overcome its occurrence. METHODS: Self-administered, structured questionnaire including potential etiological factors was distributed to 659 MIH and non-MIH children's parents. The analysis of data was carried out using Statistical Package for Social Sciences Computer Software (SPSS 21.0, Inc., Chicago, IL, USA). For Statistical analysis, Pearson's chi-square, Fischer's exact test and multivariate regression model were used. A p value of less than 0.05 was considered statistically significant. RESULTS: Children whose mothers had consumed food and drinks canned during pregnancy had 2.9 (CI: 1.367 to 6.187) times more likely to have MIH. Those who had history of taking antibiotics had 2.15 (CI: 1.186 to 3.909) times higher odds of MIH than those who did not have while those who had fever episodes during the early childhood years were 2.057 (CI: 1.149 to 3.683) times more likely to develop MIH. CONCLUSION: During early childhood, careful handling of high fever, greater public awareness regarding misuse of antibiotics and education about bisphenol A and how to avoid it during pregnancy and breastfeeding are recommended to decrease the occurrence of MIH.

Molar incisor hypomineralisation in Lebanon: prevalence and clinical characteristics.

BACKGROUND: Molar incisor hypomineralisation (MIH) is a qualitative enamel developmental defect affecting 1-4 first permanent molars and sometimes the permanent incisors. MIH is extremely widespread around the world and presents a considerable clinical problem in paediatric dentistry. Although, little prevalence data exist for Middle East populations including the Lebanese one. AIM: The objectives of this study were to investigate the prevalence of MIH in 7-9-year-old Lebanese children, with relevance to gender, jaw and side distribution, and to assess the clinical status, extent and severity of MIH lesions of the affected teeth. DESIGN: Representative sample (n = 659) of 7-9-year-old Lebanese children attending private and public schools distributed throughout Lebanon was examined for MIH. Clinical status, extent and severity of MIH lesions on FPMs and permanent incisors were scored using the short-form grading method (MIH index) of Ghanim et al. (Eur Arch Paediatr Dent 16:235-246, 2015). RESULTS: An overall MIH prevalence of 26.7% was reported with no significant predilection for girls over boys. 52.8% of the cases present with only molars and. 47.2% with both molars and incisors and did not present any significant difference between upper and lower jaws (P = 0.325). Left-side FPMs were more affected than the right ones (P = 0.0218). Central incisors were significantly more affected than the laterals in both jaws (P < 0.0001). Maxillary central incisors were significantly more affected than their mandibular counterparts (P < 0.0001). Most of the clinical status was demarcated opacities extended on less than the third of the tooth surface. The extent of lesions correlated significantly with the number of affected molars. Most of the affected teeth presented with mild defects and the degree of severity was not correlated with gender but significantly increased with age. CONCLUSIONS: MIH is prevalent in Lebanon. Further studies are required to analyse the possible systemic and environmental etiologies among Lebanese children.

Report on a patient with a 12q24.31 microdeletion inherited from an insulin-dependent diabetes mellitus father.

We report a 2.3-year-old female patient with global developmental delay, infantile spasms, hypotonia, microcephaly, flat face, full cheeks, macroglossia, highly arched palate, retro-gnathia, narrow ear orifices, and café-au-lait spots. Molecular karyotyping revealed approximately a 1-Mb interstitial deletion of the long arm of one chromosome 12, del(12)(q24.31). The same deletion was identified in her father who presents insulin-dependent diabetes mellitus (IDDM) diagnosed at 14 years. Only one other patient with a similar de novo deletion has been reported previously [Mol Syndromol 2010;1:42-45]. A phenotype-genotype correlation is discussed, and the description of a novel rare microdeletion entity is raised.

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

A novel deletion in ZBTB24 in a Lebanese family with immunodeficiency, centromeric instability, and facial anomalies syndrome type 2.

The immunodeficiency, centromeric instability and facial anomalies (ICF) syndrome is a rare autosomal recessive disease characterized by targeted chromosome breakage, directly related to a genomic methylation defect. It manifests with phenotypic and clinical variability, with the most consistent features being developmental delay, facial anomalies, cytogenetic defects and immunodeficiency with a reduction in serum immunoglobulin levels. From the molecular point of view, ICF syndrome was always divided into ICF type I (ICF1) and ICF type 2 (ICF2). Mutations in DNMT3B gene are responsible for ICF1, while mutations in ZBTB24 have been reported to be responsible for ICF2. In this study, we describe a Lebanese family with three ICF2 affected brothers. Sanger sequencing of the coding sequence of ZBTB24 gene was conducted and revealed a novel deletion: c.396_397delTA (p.His132Glnfs*19), resulting in a loss-of-function of the corresponding protein. ZBTB24 belongs to a large family of transcriptional factors and may be involved in DNA methylation of juxtacentromeric DNA. Detailed molecular and functional studies of the ZBTB24 and DNMT3B genes are needed to understand the pathophysiology of ICF syndrome.

Cardiorenal syndrome in hypertensive rats: microalbuminuria, inflammation and ventricular hypertrophy.

The aim of our study was to evaluate a possible association between microalbuminuria (MA), several low-grade inflammation factors and left ventricular hypertrophy (LVH) by using a pharmacological approach. This may provide new insights into the pathophysiologic mechanisms of the cardiorenal syndrome (CRS) linking early renal impairment with elevated cardiovascular risk. Two kidney-one clip (2K-1C) renovascular hypertension was induced in 24 male Wistar rats (220-250 g). After the development of hypertension, rats were divided into four groups: 2K-1C (untreated), calcium channel blocker (amlodipine-treated), angiotensin receptor blocker (losartan-treated) and peripheral vasodilator (hydralazine-treated), which were treated for 10 weeks. Rats in the 2K-1C group had all developed hypertension, a significant increase in plasma levels of tumor necrosis factor alpha (TNF-alpha), interleukin 6 (IL-6), brain natriuretic peptide (BNP) and C-reactive protein (CRP). Moreover MA and creatininaemia underwent a significant increase. Under treatment decreases were observed in systolic blood pressure (SBP), TNF-alpha, CRP, IL-6, BNP concentrations and creatininaemia. These results were related to the absence of MA which was significantly associated with reductions in cardiac mass and hypertrophy markers (BNP and beta-MHC gene expression) as well as renal interstitial inflammation. In conclusion, our results suggest that the reduction of MA is correlated with the decrease of the inflammatory components and seems to play an important role in protecting against cardiac hypertrophy and renal injury.

Mild Campomelic Dysplasia: Report on a Case and Review.

We report on a 10.5-year-old girl with a mild form of campomelic dysplasia. She presented with short stature of prenatal onset, dysmorphic facial features, limitation of supination and pronation of the forearms, dysplastic nails, and bone abnormalities consisting especially of cone-shaped epiphyses of the middle phalanx of the 2nd fingers, brachydactyly and clinodactyly of the middle phalanx of both 5th fingers, short 4th metacarpals, radial and femoral head subluxation, hypoplastic scapulae, humeral and ulnar epiphyseal abnormalities, unossified symphysis pubis, and a significant delay in bone age. Molecular analysis of the SOX9 gene revealed the presence of a de novo missense mutation: p.P170L (c.509C>T). Mild and surviving cases of campomelic dysplasia are reviewed.

Molecular Study of Three Lebanese and Syrian Patients with Waardenburg Syndrome and Report of Novel Mutations in the EDNRB and MITF Genes.

Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region.

Microalbuminuria versus brain natriuretic peptide in cardiac hypertrophy of hypertensive rats.

The objective of this study was to assess a possible link between microalbuminuria (MA), a major risk factor of the cardiorenal syndrome and the brain natriuretic peptide (BNP), a marker of cardiac hypertrophy. Two kidney-one clip (2K-1C) renovascular hypertension was induced in 24 male Wistar rats (weighing 220-250 g). Rats were randomized into four groups for 8 weeks: Sham, not treated; Bos, treated with bosentan; Cap, treated with captopril; Bos/Cap, treated with both drugs. Blood pressure, plasma BNP and transforming growth factor beta1 (TGF-ß1) concentrations, microalbuminuria and creatininemia as well as cardiac mass, BNP, alpha- and beta-myosin heavy chain (MHC) gene expression and kidney histology were determined. Following stenosis, Sham rats developed hypertension (p < 0.001), an increase in BNP (p < 0.05) and TGF-ß1 (p < 0.005) concentrations, creatinine levels (p < 0.001), and urinary albumin (p < 0.001). Under drug treatment, decreases in blood pressure (p < 0.001), creatinine levels (p < 0.05), plasma TGF-ß1 (p < 0.005) and BNP (p < 0.05) concentrations, were concomitant with the absence of MA which was significantly correlated with reductions in cardiac mass (p < 0.05) and hypertrophy markers (BNP and ß-MHC gene expression) (p < 0.005) as well as in renal fibrosis. These findings suggest a potential link between microalbuminuria evolution and BNP as well as a possible effect of microalbuminuria-lowering therapy on halting the progression, or even inducing the regression of cardiac hypertrophy.

B-type natriuretic peptide receptors in hypertrophied adult rat cardiomyocytes.

Brain natriuretic peptide (BNP) binds to three types of natriuretic peptide receptors, NPR-A, -B and -C (NPRs). The expression shape of BNP and NPRs seems to be an important modulator factor in the pathogenesis of cardiac hypertrophy. The aim of this study was to evaluate the expression of NPRs in an animal model of pressure overload hypertrophy. Left ventricular hypertrophy was induced by chronic abdominal aortic banding in adult male Wistar rats. After six weeks, NPRs gene expression was evaluated with RT-PCR, BNP plasma concentration and BNP positive myocytes were measured with ELISA and immunohistochemistry techniques respectively. NPR-A and NPR-C mRNA expression was significantly increased in left ventricular hypertrophied cardiomyocytes by 1.6-fold and 2.1-fold respectively (P<0.01). Abdominal aortic banding increased significantly BNP plasma concentration (630+/-8pg/ml vs 106+/-4pg/ml; P<0.01). The percentage of BNP positive cells in normal myocardial tissue were 40% while in the hypertrophied one it raised to 80%. The data suggest that in our left ventricular hypertrophy model, the NPR-A and NPR-C receptors were increased in association to the increased BNP level. This relationship may amplify beneficial paracrine/autocrine effects of BNP on cardiac remodelling in response to hemodynamic overload.

A novel locus for autosomal recessive primary torsion dystonia (DYT17) maps to 20p11.22-q13.12.

Primary torsion dystonia is a clinically and genetically heterogeneous group of movement disorders. Fifteen different types of dystonia have been described to date, of whom 14 loci have been mapped, but only seven genes identified. Several different modes of inheritance have been described, including autosomal dominant transmission with reduced penetrance (12 loci), recessive X-linked (one locus), and autosomal recessive transmission (three loci). In this study, we describe the localization of a novel form of autosomal recessive, primary focal torsion dystonia using a genomewide search in a large consanguineous Lebanese family with three affected individuals. Homozygosity mapping with 382 microsatellite markers was conducted. Linkage analysis and haplotype construction allowed us to identify a novel locus designated as DYT17, within a 20.5-Mb interval on chromosome 20. Of the 270 known genes spread on this interval, 27 candidate genes were tested and excluded as responsible for the disease. Fine mapping by identification of other dystonia families linked to chromosome 20 and sequencing of candidate genes in the refined interval is required in order to identify the causative gene in DYT17.

Molecular analysis of F8 in Lebanese haemophilia A patients: novel mutations and phenotype-genotype correlation.

Haemophilia A (HA) is an X-linked recessive hereditary bleeding disorder affecting one in 5000 men, resulting from mutations in the F8 gene. Our objective was to identify the spectrum of mutations of the F8 gene in Lebanese patients, and to perform genotype/phenotype correlations. A group of 79 HA patients from 55 unrelated families was studied. Patients were screened for intron 22 and intron 1 inversion using PCR. In the absence of mutations in both introns, a dHPLC screening followed by a DNA sequencing of all coding regions was performed. When patients presented novel mutations, 150 control chromosomes were tested to exclude common polymorphisms. Large deletions were confirmed by MLPA technique. The mRNA was specifically studied whenever a splice site mutation was detected. In addition, studies of the putative biochemical function and FVIII 3D structures were conducted. Thirty-four mutations were identified in this study of which 21 were novel: 11 missense, two nonsense, two splice sites, five small deletions and one large deletion. Inhibitor found in three over 75 patients correlated with large deletion, intron 22 inversion, and nonsense mutations. We were able to identify all causative mutations in those HA patients. This knowledge represents a huge step for genetic counselling.

Revisiting the craniosynostosis-radial ray hypoplasia association: Baller-Gerold syndrome caused by mutations in the RECQL4 gene.

Baller-Gerold syndrome (BGS) is a rare autosomal recessive condition with radial aplasia/hypoplasia and craniosynostosis (OMIM 218600). Of >20 cases reported so far, a few appear atypical and have been reassigned to other nosologic entities, including Fanconi anaemia, Roberts SC phocomelia, and Pfeiffer syndromes after demonstration of corresponding cytogenetic or molecular abnormalities. Clinical overlap between BGS, Rothmund-Thomson syndrome (RTS), and RAPADILINO syndrome is noticeable. Because patients with RAPADILINO syndrome and a subset of patients with RTS have RECQL4 mutations, we reassessed two previously reported BGS families and found causal mutations in RECQL4 in both. In the first family, four affected offspring had craniosynostosis and radial defect and one of them developed poikiloderma. In this family, compound heterozygosity for a R1021W missense mutation and a g.2886delT frameshift mutation of exon 9 was found. In the second family, the affected male had craniosynostosis, radial ray defect, poikiloderma, and short stature. He had a homozygous splice site mutation (IVS17-2A>C). In both families, the affected offspring had craniosynostosis, radial defects, and growth retardation, and two developed poikiloderma. Our results confirm that BGS in a subgroup of patients is due to RECQL4 mutations and could be integrated into a clinical spectrum that encompasses RTS and RAPADILINO syndrome.

X-linked reticulate pigmentary layer. Report of a new patient and demonstration of a skewed X-inactivation.

We report a boy, born to healthy first cousin parents, with diffuse hyperpigmentation of the skin and guttate hypomelanotic lesions, photophobia, abnormal hair, developmental delay, and recurrent bronchitis. Skin histology showed pigmentation incontinence with numerous melanophages. Electron microscopy showed a very high number of melanosomes and some degenerating keratinocytes. These features correspond to a rare genodermatosis, the X-linked reticulate pigmentary disorder with systemic manifestations. Skewed X-inactivation patterns were detected in the mother's lymphocytes.