RESUMO
We report a 2.3-year-old female patient with global developmental delay, infantile spasms, hypotonia, microcephaly, flat face, full cheeks, macroglossia, highly arched palate, retro-gnathia, narrow ear orifices, and café-au-lait spots. Molecular karyotyping revealed approximately a 1-Mb interstitial deletion of the long arm of one chromosome 12, del(12)(q24.31). The same deletion was identified in her father who presents insulin-dependent diabetes mellitus (IDDM) diagnosed at 14 years. Only one other patient with a similar de novo deletion has been reported previously [Mol Syndromol 2010;1:42-45]. A phenotype-genotype correlation is discussed, and the description of a novel rare microdeletion entity is raised.
RESUMO
BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.
Assuntos
Alelos , Testes Genéticos , Genótipo , Mutação INDEL/genética , Proteína 2 de Ligação a Metil-CpG/genética , Fenótipo , Síndrome de Rett/genética , Adolescente , Criança , Pré-Escolar , Deleção Cromossômica , Éxons/genética , Feminino , Humanos , Deficiência Intelectual/diagnóstico , Deficiência Intelectual/genética , Líbano , Polimorfismo Genético/genética , Síndrome de Rett/diagnósticoRESUMO
The immunodeficiency, centromeric instability and facial anomalies (ICF) syndrome is a rare autosomal recessive disease characterized by targeted chromosome breakage, directly related to a genomic methylation defect. It manifests with phenotypic and clinical variability, with the most consistent features being developmental delay, facial anomalies, cytogenetic defects and immunodeficiency with a reduction in serum immunoglobulin levels. From the molecular point of view, ICF syndrome was always divided into ICF type I (ICF1) and ICF type 2 (ICF2). Mutations in DNMT3B gene are responsible for ICF1, while mutations in ZBTB24 have been reported to be responsible for ICF2. In this study, we describe a Lebanese family with three ICF2 affected brothers. Sanger sequencing of the coding sequence of ZBTB24 gene was conducted and revealed a novel deletion: c.396_397delTA (p.His132Glnfs*19), resulting in a loss-of-function of the corresponding protein. ZBTB24 belongs to a large family of transcriptional factors and may be involved in DNA methylation of juxtacentromeric DNA. Detailed molecular and functional studies of the ZBTB24 and DNMT3B genes are needed to understand the pathophysiology of ICF syndrome.
Assuntos
Síndromes de Imunodeficiência/genética , Proteínas Repressoras/genética , Adolescente , Adulto , Sequência de Aminoácidos , Criança , Pré-Escolar , Aberrações Cromossômicas , Cromossomos Humanos/genética , DNA (Citosina-5-)-Metiltransferases/genética , Metilação de DNA , Análise Mutacional de DNA , Face/anormalidades , Face/patologia , Feminino , Deleção de Genes , Testes Genéticos/métodos , Humanos , Síndromes de Imunodeficiência/patologia , Líbano , Masculino , Dados de Sequência Molecular , Mutação , Linhagem , Doenças da Imunodeficiência Primária , DNA Metiltransferase 3BRESUMO
We report on a 10.5-year-old girl with a mild form of campomelic dysplasia. She presented with short stature of prenatal onset, dysmorphic facial features, limitation of supination and pronation of the forearms, dysplastic nails, and bone abnormalities consisting especially of cone-shaped epiphyses of the middle phalanx of the 2nd fingers, brachydactyly and clinodactyly of the middle phalanx of both 5th fingers, short 4th metacarpals, radial and femoral head subluxation, hypoplastic scapulae, humeral and ulnar epiphyseal abnormalities, unossified symphysis pubis, and a significant delay in bone age. Molecular analysis of the SOX9 gene revealed the presence of a de novo missense mutation: p.P170L (c.509C>T). Mild and surviving cases of campomelic dysplasia are reviewed.
RESUMO
Haemophilia A (HA) is an X-linked recessive hereditary bleeding disorder affecting one in 5000 men, resulting from mutations in the F8 gene. Our objective was to identify the spectrum of mutations of the F8 gene in Lebanese patients, and to perform genotype/phenotype correlations. A group of 79 HA patients from 55 unrelated families was studied. Patients were screened for intron 22 and intron 1 inversion using PCR. In the absence of mutations in both introns, a dHPLC screening followed by a DNA sequencing of all coding regions was performed. When patients presented novel mutations, 150 control chromosomes were tested to exclude common polymorphisms. Large deletions were confirmed by MLPA technique. The mRNA was specifically studied whenever a splice site mutation was detected. In addition, studies of the putative biochemical function and FVIII 3D structures were conducted. Thirty-four mutations were identified in this study of which 21 were novel: 11 missense, two nonsense, two splice sites, five small deletions and one large deletion. Inhibitor found in three over 75 patients correlated with large deletion, intron 22 inversion, and nonsense mutations. We were able to identify all causative mutations in those HA patients. This knowledge represents a huge step for genetic counselling.