Combining transcriptome and metabolome analysis to understand the response of sorghum to Melanaphis sacchari.

BACKGROUND: The sorghum aphid Melanaphis sacchari (Zehntner) (Homoptera: Aphididae) is an important insect in the late growth phase of sorghum (Sorghum bicolor L.). However, the mechanisms of sorghum response to aphid infestation are unclear. RESULTS: In this paper, the mechanisms of aphid resistance in different types of sorghum varieties were revealed by studying the epidermal cell structure and performing a transcriptome and metabolome association analysis of aphid-resistant and aphid-susceptible varieties. The epidermal cell results showed that the resistance of sorghum to aphids was positively correlated with epidermal cell regularity and negatively correlated with the intercellular space and leaf thickness. Transcriptome and metabolomic analyses showed that differentially expressed genes in the resistant variety HN16 and susceptible variety BTX623 were mainly enriched in the flavonoid biosynthesis pathway and differentially expressed metabolites were mainly related to isoflavonoid biosynthesis and flavonoid biosynthesis. The q-PCR results of key genes were consistent with the transcriptome expression results. Meanwhile, the metabolome test results showed that after aphidinfestation, naringenin and genistein were significantly upregulated in the aphid-resistant variety HN16 and aphid-susceptible variety BTX623 while luteolin was only significantly upregulated in BTX623. These results show that naringenin, genistein, and luteolin play important roles in plant resistance to aphid infestation. The results of exogenous spraying tests showed that a 1‰ concentration of naringenin and genistein is optimal for improving sorghum resistance to aphid feeding. CONCLUSIONS: In summary, the physical properties of the sorghum leaf structure related to aphid resistance were studied to provide a reference for the breeding of aphid-resistant varieties. The flavonoid biosynthesis pathway plays an important role in the response of sorghum aphids and represents an important basis for the biological control of these pests. The results of the spraying experiment provide insights for developing anti-aphid substances in the future.

First report of the maize cyst nematode Heterodera zeae in Sichuan Province of Southwest China.

Maize is the largest crop planted in China. Nine species of cyst nematodes have been reported to affect maize production. Heterodera zeae, H. avenae and Punctodera chalcoensis can cause significant maize yield losses annually (Luc et al. 2005). In 1971, the maize cyst nematode H. zeae was first detected in Rajasthan, India (Koshy et al. 1971). Subsequently, it has been reported in many other countries such as the United States, Greece, Pakistan, and Egypt. In China, H. zeae was first identified in the maize fields of Laibin City, Guangxi Zhuang Autonomous Region (Wu et al., 2017). Cui et al. (2020) identified H. zeae in a maize field of Yuzhou City, Henan Province of Central China in 2018. From 2018 to 2022, a survey of cyst-forming nematodes was conducted in Southwest China. Fifteen soil samples of about 500 g each were collected from Luding County, Ganzi Prefecture of Sichuan Province. No major aboveground symptoms were shown on maize, but a few females were observed on the roots of maize in one field. The cysts and second-stage juveniles (J2s) were collected from each soil sample using Cobb's screening gravity method. A total of 8.50±2.0 cysts per 100 ml of soil on the average were observed in the field. A thin subcrystalline layer was discernible only in young cysts. Morphological and molecular studies of cysts and J2s indicated that the nematodes were identified to be H. zeae in a maize-field. Morphologically, the cysts were in a lemon shape, light brown or pearly white in color. The vulval cone was prominent. Fenestra ambifenestrate, and semifenestra were separated by a fairly wide vulval bridge, fenestral length and width were variable, and the cyst wall was shown in a zigzag pattern. The J2s' body was in a vermiform, tapering at both ends, with a hyaline tail. Stylet was strongly developed with round or slightly anteriorly directed knobs. Morphological measurements of the cysts (n = 9) determined that the mean body length was 417.2 µm (403.6 to 439.4 µm), body width was 429.7 µm (397.6 to 456.9µm); length-width ratio was 1.4 (0.75 to 3); fenestra length was 525.3 µm (498.5 to 570.7 µm); and the mean semifenestra width was 458.6 µm (403.6 to 546.3 µm). Morphometric measurements of second-stage juveniles (n = 20) showed a body length of 419.7µm (355.8 to 492.5 µm); a stylet length of 20.8 µm (19.51 to 23.3µm); a tail length of 41.5 µm (20 to 49.4 µm); and a hyaline tail length of 20.7 µm (16.6 to 24 µm). The main morphological characteristics and measured values were basically consistent with those described by Cui et al. (2022), and all of which were similar to those of H. zeae. Amplification of DNA from random single cysts (n = 5) was conducted using the protocol described by Cui et al. (2022). The rDNA-internal transcribed spacer (ITS) was amplified and sequenced using a pair of universal primers TW81 (5'-GTTTCCGTAGGTGAA CCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3'). The ITS sequences were deposited at GenBank with the accession number OR811029.1. Alignments of sequences showed an identity of 98% with H. zeae sequences from China (OP692769.2, MW785772.1) and the USA (GU145616.1), which were confirmed using a pair of species-specific primers HzF1 (5'-GGGGAGGTGAATGTGGG-3') and HzR1 (5'-CCTTTGGCAATCGGTGA-3') of H. zeae with a targeted PCR fragment of 393 bp (Cui et al. 2022). Pathogenicity was conducted and confirmed by infection and reproduction on maize. Seeds (cv. Zhengda 619) were sown in three pots that contained 150 ml of a sterile soil mixture (loamy soil: sand=1:1), and 5 cysts (103 eggs/cyst on the average) were inoculated in each pot at 25/30°C, under a 12-h dark/12-h light condition (Cui et al. 2023). Fifteen days after sowing, third- and fourth-stage juveniles were observed in the rootstained with acid fuchsin, and a total of 32 cysts per maize plant on the average were collected at 40 days after sowing. The new cysts' morphological and molecular characteristics were identical to the cysts from the original soil samples. To the best of our knowledge, this is the first report of H. zeae as a pathogen on maize in Sichuan Province, Southwest China. Our findings will be useful for management and further research of maize cyst nematodes.

Identification and biological characterization of a new cyst nematode, Heterodera glycines sbsp.n. tabacum, parasitizing tobacco in China.

In an investigation of diseases from plant-parasitizing nematodes in Henan Province, a cyst nematode was found on tobacco roots and in rhizosphere soil. We identified this strain as a new cyst nematode subspecies, Heterodera glycines sbsp.n. tabacum. The cysts and second-stage juveniles (J2) parasitizing Henan tobacco were larger than those of Heterodera glycines. A single 345-bp fragment was amplified from H. glycines sbsp.n. tabacum, whereas the 345-bp and 181-bp fragments were amplified from the soybean cyst nematode. Thus, H. glycines sbsp.n. tabacum was different from that of H. glycines. There were base transversions at 504 sites and base transitions at 560, 858, 920 and 921 sites in the rDNA-ITS sequences of H. glycines sbsp.n. tabacum compared with H. glycines, and there were base transitions at 41, 275, 278, and 380 sites in the mtDNA-COI sequences. In the phylogenetic tree based on the rDNA-ITS and mtDNA-COI regions, H. glycines sbsp.n. tabacum plants were clustered on a single branch. Based on the RAPD technique, SCAR-PCR primers were designed. A single 1113-bp fragment was amplified by specific primers (HtF1/HtR1) from H. glycines sbsp.n. tabacum, while no fragments were obtained from H. glycines. The Heterodera glycines sbsp.n. tabacum can infect soybean plants but cannot complete its life cycle. Eleven tested tobacco cultivars were infected, with an average Rf of 9.74 and a maximum of 64.2 in K326. The cumulative egg hatching rate of H. glycines sbsp.n. tabacum plants in the presence of tobacco root exudates was 42.6% at 32 days posthatching, which was significantly greater than that in the presence of soybean root exudates (30.3%) and sterile water (33.1%). In summary, the cyst nematode population parasitizing Henan tobacco was identified as a new subspecies, H. glycines sbsp.n. tabacum.

Key Roles of Conjunctiva Fornix-Bulbar Conjunctiva-Tenon Capsule in Conjoint Fascial Sheath Suspension.

BACKGROUND: Bulbar conjunctival prolapse is one of the complications of conjoint fascial sheath (CFS) suspension and has a negative impact on surgical results. To explore the prevention methods of this complication, the authors compared the incidence of it between the below-conjunctiva fornix-bulbar conjunctiva-Tenon capsule (CBT) approach and the above-CBT approach to dissecting CFS in CFS suspension and shared their experience in the treatment of bulbar conjunctival prolapse. METHODS: From January of 2020 to August of 2021, 81 patients with severe congenital ptosis who underwent CFS suspension were enrolled and divided into two groups. Forty-five patients' (group A) CFS was dissected by means of the below-CBT approach and 36 patients' (group B) CFS was dissected by means of the above-CBT approach. Data regarding the incidence and outcomes of bulbar conjunctival prolapse and the postoperative condition were collected and analyzed. RESULTS: The incidence of bulbar conjunctival prolapse was 24.44% in group A and 2.78% in group B. Of the 12 bulbar conjunctival prolapse patients, seven patients' conditions improved after conservative treatment, and five did not. All of them underwent bulbar conjunctiva resection within 1 year and were cured. No recurrent prolapse was observed within 3 months postoperatively. At the last follow-up, the mean marginal reflex distance 1 and palpebral fissure height were 4.09 ± 0.19 mm and 9.85 ± 0.62 mm, respectively. There were no complications except lagophthalmos (16 eyelids), asymmetric eyelid contour (one patient), and trichiasis (two eyelids). CONCLUSIONS: The incidence of bulbar conjunctival prolapse decreased significantly by dissecting CFS by means of the above-CBT approach. For patients with bulbar conjunctival prolapse after CFS suspension, bulbar conjunctiva resection could provide satisfactory results. CLINICAL QUESTION/LEVEL OF EVIDENCE: Therapeutic, IV.

First record of cyst nematode (Heterodera filipjevi) on winter wheat from Shanxi Province in North China.

Heterodera avenae, H. filipjevi, and H. laptipons are considered to be the major cyst nematode pathogens affecting most cereals and causing severe crop losses (Smiley and Yan 2015). In China, H. filipjevi was first recorded in Xuchang, Henan Province (Peng et al. 2010). Recently, H. filipjevi has been found in Anhui, Hebei, Shandong and Xinjiang provinces of China (Cui et al. 2021). To further understand the latest occurrence and distribution of H. filipjevi in China, a survey of cyst nematodes was conducted in the wheat planting area of Shanxi Province of North China from June 2018 to November 2020. White female cysts (5.8 ± 2.99 cysts per plant) were found on wheat roots in the sandy soil, and wheat was displaying symptoms of dwarfing, yellowing, and had few tillers in Licheng of Changzhi (N36°32´010´´, E113°27´039´´; N36°29´050´´, E113°23´023´´; N36°29´035´´, E113°22´020´´) and Zezhou of Jincheng (N35°33´057´´, E112°56´020´´) in Shanxi Province, and second-stage juveniles (J2s) were obtained from 13 soil samples using the sieving-decanting method. Four of the 13 samples were identified as H. filipjevi on the basis of morphological and molecular studies of female cysts and J2s. Morphologically, the cysts were lemon shaped and featured a pronounced vulval cone. The color ranged from light to dark brown. The white female shell was covered with a white crystalline layer. The vulval cone was bifenestrate with horseshoe-shaped bullae numerous and distinct, and a strongly developed underbridge. The main measurements (mean ± SD, range) of cysts (n = 13) were as follows: body length including neck 780.5 ± 53.9 µm (692 to 843 µm); body width 527.3 ± 55.5 µm (435 to 620 µm); length/width ratio 1.50 ± 0.21 (1.20 to 1.93); fenestra length 55.5 ± 4.1 µm (49 to 61 µm); fenestra width 24.8 ± 2.2 µm (21.1 to 28.8 µm); vulval slit length 9.0 ± 0.7 µm (7.8 to 9.6 µm); and underbridge length 66.8 ± 5.0 µm (61 to 77 µm). The measurements of J2s (n = 13) were as follows: body length 554.4 ± 23.4 µm (520to 587 µm); stylet length 22.7 ± 0.7 µm (21.5 to 23.8 µm); tail length 61.0 ± 5.5 µm (51.2 to 68.9 µm); and hyaline tail terminus length 37.3 ± 2.7 µm (33.4 to 42.3 µm). These morphological measurements are within the range characteristic of H. filipjevi (Peng et al. 2010). Genomic DNA was extracted from individual cyst (n = 6) and the rDNA internal transcribed spacer (ITS) sequence was amplified using the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR test for each sample was repeated five times. The obtained ITS sequences (GenBank accession No. OQ421499 to OQ421502, 1054 bp) showed more than 99.5% similarity to those of H. filipjevi from the United States (GU079654 and KP878490), Turkey (KR704304 and KR704292), and China (MW789611, KY448473 and KT314234). The results were confirmed again by the species-specific primers HfF1 and HfR1of H. filipjevi and the target PCR fragments of 646 bp were obtained (Peng et al. 2013). The pathogenicity of H. filipjevi was verified by infesting winter wheat (Triticum aestivum 'Wenmai 19') and studying nematode developmentand reproduction with growth chamber (Cui et al. 2015). Eggs were hatched at 14-16°C, and freshly hatched J2s were used to inoculate wheat plants when the roots were approximately 1-centimeter long. Fifteen wheat plants were inoculated with 200 J2s, and three wheat plants without J2s were set as controls (Cui et al. 2021). Parasitic J2s and third- and fourth-stage juveniles were found in roots stained with acid fuchsin at 5, 15, and 25 days after inoculation (DAI), adult females were detected at 50 DAI, and a mean of 23.7 cysts per pot were extracted at 70 DAI (Cui et al. 2015). The morphological and molecular characteristics of the new cysts were identical to those of the H. filipjevi cysts from the original field samples, and no cysts formed in the control groups. Wheat is the main food and economic crop in Shanxi, and H. filipjevi, a potential threat to cereal crop production in Shanxi, should arouse sufficient attention. H. filipjevi is major cyst nematode pathogens of wheat and shows high prevalence in China. The loss of wheat production due to H. filipjevi is as high as 32.3% when the initial density ≥ 64 eggs/mL in soil (Li 2018). To the best of our knowledge, this is the first report of H. filipjevi in Shanxi Province of North China.

Bv8 mediates myeloid cell migration and enhances malignancy of colorectal cancer.

Colorectal cancer (CRC) is the third most predominant malignancy in the world. Although the importance of immune system in cancer development has been well established, the underlying mechanisms remain to be investigated further. Here we studied a novel protein prokineticin 2 (Prok2, also known as Bv8) as a key pro-tumoral factor in CRC progression in in vitro and ex vivo settings. Human colorectal tumor tissues, myeloid cell lines (U937 cells and HL60 cells) and colorectal cancer cell line (Caco-2 cells) were used for various studies. Myeloid cell infiltration (especially neutrophils) and Bv8 accumulation were detected in human colorectal tumor tissue with immunostaining. The chemotactic effects of Bv8 on myeloid cells were presented in the transwell assay and chemotaxis assy. Cultured CRC cells treated with myeloid cells or Bv8 produced reactive oxygen species (ROS) and vascular endothelial growth factor (VEGF). Furthermore, ROS and VEGF acted as pro-angiogenesis buffer in myeloid cell-infiltrated CRC microenvironment. Moreover, myeloid cells or Bv8 enhanced energy consumption of glycolysis ATP and mitochondria ATP of CRC cells. Interestingly, myeloid cells increased CRC cell viability, but CRC cells decreased the viability of myeloid cells. ERK signalling pathway in CRC cells was activated in the presence of Bv8 or co-cultured myeloid cells. In conclusion, our data indicated the vital roles of Bv8 in myeloid cell infiltration and CRC development, suggesting that Bv8 may be a potential therapeutic target for colorectal cancer-related immunotherapy.

Extended Frontalis Muscle Advancement Technique for Severe Congenital Blepharoptosis.

BACKGROUND: The conventional frontalis muscle advancement technique still has some disadvantages, such as residual lagophthalmos, eyebrow ptosis, eyelid contour abnormality, and undercorrection. This article describes the authors' extended frontalis muscle advancement technique, which takes extensive subcutaneous separation through the eyelid crease incision for the treatment of severe congenital blepharoptosis. METHODS: A retrospective review was performed that included patients with severe congenital ptosis who underwent extended frontalis muscle advancement technique from April of 2019 to April of 2021. Preoperative evaluation included age, sex, and margin reflex distance 1, levator function, and lagophthalmos. Postoperative evaluation including correction result, closure function of eyelid, and cosmetic result was performed at the last follow-up. RESULTS: From April of 2019 to April of 2021, a total of 102 patients (137 eyes) who underwent extended frontalis muscle advancement technique were included in the study. The mean postoperative margin reflex distance 1 in unilateral and bilateral ptosis patients was 3.84 ± 0.60 mm and 3.86 ± 0.56, respectively, and 126 eyes (92.0%) showed successful correction. Postoperatively, the mean residual lagophthalmos was 0.88 ± 1.40 mm, and 127 eyes (92.7%) showed excellent or good eyelid closure function. The average score of cosmetic results was 8.29 ± 1.34, and 94 patients (92.2%) had an excellent or good cosmetic result. CONCLUSIONS: Extensive subcutaneous separation relieves the mutual restriction between the forehead skin and frontalis muscle. The extended frontalis muscle advancement technique is effective in correcting severe congenital ptosis, and minimizes undercorrection, residual lagophthalmos, eyelid contour abnormality, and eyebrow ptosis. CLINICAL QUESTION/LEVEL OF EVIDENCE: Therapeutic, IV.

Effects of chemical fertilizer reduction and organic fertilizer substitution on yield and quality of Saposhnikovia divaricata / 中国中药杂志

To explore the suitable fertilizing pattern for Saposhnikovia divaricata in the genuine producing area, a field trial was carried out to investigate the changes in the yield and quality of medicinal materials and soil in different fertilization patterns, such as organic fertilizer substitution(organic fertilizer+NPK fertilizer) and chemical fertilizer reduction(organic fertilizer+NPK fertilizer decrement and organic fertilizer+NPK fertilizer decrement+soil conditioner). The comprehensive analysis of all treatments was based on the medicine quality evaluation data set and soil quality evaluation data set, respectively, by CRITIC weight method. The results showed that(1) the yield of S. divaricate increased by 4.93%-12.67% under the organic fertilizer substitution mode, and the yield increased by 44.43% under the treatment of chemical fertilizer reduction YHT15, which was higher than that of the organic fertilizer substitution mode.(2) The quality of S. divaricate under the two fertilization modes was superior to the standard in the Chinese Pharmacopoeia, and the application of biochar was helpful to improve the quality of S. divaricate quality, with an increase of 82.83%-181.54%. CRITIC method analysis showed that fertilization treatments with high comprehensive scores were YHT15, YH30, and YH15.(3) Soil quality under the two fertilization modes was higher than that under the control. The fertilization treatments with higher comprehensive scores of soil quality were YHT15, YHT30, and YHT. The fertilization mode of adding biochar as soil conditioner, applying an appropriate amount of organic fertilizer, and reducing part of chemical fertilizer is the appropriate way to develop ecological plantation of S. divaricata in the Baicheng area in the western Jilin province. The specific fertilization mode is as follows. The basic fertilizer was 361 kg·hm~(-2) superphosphate+110 kg·hm~(-2) potassium sulfate+82 kg·hm~(-2) organic fertilizer+10 000 kg·hm~(-2) rice husk biochar, and urea was applied as top fertilizer three times, 29, 29, and 20 kg·hm~(-2), respectively.

Natural Mediterranean Spotted Fever Foci, Qingdao, China.

We sequenced DNA from spleens of rodents captured in rural areas of Qingdao, East China, during 2013-2015. We found 1 Apodemus agrarius mouse infected with Rickettsia conorii, indicating a natural Mediterranean spotted fever foci exists in East China and that the range of R. conorii could be expanding.

Predictive value of Leukocyte ImmunoTest (LIT™) in cancer patients: a prospective cohort study.

Early diagnosis of cancer is crucial to initiate prompt treatment for better patient outcomes. The host immune function and its associated modulators are considered to be potential biomarkers for early cancer diagnosis. Immune and immune-checkpoint biomarkers have been reported to contribute to cancer development, while a high neutrophil-to-lymphocyte ratio has been shown to be associated with poor survival outcomes in a variety of cancers. One hundred sixty-one cancer patients were recruited to take a cost-effective novel Leukocyte ImmuneTest (LIT). LIT was measured to objectively determine the pre-treatment immune status of patients. The correlation between LIT and other conventional diagnostic markers or tumor-related variables was then investigated. Significant correlations between LIT and white blood cell count, smoking status, and tumor stage 4 were found. In addition, the LIT score significantly differentiated between malignant and benign tumors in this study population. Our work raises the possibility to use LIT for general screening surveillance before further costly specialized equipment is applied for cancer diagnosis.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±â€¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0  ±â€¯ 28.6 µm (329.7 to 436.1 µm); stylet length  =  17.0  ±â€¯ 1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±â€¯ 0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±â€¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±â€¯ 1.0 (26.7 to 30.4); stylet length =  10.3  ±â€¯ 0.6 µm (9.1 to 11.2 µm); DGO  =  2.4  ±â€¯ 0.1 µm (2.1 to 2.6 µm); and tail length  =  49.3  ± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.

Simultaneous Double Eyelid Blepharoplasty and Blepharoptosis Correction With Levator Aponeurosis Plication Technique: Clinical Experience of 108 Cases.

BACKGROUND: Fifty percent of Asians are born without a supratarsal fold (also called single eyelid), and double eyelid blepharoplasty is one of the most commonly performed and most popular facial cosmetic surgeries in the Asian population. However, patients with single eyelid frequently present with concomitant mild blepharoptosis (degree of ptosis, ≤2 mm), which often fails to cause the attention of surgeons and misses correction. METHODS: A retrospective study of all patients who underwent double eyelid blepharoplasty and blepharoptosis correction simultaneously with the modified levator aponeurosis plication technique was performed from June of 2017 to June of 2020. RESULTS: A total of 108 patients (155 eyelids) underwent double eyelid blepharoplasty and blepharoptosis correction simultaneously with the modified levator aponeurosis plication technique and were enrolled in the study. The average follow-up period was 11.8 ± 4.5 months. There was a statistically significant difference between the preoperative margin reflex distance 1 (MRD1) and postoperative MRD1 (2.93 ± 0.37 vs 4.21 ± 0.39 mm, P = 0.000), and the mean MRD1 improvement was 1.28 ± 0.50 mm. Sufficient correction was obtained in 148 eyelids (95.5%), whereas undercorrection was observed in 5 eyelids (3.2%) and overcorrection was observed in 2 eyelids (1.3%). One hundred two patients (94.4%) were completely satisfied with the final result.All patients had smooth and elegant upper eyelid margin curve, and no patients complained of distortion of the eyelid margin contour and foreign body sensation.There were no cases of hematoma, infection, suture exposure, corneal abrasion, and keratitis in any patient. CONCLUSIONS: This modified levator aponeurosis plication introduced in this study is a simple and effective method for creating double-eyelid crease and correcting mild blepharoptosis simultaneously, and provides a satisfactory outcome. As such, we recommend this method in treating patients with both single eyelid and mild blepharoptosis.

Aesthetic Changes of Brow-Eyelid Continuum After Correction of Moderate-Severe Blepharoptosis with Conjoint Fascial Sheath Suspension.

BACKGROUND: As periorbital aesthetic commonly improved in blepharoptosis patients after correction surgery, the aim of this study was to elaborate the brow-eyelid continuum changes in moderate-severe ptosis patients who underwent conjoint fascial sheath suspension systematically. METHODS: Patients with moderate-severe ptosis who underwent conjoint fascial sheath suspension were assessed by using pre- and post-operative digital photographs in the primary gaze position of the eye. The main outcome measurements included marginal reflex distance1 (MRD1), palpebral fissure height (PFH), eyebrow position, the symmetry of face and the horizontal forehead lines condition. RESULTS: There were 43 patients (53 eyelids) in our study, including 33 unilateral and 10 bilateral patients. The mean levator function was 3.00 ± 1.07 mm. Before surgery, the mean MRD1 and PFH were 0.60 ± 1.14 mm and 6.75 ± 1.71 mm, respectively. The mean eyebrow height at medial, center, lateral position was 33.16 ± 3.95 mm, 35.99 ± 4.02 mm and 34.35 ± 4.80 mm, respectively. It was found that MRD1 and PFH symmetry both were 23.26% and eyebrow symmetry was 62.79%. For forehead wrinkles, 48.84% of the patients was mild, 34.88% was moderate, and 16.28% was severe. The average follow-up was 12.78 months (ranged from 12 to 18 months). One month after surgery, the mean MRD1 and PFH were 5.68 ± 0.86 mm, 11.61 ± 0.97 mm, respectively, both of which improved significantly (P < 0.0001). The mean eyebrow height at medial, center, lateral position descended to 28.22 ± 4.77 mm (P = 0.017), 31.41 ± 4.58 mm (P = 0.033) and 30.28 ± 3.41 mm (P = 0.018), respectively. The result showed that the rate of patients with MRD1 symmetry was 32.56%, PFH symmetry was 30.23%, and eyebrow symmetry was 90.7%. For forehead wrinkles, 69.77% was mild and 30.23% was moderate. Then, patients' eyebrow gradually elevated, while their upper eyelid dropped. At the last follow-up, the mean MRD1 and PFH were 3.83 ± 0.98 mm and 9.84 ± 1.56 mm, respectively. The mean eyebrow height at medial, center, lateral position improved to 30.52 ± 4.59 mm (P = 0.031), 32.40 ± 4.68 mm (P = 0.033), 31.19 ± 4.16 mm (P = 0.028), respectively. The patients with MRD1 symmetry accounted for 86.05%, PFH symmetry 86.05%, and eyebrow symmetry 90.7%. For forehead wrinkles, 67.44% was mild and 32.56% was moderate. CONCLUSION: CFS suspension can effectively reconstruct moderate-severe ptosis patients' aesthetics of the brow-eyelid continuum by descending elevated eyebrow, improving facial symmetry and reducing forehead rhytids. LEVEL OF EVIDENCE IV: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

First record of Aphelenchoides besseyi on foxtail millet (Setaria italica) in Henan Province of China.

Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027″ and E113° 39' 059″) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.

Conjoint Fascial Sheath Suspension for Correction of Recurrent Blepharoptosis.

BACKGROUND: Blepharoptosis is defined as an abnormally low-positioned upper eyelid margin in the primary gaze position, which results in cosmetic discomfort and functional visual dysfunction. Recurrence is one of the common complications after ptosis correction and requires further revision. Conjoint fascial sheath (CFS) suspension has become increasingly popular for ptosis. In this article, we described our experience of CFS suspension in the treatment of recurrent blepharoptosis and evaluated the postoperative outcomes so as to guide the clinical application of CFS suspension. METHODS: Thirty-eight patients (48 eyelids) who had recurrent blepharoptosis and received CFS suspension were included in this study. Before the surgery, the degree of ptosis and levator function were assessed. The postoperative evaluation consisted of the correction effect, eyelid symmetry, protective closure function of eyelid, and surgical complications. RESULTS: At the final follow-up, 46 eyelids (95.8%) showed an ideal correction, of which 24 eyelids (50%) showed sufficient correction and 22 eyelids (45.8%) showed normal correction. The remaining 2 eyelids (4.2%) showed under-correction. Among all 38 patients, 26 patients (68.4%) achieved good symmetry, and 10 patients (26.3%) achieved fair symmetry, while only 2 patients (5.3%) showed poor symmetry. Recovery time of eyelid protective closure function was 3.9 ± 1.04 months (range, 2.5-6 months). There were no complications except residual lagophthalmos (9 eyelids) residual conjunctival prolapse (10 eyelids). CONCLUSION: CFS suspension is an effective method for the correction of recurrent blepharoptosis due to its sufficient correction effect, recovery of eyelid protective closure function, and less complication rate. LEVEL OF EVIDENCE IV: This journal requires that authors assign a level of evidence to each article. For a full description of these Evidence-Based Medicine ratings, please refer to the Table of Contents or the online Instructions to Authors www.springer.com/00266 .

Effect of Sinisan on NLRP3 Inflammasomes and Depression-like Behaviors in Depressed Rats / 中国实验方剂学杂志

ObjectiveTo observe the effects of Sinisan on behaviors and NOD-like receptor protein 3 （NLRP3） inflammasomes of depressed rats induced by chronic unpredictable mild stress （CUMS） and further explore the anti-depressant mechanism of Sinisan. MethodFifty male rats were randomly divided into a normal group， a model group， an NLRP3 inhibitor （MCC950） group （10 mg·kg-1）， and low- （2.5 g·kg-1） and high-dose （5 g·kg-1） Sinisan groups， with 10 rats in each group. The depression model was induced by 42 d CUMS in rats except for those in the normal group. Drug intervention was performed on the 22nd day of modeling by gavage in the Sinisan groups and by intraperitoneal injection in the MCC950 group. Except for the MCC950 group， the remaining four groups received 10 mg·kg-1 physiological saline by intraperitoneal injection， while the rats in the model group， the normal group， and the MCC950 group were administered with 3 mL of physiological saline by gavage. Twenty-one days later， the sucrose preference test and open field test were performed. Western blot was used to detect the protein expression of NLRP3， apoptosis-associated speck-like protein containing a CARD （ASC）， cysteinyl aspartate-specific protease-1 （Caspase-1）， B-cell lymphoma-2 （Bcl-2）， Bcl-2 associated X protein （Bax）， ionized calcium-binding adapter molecule 1 （Iba1）， and CD68 in the hippocampus of rats in each group. Enzyme-linked immunosorbent assay （ELISA） was used to detect the levels of interleukin-1β （IL-1β） and interleukin-18 （IL-18） in the hippocampus of rats. Nissl staining and TUNEL were used to assess the pathological changes and apoptosis level in the hippocampal CA1 region of rats， respectively. ResultThe sucrose preference rate and consumption volume in the sucrose preference test， the total distance， the percentage of central movement distance， and the percentage of residence time in the open field test of rats in the model group were lower than those in the normal group （P<0.01）. Compared with the model group， the Sinisan groups and the MCC950 group showed improved depression-like behaviors， apoptosis level in the hippocampal CA1 region， and neuron loss to varying degrees. Sinisan could reduce the levels of IL-1β， IL-18， Bax， Iba1， and CD68 in the hippocampus （P<0.05， P<0.01）， increase the level of Bcl-2 （P<0.05， P<0.01）， and inhibit the protein expression of NLRP3， ASC， and Caspase-1 related to NLRP3 inflammasomes （P<0.05， P<0.01）. ConclusionSinisan can improve the depression-like behaviors and pathological damage of hippocampal neurons in CUMS-induced rats， and the mechanism may be related to the inflammatory response mediated by the NLRP3 inflammasome signaling pathway.

Abdominal cocoon sign: an unusual cause of intestinal obstruction.

A 46-year-old male patient came to the gastroenterology department with recurrent abdominal pain, distension, and delayed defecation. Also, three bowel obstructions had occurred within six months. He presented to his local emergency department and received intestinal dredging and antibiotic treatment. Computed tomography of the abdomen showed local dilation of the small bowel in the middle and lower abdomen, with contents visible in the lumen of the bowel. The bowels were surrounded by multiple fibrous, cable-like envelopments and thickened mesentery, as though in a cocoon.

First report of Heterodera filipjevi on winter wheat from Hebei Province in North China.

Three of the cereal cyst nematodes, Heterodera avenae, H. filipjevi and H. latipons are considered to be the most economically important cyst nematodes that affect cultivated cereals around the world. H. filipjevi was first detected in China from Xuchang, Henan Province in 2010 (Peng et al. 2010) and now has been recorded in the Central China of Henan, Shandong and Anhui provinces and the Northwest China of Xinjiang Uygur Autonomous Region (Cui et al. 2020). In June 2019, 42 samples consisting of roots and soil were collected from winter wheat fields in Hebei Province of North China. Cysts were detected in 37 soil samples with a mean of 6.4 ± 1.67 cysts per 100 ml of soil. Cysts and second-stage juveniles (J2s) were extracted from root and soil following Cobb's sieving gravity method. Morphological and molecular studies of J2s and cysts confirmed its identity with H. filipjevi in 5 samples from Handan (N36°10'052" and E114°35'056"; N36°37'054" and E114°22'052"), Xingtai (N36°53'060" and E114°30'011") and Shijiazhuang (N 37°26'048" and E 116°05'039") in Hebei Province, China. Morphologically, the cysts are lemon-shaped, light or dark brown in color. The vulval cone is bifenestrate with horseshoe-shaped semifenestrae, strongly globular bullae, and well-developed underbridge. Measurements (mean +_ sd (range)) of cysts (n=10), body length not including neck is 743.0 ± 36.1 µm (665 - 780 µm), body width is 559.0 ± 50.0 µm (455 - 639 µm), length / width ratio is 1.33 ± 0.07 (1.20 - 1.46); neck length is 99.3 ± 8.8 µm (85 - 122 µm); fenestrae length is 56.8 ± 5.0 µm (49 - 65 µm) and width is 25.5 ± 1.8 µm (21.1 - 27.8 µm); underbridge length is 84.0 ± 8.1 µm (62 - 93 µm); and vulval slit length is 8.6 ± 0.5 µm (7.2 - 9.1 µm). Measurements of J2s (n = 12), body length is 541 ± 11.4 µm (490 - 578 µm); stylet length is 22.3 ± 0.5 µm (22.0 - 25.0 µm) with anchor-shaped basal knobs; tail length is 57.7 ± 3.7 µm (52.7 - 65.2 µm), and hyaline tail terminal length is 36.5 ± 2.8 µm (32 - 39.8 µm). The tail had a sharp terminus. Morphology of the cysts and J2s were consistent with the record of H. filipjevi (Peng et al. 2010; Subbotin et al. 2010). The amplifications of rDNA-internal transcribed spacer (ITS) fragments were generated with a PCR fragment of 1054 bp from single cysts of each population, using primers TW81 and AB28 (Joyce et al. 1994). The PCR tests for each sample were repeated five times. The PCR product was purified and sequenced. All nucleotide sequences of ITS-rDNA were submitted to GenBank under accession numbers MW282843-6. Sequences from the ITS region were more than 99.5% identical to those of H. filipjevi from Egypt (KF225725), Turkey (KR704308, KR704293 and MN848333) and China (KT314234, MT254744 and KY448473). These results from ITS supported its identity as H. filipjevi. The results were also confirmed by species specific sequence characterized amplified region primers of H. filipjevi (Peng et al. 2013). Pathogenicity of the H. filipjevi was confirmed by infection of winter wheat (Triticum aestivum L cv. 'Aikang58') and examination of the nematode development and reproduction. Wheat seeds were germinated in petri dishes and then transplanted into five polyvinyl chloride tubs (3 cm in diameter, 25 cm in length) that contained 150 cm3 of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 252.0 eggs/cyst). Plants were grown in an artificial climate box for one week at 14/18°C, two weeks at 16/20°C, five weeks at 18/25°C and two weeks at 22/30°C, under 8 h of darkness/16 h light and normal culturing practices (Cui et al. 2015). The parasitic J2s, third and fourth-stage juveniles, and adult females were observed in roots stained with acid fuchsin at 10, 20, 30, and 50 days after inoculation (DAI), and an average of 32.0 cysts per tubes were extracted 70 DAI. The new cyst' morphological and molecular characteristics were identical to the H. filipjevi cysts from the original soil samples. Three other tubes without cysts were set as control and there were no newly formed cysts. Heterodera avenae and H. filipjevi had been detected in a total of 16 wheat-producing provinces in China, which resulted in losses of 1.9 billion CNY year-1 (Cui et al. 2015). To our knowledge, this is the first report of H. filipjevi in Hebei Province of North China. Cereal cyst nematodes are easily transferred to non-infested areas by many avenues, resulting in increased species and pathotype complexity (Cui et al. 2020). Once H. filipjevi continues to spread in main wheat producing area of China, it could become be a new threat to cereals production. It is time to take effective control methods to prevent H. filipjevi further dispersal, especially through the farming machinery transmission. Hebei Province is one of the most important major grain-producing areas, our findings will be very beneficial for H. filipjevi management and further research on winter wheat in Hebei Province, North China.

In Situ TEM Study on Conversion-Type Electrodes for Rechargeable Ion Batteries.

Conversion-type materials have been considered as potentially high-energy-density alternatives to commercially dominant intercalation-based electrodes for rechargeable ion batteries and have attracted tremendous research effort to meet the performance for viable energy-storage technologies. In situ transmission electron microscopy (TEM) has been extensively employed to provide mechanistic insights into understanding the behavior of battery materials. Noticeably, a great portion of previous in situ TEM studies has been focused on conversion-type materials, but a dedicated review for this group of materials is missing in the literature. Herein, recent developments of in situ TEM techniques for investigation of dynamic phase transformation and associated structural, morphological, and chemical evolutions during conversion reactions with alkali ions in secondary batteries are comprehensively summarized. The materials of interest broadly cover metal oxides, chalcogenides, fluorides, phosphides, nitrides, and silicates with specific emphasis on spinel metal oxides and recently emerged 2D metal chalcogenides. Special focus is placed on the scientific findings that are uniquely obtained by in situ TEM to address fundamental questions and practical issues regarding phase transformation, structural evolution, electrochemical redox, reaction mechanism, kinetics, and degradation. Critical challenges and perspectives are discussed for advancing new knowledge that can bridge the gap between prototype materials and real-world applications.

Bushen Huoxue Prescription Replenishes Diminished Ovarian Reserve in Rats Through PI3K/Akt/mTOR Signaling Pathway / 中国实验方剂学杂志

Objective:To explore the mechanism of Bushen Huoxue prescription in regulating the related factors in phosphatidylinositol 3-kinase （PI3K）/ protein kinase B （Akt）/ mammalian target of rapamycin （mTOR） pathway and improving ovarian reserve function of rats with diminished ovarian reserve （DOR）. Method:Sixty DOR model rats were duplicated by Ataya method （intraperitoneal injection of cyclophosphamide） and then randomized into the model group， estradiol valerate （0.000 9 g·kg^-1） group， and high- （33 g·kg^-1）， middle- （16.5 g·kg^-1） and low-dose （8.25 g·kg^-1） Bushen Huoxue prescription groups， with 12 rats in each group. Another 12 healthy rats were classified into the blank control group. The rats in each group were given the corresponding drugs by gavage， while those in the blank control group and model group received the same volume of normal saline， once per day， for 14 successive days. After treatment， the ovarian tissue was stained with hematoxylin-eosin （HE） for observing the changes in quantities of primary follicles， mature follicles， and total follicles under a light microscope， followed by the detection of vascular endothelial growth factor （VEGF） expression in the ovarian tissue by immunohistochemistry. The protein expression levels of PI3K， Akt， mTOR， and cysteine-dependent aspartate-directed protease-3 （Caspase-3） in the ovarian tissue were assayed by Western blot， whereas the mRNA expression levels of PI3K， Akt， and mTOR were measured by Real-time polymerase chain reaction （Real-time PCR）. Result:As revealed by comparison with the blank control group， the quantities of mature follicles and total follicles in the ovarian tissue of model group were significantly reduced （<italic>P</italic><0.05， <italic>P</italic><0.01）. The protein expression levels of VEGF and Caspase-3 in the ovarian tissue were increased （<italic>P</italic><0.05）， while the protein and mRNA expression levels of PI3K， Akt， and mTOR were decreased （<italic>P</italic><0.05， <italic>P</italic><0.01）. Compared with the model group， Bushen Huoxue prescription at the high and middle doses elevated the quantities of mature follicles and total follicles to varying degrees （<italic>P</italic><0.05， <italic>P</italic><0.01）， and VEGF increased most significantly in the middle-dose Bushen Huoxue prescription group （<italic>P</italic><0.05）. Caspase-3 in the low-， middle-， and high-dose Bushen Huoxue prescription groups and the western medicine group declined. The protein and mRNA expression levels of PI3K， Akt， and mTOR were up-regulated in the middle- and high-dose Bushen Huoxue prescription groups （<italic>P</italic><0.05， <italic>P</italic><0.01）， and the levels in the middle-dose Bushen Huoxue prescription group were closer to those in the blank control group. Conclusion:Bushen Huoxue prescription effectively improves the ovarian reserve function of rats with DOR and increases the number of follicles possibly by up-regulating VEGF expression in the ovarian tissue， activating the PI3K/Akt/mTOR signaling pathway， and regulating the content of Caspase-3.