First report of the maize cyst nematode Heterodera zeae in Sichuan Province of Southwest China.

Maize is the largest crop planted in China. Nine species of cyst nematodes have been reported to affect maize production. Heterodera zeae, H. avenae and Punctodera chalcoensis can cause significant maize yield losses annually (Luc et al. 2005). In 1971, the maize cyst nematode H. zeae was first detected in Rajasthan, India (Koshy et al. 1971). Subsequently, it has been reported in many other countries such as the United States, Greece, Pakistan, and Egypt. In China, H. zeae was first identified in the maize fields of Laibin City, Guangxi Zhuang Autonomous Region (Wu et al., 2017). Cui et al. (2020) identified H. zeae in a maize field of Yuzhou City, Henan Province of Central China in 2018. From 2018 to 2022, a survey of cyst-forming nematodes was conducted in Southwest China. Fifteen soil samples of about 500 g each were collected from Luding County, Ganzi Prefecture of Sichuan Province. No major aboveground symptoms were shown on maize, but a few females were observed on the roots of maize in one field. The cysts and second-stage juveniles (J2s) were collected from each soil sample using Cobb's screening gravity method. A total of 8.50±2.0 cysts per 100 ml of soil on the average were observed in the field. A thin subcrystalline layer was discernible only in young cysts. Morphological and molecular studies of cysts and J2s indicated that the nematodes were identified to be H. zeae in a maize-field. Morphologically, the cysts were in a lemon shape, light brown or pearly white in color. The vulval cone was prominent. Fenestra ambifenestrate, and semifenestra were separated by a fairly wide vulval bridge, fenestral length and width were variable, and the cyst wall was shown in a zigzag pattern. The J2s' body was in a vermiform, tapering at both ends, with a hyaline tail. Stylet was strongly developed with round or slightly anteriorly directed knobs. Morphological measurements of the cysts (n = 9) determined that the mean body length was 417.2 µm (403.6 to 439.4 µm), body width was 429.7 µm (397.6 to 456.9µm); length-width ratio was 1.4 (0.75 to 3); fenestra length was 525.3 µm (498.5 to 570.7 µm); and the mean semifenestra width was 458.6 µm (403.6 to 546.3 µm). Morphometric measurements of second-stage juveniles (n = 20) showed a body length of 419.7µm (355.8 to 492.5 µm); a stylet length of 20.8 µm (19.51 to 23.3µm); a tail length of 41.5 µm (20 to 49.4 µm); and a hyaline tail length of 20.7 µm (16.6 to 24 µm). The main morphological characteristics and measured values were basically consistent with those described by Cui et al. (2022), and all of which were similar to those of H. zeae. Amplification of DNA from random single cysts (n = 5) was conducted using the protocol described by Cui et al. (2022). The rDNA-internal transcribed spacer (ITS) was amplified and sequenced using a pair of universal primers TW81 (5'-GTTTCCGTAGGTGAA CCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3'). The ITS sequences were deposited at GenBank with the accession number OR811029.1. Alignments of sequences showed an identity of 98% with H. zeae sequences from China (OP692769.2, MW785772.1) and the USA (GU145616.1), which were confirmed using a pair of species-specific primers HzF1 (5'-GGGGAGGTGAATGTGGG-3') and HzR1 (5'-CCTTTGGCAATCGGTGA-3') of H. zeae with a targeted PCR fragment of 393 bp (Cui et al. 2022). Pathogenicity was conducted and confirmed by infection and reproduction on maize. Seeds (cv. Zhengda 619) were sown in three pots that contained 150 ml of a sterile soil mixture (loamy soil: sand=1:1), and 5 cysts (103 eggs/cyst on the average) were inoculated in each pot at 25/30°C, under a 12-h dark/12-h light condition (Cui et al. 2023). Fifteen days after sowing, third- and fourth-stage juveniles were observed in the rootstained with acid fuchsin, and a total of 32 cysts per maize plant on the average were collected at 40 days after sowing. The new cysts' morphological and molecular characteristics were identical to the cysts from the original soil samples. To the best of our knowledge, this is the first report of H. zeae as a pathogen on maize in Sichuan Province, Southwest China. Our findings will be useful for management and further research of maize cyst nematodes.

First record of cyst nematode (Heterodera filipjevi) on winter wheat from Shanxi Province in North China.

Heterodera avenae, H. filipjevi, and H. laptipons are considered to be the major cyst nematode pathogens affecting most cereals and causing severe crop losses (Smiley and Yan 2015). In China, H. filipjevi was first recorded in Xuchang, Henan Province (Peng et al. 2010). Recently, H. filipjevi has been found in Anhui, Hebei, Shandong and Xinjiang provinces of China (Cui et al. 2021). To further understand the latest occurrence and distribution of H. filipjevi in China, a survey of cyst nematodes was conducted in the wheat planting area of Shanxi Province of North China from June 2018 to November 2020. White female cysts (5.8 ± 2.99 cysts per plant) were found on wheat roots in the sandy soil, and wheat was displaying symptoms of dwarfing, yellowing, and had few tillers in Licheng of Changzhi (N36°32´010´´, E113°27´039´´; N36°29´050´´, E113°23´023´´; N36°29´035´´, E113°22´020´´) and Zezhou of Jincheng (N35°33´057´´, E112°56´020´´) in Shanxi Province, and second-stage juveniles (J2s) were obtained from 13 soil samples using the sieving-decanting method. Four of the 13 samples were identified as H. filipjevi on the basis of morphological and molecular studies of female cysts and J2s. Morphologically, the cysts were lemon shaped and featured a pronounced vulval cone. The color ranged from light to dark brown. The white female shell was covered with a white crystalline layer. The vulval cone was bifenestrate with horseshoe-shaped bullae numerous and distinct, and a strongly developed underbridge. The main measurements (mean ± SD, range) of cysts (n = 13) were as follows: body length including neck 780.5 ± 53.9 µm (692 to 843 µm); body width 527.3 ± 55.5 µm (435 to 620 µm); length/width ratio 1.50 ± 0.21 (1.20 to 1.93); fenestra length 55.5 ± 4.1 µm (49 to 61 µm); fenestra width 24.8 ± 2.2 µm (21.1 to 28.8 µm); vulval slit length 9.0 ± 0.7 µm (7.8 to 9.6 µm); and underbridge length 66.8 ± 5.0 µm (61 to 77 µm). The measurements of J2s (n = 13) were as follows: body length 554.4 ± 23.4 µm (520to 587 µm); stylet length 22.7 ± 0.7 µm (21.5 to 23.8 µm); tail length 61.0 ± 5.5 µm (51.2 to 68.9 µm); and hyaline tail terminus length 37.3 ± 2.7 µm (33.4 to 42.3 µm). These morphological measurements are within the range characteristic of H. filipjevi (Peng et al. 2010). Genomic DNA was extracted from individual cyst (n = 6) and the rDNA internal transcribed spacer (ITS) sequence was amplified using the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR test for each sample was repeated five times. The obtained ITS sequences (GenBank accession No. OQ421499 to OQ421502, 1054 bp) showed more than 99.5% similarity to those of H. filipjevi from the United States (GU079654 and KP878490), Turkey (KR704304 and KR704292), and China (MW789611, KY448473 and KT314234). The results were confirmed again by the species-specific primers HfF1 and HfR1of H. filipjevi and the target PCR fragments of 646 bp were obtained (Peng et al. 2013). The pathogenicity of H. filipjevi was verified by infesting winter wheat (Triticum aestivum 'Wenmai 19') and studying nematode developmentand reproduction with growth chamber (Cui et al. 2015). Eggs were hatched at 14-16°C, and freshly hatched J2s were used to inoculate wheat plants when the roots were approximately 1-centimeter long. Fifteen wheat plants were inoculated with 200 J2s, and three wheat plants without J2s were set as controls (Cui et al. 2021). Parasitic J2s and third- and fourth-stage juveniles were found in roots stained with acid fuchsin at 5, 15, and 25 days after inoculation (DAI), adult females were detected at 50 DAI, and a mean of 23.7 cysts per pot were extracted at 70 DAI (Cui et al. 2015). The morphological and molecular characteristics of the new cysts were identical to those of the H. filipjevi cysts from the original field samples, and no cysts formed in the control groups. Wheat is the main food and economic crop in Shanxi, and H. filipjevi, a potential threat to cereal crop production in Shanxi, should arouse sufficient attention. H. filipjevi is major cyst nematode pathogens of wheat and shows high prevalence in China. The loss of wheat production due to H. filipjevi is as high as 32.3% when the initial density ≥ 64 eggs/mL in soil (Li 2018). To the best of our knowledge, this is the first report of H. filipjevi in Shanxi Province of North China.

First report of the root-knot nematode Meloidogyne incognita on Salvia miltiorrhiza Bunge in Henan Province, China.

Salvia miltiorrhiza Bunge is an important Chinese herbal medicine, mainly used to treat cardiovascular disease. At present, the planting area of S. miltiorrhiza is near 20,000 hectares in China, mainly in Shandong, Henan, Shanxi, Shaanxi and Sichuan provinces. Root-knot nematode (Meloidogyne spp.) is one of the most devastating pathogens on S. miltiorrhiza. In November 2020, we observed that some S. miltiorrhiza plants grew poorly with smaller, fewer and chlorotic leaves and even necrosis on some middle and lower ones in a Chinese herbal medicine planting base (34° 4' 11.52'' N; 113° 25' 51.40'' E) in Yuzhou City, Henan Province, China. Furthermore, the galls and egg masses were visible on the roots of S. miltiorrhiza, which were the typical symptoms caused by root-knot nematodes. Ten samples of galled roots and rhizosphere soils were collected, bagged and taken to the lab for tests. Females and J2s were extracted from these samples. White, pear-shaped females were observed in the roots, and the average number of second-stage juveniles (J2s) was 121.5 ± 10.8 per 100 ml of soil. The perineal patterns of females showed a high dorsal arch, which was either square or trapezoid with either smooth or wavy striae and without obvious lateral lines. The main morphometrics of females (n=20, mean ± SE; range) were as follows: body length (L)  = 609.0  ±â€¯ 62.5 µm (492.4 to 716.4 µm); maximum body width (W) = 377.0  ±â€¯ 28.6 µm (329.7 to 436.1 µm); stylet length  =  17.0  ±â€¯ 1.8 µm (14.2 to 20.5 µm); and distance from dorsal esophageal gland orifice to stylet knobs (DGO) =  3.3  ±â€¯ 0.3 µm (2.8 to 3.9 µm). The J2s were in vermiform, and stylet knobs were prominent and rounded. The tail of J2s possessed a transparent area with an obtuse tip. J2s (n  =  20) were measured (mean ± SD; range) as follows: L  =  401.2  ±â€¯ 29.3 µm (358.2 to 456.1 µm); W = 14.1 ± 1.1 µm (12.5 to 16.0 µm); L/W  = 28.6  ±â€¯ 1.0 (26.7 to 30.4); stylet length =  10.3  ±â€¯ 0.6 µm (9.1 to 11.2 µm); DGO  =  2.4  ±â€¯ 0.1 µm (2.1 to 2.6 µm); and tail length  =  49.3  ± 2.8 µm (45.2 to 54.7 µm). All the key morphometrics were similar to those of the M. incognita population described by Song et al. (2019). The PCR amplifications of rDNA-internal transcribed spacer (ITS) fragments generated an amplicon of 544 bp from a single female or/and J2s (n = 22) using the universal primers M18S (5'-AACCTGCTGCTGGATCATTAC-3') and M28S (5'-GTATGCTTAAGTTCAGCG-3') (Feng et al. 2010). The PCR amplifications were repeated five times for each sample, and the products were purified and sequenced. The obtained sequnce was deposited in GenBank with Acc. No. OM304617.1. The amplified ITS region sequence was identical to those of M. incognita from India (KT869139.1) and China (MT490926.1 and MT071559.1). For confirmation, the primers species-specific for M. incognita (Inc-K14-F, 5'- GGGATGTGTAAATGCTCCTG -3' and Inc-K14-R, 5'- CCCGCTACACCCTCAACTTC -3') were further used for amplification. Expected PCR amplicon of 399 bp was acquired, which was consistent with previous report for M. incognita (Randig et al. 2002). Pathogenicity and reproduction of this M. incognita population on S. miltiorrhiza was confirmed and examined. Seeds of S. miltiorrhiza were sown in the pots filled with 200 ml of autoclaved soil mixture (loamy soil/sand, 1:1). Two weeks later, a total of 12 plants were inoculated each with 400 J2s, which were hatched from a field-derived M. incognita population. Four plants without nematode inoculation were used as the control. The plants grew in a chamber at 25/30 °C under 12-h dark/12-h light conditions. The parasitic J2s, J3s, J4s and females in roots were observed under a stereomicroscope at 5, 15 and 30 days post inoculation (dpi). At 35 dpi, an average of 98.3 ± 15.7 galls and 23.8 ± 6.9 egg masses per S. miltiorrhiza plant were counted, and the root gall index reached 6 according to the 0-10 RKN rating scale (Poudyal et al. 2005). Nematodes were re-isolated from the roots and their morphological and molecular characteristics were identical to the nematodes obtained from the original samples. Furthermore, all the inoculated S. miltiorrhiza roots showed typical RKN galls with the same symptoms as those initially observed in the field. No symptoms were developed on the non-inoculated control plants, and from which no nematodes were isolated. The nematode on S. miltiorrhiza was therefore certified as M. incognita. Han et al. (2019) isolated and morphologically identified M. incognita from the roots of S. miltiorrhiza and Trichosanthes kirilowii Maximin in Changqing area of Shandong Province, China, but did not perform the Koch's Rule. To our knowledge, this is the first formal report of M. incognita infecting S. miltiorrhiza in Henan Province, China. With the increase of Chinese herbal medicine planting area, plant parasitic nematodes are becoming more and more serious and have become an limiting factor on medicinal plant production, and the yield losses can be as high as 70%. This finding provides important and solid information for growers of Chinese medicinal plants, based on which suitable management action should be taken.

First record of Aphelenchoides besseyi on foxtail millet (Setaria italica) in Henan Province of China.

Aphelenchoides besseyi is one of the important plant-parasitic nematodes on rice, reducing approximate 10-20% of the rice yield annually (Jones et al. 2013). Foxtail millet (Setaria italica) has been a major cereal crop in Northern China, especially in the semi-arid areas of this region, for thousands of years. In August of 2019 and 2020, a survey of nematodes on autumn grain crops was performed each year. One foxtail millet field (N34° 58' 027″ and E113° 39' 059″) in Yuanyang County of Henan Province caught our attention. Some upper leaves showed chlorosis without or with necrotic tips, and flag leaves presented crinkling and distortion, stalks were colored, earheads were vertical, glumes were brown or light black and open, and grains became thin. A total of ten samples were collected, and the nematodes were isolated from the spike pieces by shallow plate method and counted under a stereomicroscope. The average number of nematodes per earhead of foxtail millet counted up to 1738.75 ± 107.72. Morphologically, females were slender with a short stylet, an oval metacorpus with a distinct valve, a labial region slightly wider than the first body annulus and a conoid tail with a terminus bearing a star-shaped mucro with four pointed processes. The females were characterized as follows (mean ± SD; n=20): body length (L) = 668.92 ± 12.73 µm (647.38 to 689.70 µm); maximum body width (W) = 14.35 ± 1.11 µm (12.12 to 16.88 µm); L/W = 46.83 ± 2.94 (40.44 to 50.03); tail length = 38.93 ± 3.48 µm (33.41 to 45.92 µm); L/tail length = 17.31 ± 1.44 (14.47 to 19.62); and stylet length (ST) = 11.57 ± 0.57 µm (10.77 to 12.34 µm). The males had three pairs of ventrosubmedian papillae with the first one adanal, spicula curved with a slight basal process, terminus bearing four mucrones arranged variably, and the whole worm was in 'J' shape. The males could be described as follows (mean ± SD, n = 20): L = 606.66 ± 10.70 µm (586.49 to 626.37 µm); W = 13.95 ± 0.60 µm (12.71 to 14.94 µm); L/W = 43.55 ± 1.69 (40.73 to 46.43); tail length = 35.54 ± 1.93 µm (31.41 to 38.18 µm); L/tail length = 17.07 ± 0.79 (16.05 to 18.67); ST = 11.53 ± 0.56 µm (1061 to 12.76 µm). All the key morphometrics were consistent with those of A. besseyi reported from Brazil (Favoreto et al. 2018) and China (Lin et al. 2004; Ou et al. 2014). The amplifications of rDNA internal transcribed spacer (ITS) fragments generated a PCR fragment of 830 bp from a single nematode, using the primers set TW81 (5'-GTTTCCGTAGGTGAACCTGC-3') and AB28 (5'-ATATGCTTAAGTTCAGCGGGT-3') (Joyce et al. 1994). Five independent PCR experiments were conducted, and all the PCR products were purified and sequenced. Nucleotide sequence of ITS-rDNA was deposited in GenBank with Accession Number OK090549.1. The obtained ITS region sequence was more than 99% identical to those of A. besseyi reported from China (MW216945.1) and India (JF826518.1, JF826519.1 and JF826517.1). These ITS sequence results further supported that the isolated nematodes were A. besseyi. Subsequently, the species-specific primers of A. besseyi (BSF, 5'-TCGATGAAGAACGCAGTGAATT-3' and BSR, 5'-AGATCAAAAGCCAATCGAATCAT-3') were used for confirmation by PCR (Cui et al. 2010). An expected PCR fragment of 312 bp was obtained, which was consistent with those of A. besseyi reported previously. The pathogenicity of identified A. besseyi was confirmed by infection of foxtail millet (Setaria italica cv. 'Yugu33'). Foxtail millet budding seeds were sown in the pots contained 150 mL of sterile soil mixture. In two weeks, 10 seedlings were inoculated with 100 A. besseyi each, and 4 plants were non-inoculated as the control. The foxtail millet seedlings were grown in a plant-growth chamber at 25/30°C under 12 h dark/12 h light. On the average, 73.3 and 138.2 of A. besseyi were isolated from each plant at 15 and 40 days post inoculation, respectively. Both the morphological and molecular characteristics were identical with those nematodes obtained from the original samples. All the upper leaves of the inoculated plants showed chlorosis and necrosis, symptoms that were similar to those observed in the field, and neither symptom developed on the non-inoculated control plants, nor were nematodes re-isolated from the control plants. To the best of our knowledge, this is the first record of A. besseyi on foxtail millet in Henan Province of North China. Henan is one of the most important grain-producing areas in China, and A. besseyi is an important domestic quarantine nematode, which may become a severe threat to cereal production in Henan Province. Our findings will be very beneficial for A. besseyi management and further research on foxtail millet in Henan Province of North China.

First report of Heterodera filipjevi on winter wheat from Hebei Province in North China.

Three of the cereal cyst nematodes, Heterodera avenae, H. filipjevi and H. latipons are considered to be the most economically important cyst nematodes that affect cultivated cereals around the world. H. filipjevi was first detected in China from Xuchang, Henan Province in 2010 (Peng et al. 2010) and now has been recorded in the Central China of Henan, Shandong and Anhui provinces and the Northwest China of Xinjiang Uygur Autonomous Region (Cui et al. 2020). In June 2019, 42 samples consisting of roots and soil were collected from winter wheat fields in Hebei Province of North China. Cysts were detected in 37 soil samples with a mean of 6.4 ± 1.67 cysts per 100 ml of soil. Cysts and second-stage juveniles (J2s) were extracted from root and soil following Cobb's sieving gravity method. Morphological and molecular studies of J2s and cysts confirmed its identity with H. filipjevi in 5 samples from Handan (N36°10'052" and E114°35'056"; N36°37'054" and E114°22'052"), Xingtai (N36°53'060" and E114°30'011") and Shijiazhuang (N 37°26'048" and E 116°05'039") in Hebei Province, China. Morphologically, the cysts are lemon-shaped, light or dark brown in color. The vulval cone is bifenestrate with horseshoe-shaped semifenestrae, strongly globular bullae, and well-developed underbridge. Measurements (mean +_ sd (range)) of cysts (n=10), body length not including neck is 743.0 ± 36.1 µm (665 - 780 µm), body width is 559.0 ± 50.0 µm (455 - 639 µm), length / width ratio is 1.33 ± 0.07 (1.20 - 1.46); neck length is 99.3 ± 8.8 µm (85 - 122 µm); fenestrae length is 56.8 ± 5.0 µm (49 - 65 µm) and width is 25.5 ± 1.8 µm (21.1 - 27.8 µm); underbridge length is 84.0 ± 8.1 µm (62 - 93 µm); and vulval slit length is 8.6 ± 0.5 µm (7.2 - 9.1 µm). Measurements of J2s (n = 12), body length is 541 ± 11.4 µm (490 - 578 µm); stylet length is 22.3 ± 0.5 µm (22.0 - 25.0 µm) with anchor-shaped basal knobs; tail length is 57.7 ± 3.7 µm (52.7 - 65.2 µm), and hyaline tail terminal length is 36.5 ± 2.8 µm (32 - 39.8 µm). The tail had a sharp terminus. Morphology of the cysts and J2s were consistent with the record of H. filipjevi (Peng et al. 2010; Subbotin et al. 2010). The amplifications of rDNA-internal transcribed spacer (ITS) fragments were generated with a PCR fragment of 1054 bp from single cysts of each population, using primers TW81 and AB28 (Joyce et al. 1994). The PCR tests for each sample were repeated five times. The PCR product was purified and sequenced. All nucleotide sequences of ITS-rDNA were submitted to GenBank under accession numbers MW282843-6. Sequences from the ITS region were more than 99.5% identical to those of H. filipjevi from Egypt (KF225725), Turkey (KR704308, KR704293 and MN848333) and China (KT314234, MT254744 and KY448473). These results from ITS supported its identity as H. filipjevi. The results were also confirmed by species specific sequence characterized amplified region primers of H. filipjevi (Peng et al. 2013). Pathogenicity of the H. filipjevi was confirmed by infection of winter wheat (Triticum aestivum L cv. 'Aikang58') and examination of the nematode development and reproduction. Wheat seeds were germinated in petri dishes and then transplanted into five polyvinyl chloride tubs (3 cm in diameter, 25 cm in length) that contained 150 cm3 of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 252.0 eggs/cyst). Plants were grown in an artificial climate box for one week at 14/18°C, two weeks at 16/20°C, five weeks at 18/25°C and two weeks at 22/30°C, under 8 h of darkness/16 h light and normal culturing practices (Cui et al. 2015). The parasitic J2s, third and fourth-stage juveniles, and adult females were observed in roots stained with acid fuchsin at 10, 20, 30, and 50 days after inoculation (DAI), and an average of 32.0 cysts per tubes were extracted 70 DAI. The new cyst' morphological and molecular characteristics were identical to the H. filipjevi cysts from the original soil samples. Three other tubes without cysts were set as control and there were no newly formed cysts. Heterodera avenae and H. filipjevi had been detected in a total of 16 wheat-producing provinces in China, which resulted in losses of 1.9 billion CNY year-1 (Cui et al. 2015). To our knowledge, this is the first report of H. filipjevi in Hebei Province of North China. Cereal cyst nematodes are easily transferred to non-infested areas by many avenues, resulting in increased species and pathotype complexity (Cui et al. 2020). Once H. filipjevi continues to spread in main wheat producing area of China, it could become be a new threat to cereals production. It is time to take effective control methods to prevent H. filipjevi further dispersal, especially through the farming machinery transmission. Hebei Province is one of the most important major grain-producing areas, our findings will be very beneficial for H. filipjevi management and further research on winter wheat in Hebei Province, North China.

First record of Heterodera elachista infecting rice in Henan Province of central China.

From June 2018 to November 2019, a survey for cyst-forming nematodes was conducted in rice fields in Henan Province of central China. Cysts were recovered from two rice fields (N32° 14' 048″8 and E115° 4' 008″) at Huangchuan County, leading to more intensive sampling. A further 25 soil samples were then collected with a valve bag from each of these two locations. Cysts and second-stage juveniles (J2) were recovered from roots and soil following Cobb's gravity sieving method. Live cysts were detected in all soil samples with a mean of 6.7±1.5 cysts per 100 ml of soil. Morphologically, the cysts were spherical to lemon-shaped, light to dark brown in color with subcrystalline layer. The vulval cone was well developed, cone terminus with a few large, peripheral, dark brown bullae lacking finger-like projections, and the ambifenestrae were almost rounded with two semifenestrae; width and length of the semifenestrae were similar. The vulval bridge was narrow, with a medium sized underbridge. Cyst measurements (n = 8) determined a mean body length of 431.1 ± 47.23 (351.0 - 516.0) µm, body width 304.3 ± 47.40 (240.0 - 381.0) µm; body length to width ratio 1.42 ± 0.10 (1.2 to 1.6); fenestrae length 39.4 ± 7.06 (26.0 - 47.0) µm; fenestrae width 36.5 ± 5.96 (25.0 - 43.0) µm; vulva slit length 37.1 ± 3.62 (30.0 - 42.0) µm; and the mean underbridge length 75.0 ± 3.39 (70.0 - 81.0) µm. Morphometric J2 measurements (n = 10) included a body length of 432.3 ± 53.26 (379.0 - 512.0) µm; stylet length 20.8 ± 1.87 (18.0 - 24) µm with rounded knobs; tail length 63.1 ± 7.92 (52.0 - 75.0) µm with a hyaline terminal tail length of 35.8 ± 6.14 (28.0 - 45.0) µm. The key morphometrics of this isolate were intermediate to those of the Japanese isolates (Nobbs et al. 1992.) and Chinese isolates (Ding et al. 2012), and other morphological character values were within the range of those reported for Heterodera elachista (Nobbs et al. 1992; Tanha Maafi et al. 2003). Amplification of DNA from single cysts (n = 7) was conducted using the protocol described by Ding et al. (2012). rDNA - ITS sequences were amplified with the universal primers TW81 and AB28 (Joyce et al. 1994). The PCR product was purified and sequenced. The ITS sequences were submitted to GenBank under accession numbers MT579616. Comparisons showed a sequence identity of more than 99.9% for H. elachista sequence MN720080 from Korea and 99.5% for H. elachista sequences JN864884 and JN202916 from China. Species identification was also confirmed using sequence characterized amplified region (SCAR) methods with H. elachista-specific primers He-F/He-R (Qi, 2012). An expected PCR fragment of approximately 434 bp was obtained, which was consistent with those previously reported for H. elachista. Pathogenicity was confirmed by infection and reproduction on rice (Oryza sativa cv. 'Nipponbare'). Seeds were sown into three tubes containing 150 ml of a sterile soil mixture (loamy soil: sand = 1:1), each with 5 cysts (mean of 185 eggs/cyst) and cultivated in an artificial climate box at 25/30°C, under a 12-h dark/12-h light cycle. Three other tubes without cysts were set as control. Two weeks after sowing, stunting and reduction of leaf length were observed and third- and fourth-stage juveniles were observed in roots stained with acid fuchsin. On average, 142 cysts per 150 ml soil were recovered at 5 weeks after sowing. The newly formed cysts corresponded morphologically and molecularly to the cysts from the original soil samples. The globally recognized and economically important rice-damaging cyst nematodes include H. oryzae, H. oryzicola, H. elachista, H. sacchari and H. graminophila (Zhuo et al. 2014). Ohshima (1974) first reported H. elachista, which was originally recorded as H. oryzae in Japan by Luc and Brizuela (1961). H. elachista was then detected from a rice field at Mazandaran Province in Iran (Tanha Maafi et al., 2003), and in upland rice fields in Hunan (Ding et al., 2012) and Guangxi, China (Zhuo et al. 2014). To the best of our knowledge, this is the first report of H. elachista as a pathogen on rice in Henan Province, in central China. According to our field observations, H. elachista was much more serious in direct-seeded rice field than in the transplanted rice fields. H. elachista was also reported attacking corn (Xiao et al., 2019). Henan is the most important corn-producing province in China, thus H. elachista is a potential threat to corn production in Henan. Our findings will be very beneficial for H. elachista management and further research on direct-seeded rice and corn in Henan Province, central China.

Characterization of Putative Effectors from the Cereal Cyst Nematode Heterodera avenae.

Few molecular details of effectors of Heterodera avenae parasitism are known. We performed a high-throughput sequencing analysis of the H. avenae transcriptome at five developmental stages. A total of 82,549 unigenes were ultimately obtained, and 747 transcripts showed best hits to genes putatively encoding carbohydrate-active enzymes in plant-parasitic nematodes that play an important role in the invasion process. A total of 1,480 unigenes were homologous to known phytonematode effectors, and 63 putative novel effectors were identified in the H. avenae transcriptomes. Twenty-three unigenes were analyzed by qRT-PCR and confirmed to be highly expressed during at least one developmental stage. For in situ hybridization, 17 of the 22 tested putative effectors were specifically expressed and located in the subventral gland cells, and five putative novel effectors were specifically expressed in the dorsal gland. Furthermore, 115 transcripts were found to have putative lethal RNA interference (RNAi) phenotypes. Three target genes with lethal RNAi phenotypes and two of the four tested putative effectors were associated with a decrease in the number of cysts through in vitro RNAi technology. These transcriptomic data lay a foundation for further studies of interactions of H. avenae with cereal and H. avenae parasitic control.

Efficacy Evaluation of Seed-Coating Compounds Against Cereal Cyst Nematodes and Root Lesion Nematodes on Wheat.

Cereal cyst nematodes (Heterodera avenae and H. filipjevi) and root lesion nematodes (Pratylenchus spp.) have been found to infect cereals in 16 provinces of China. To develop a nematicide that effectively controls nematodes, two novel chemical products, methylene bis thiocyanate (MBT) and MBT + thiamethoxam (MTT); four common pesticides, fipronil + chlorpyrifos (FIC), emamectin benzoate, imidacloprid, and Bacillus thuringiensis; and one fungicide, iprodione, were tested as seed coatings for the control of cereal cysts and root lesion nematodes from 2013 to 2015. Wheat seeds were treated with these seven seed coatings before sowing, and changes in the numbers of Heterodera spp. and Pratylenchus spp. were recorded during three different growth stages. Wheat yields were also compared after harvest. All treatments reduced the numbers of Pratylenchus in wheat and of cysts and eggs of Heterodera in the soil compared with the untreated control. Among the treatments, application of MTT or FIC was more effective than that of the other treatments for nematode control, and the other treatments had similar effects. The results of this study have demonstrated that MTT and FIC applied as seed treatments effectively reduce the number of cysts, inhibit the reproduction of Heterodera and Pratylenchus, and enhance wheat yields. MTT and FIC are thus suitable for controlling nematodes on wheat under natural field conditions.

Mutations in Acetylcholinesterase2 (ace2) increase the insensitivity of acetylcholinesterase to fosthiazate in the root-knot nematode Meloidogyne incognita.

The root-knot nematode Meloidogyne incognita causes severe damage to continuously cropping vegetables. The control of this nematode relies heavily on organophosphate nematicides in China. Here, we described resistance to the organophosphate nematicide fosthiazate in a greenhouse-collected resistant population (RP) and a laboratory susceptible population (SP) of M. incognita. Fosthiazate was 2.74-fold less toxic to nematodes from RP than that from SP. Quantitative real-time PCR revealed that the acetylcholinesterase2 (ace2) transcription level in the RP was significantly higher than that in the SP. Eighteen nonsynonymous amino acid differences in ace2 were observed between the cDNA fragments of the RP and SP. The acetylcholinesterase (AChE) protein activity in the RP was significantly reduced compared with that in the SP. After knocking down the ace2 gene, the ace2 transcription level was significantly decreased, but no negative impact on the infection of juveniles was observed. The 50% lethal concentration of the RNAi RP population decreased 40%, but the inhibition rate of fosthiazate against AChE activity was significantly increased in RP population. Thus, the increased fosthiazate insensitivity in the M. incognita resistant population was strongly associated with mutations in ace2. These results provide valuable insights into the resistance mechanism of root-knot nematode to organophosphate nematicides.

Large-scale identification of wheat genes resistant to cereal cyst nematode Heterodera avenae using comparative transcriptomic analysis.

BACKGROUND: Cereal cyst nematode Heterodera avenae, an important soil-borne pathogen in wheat, causes numerous annual yield losses worldwide, and use of resistant cultivars is the best strategy for control. However, target genes are not readily available for breeding resistant cultivars. Therefore, comparative transcriptomic analyses were performed to identify more applicable resistance genes for cultivar breeding. METHODS: The developing nematodes within roots were stained with acid fuchsin solution. Transcriptome assemblies and redundancy filteration were obtained by Trinity, TGI Clustering Tool and BLASTN, respectively. Gene Ontology annotation was yielded by Blast2GO program, and metabolic pathways of transcripts were analyzed by Path_finder. The ROS levels were determined by luminol-chemiluminescence assay. The transcriptional gene expression profiles were obtained by quantitative RT-PCR. RESULTS: The RNA-sequencing was performed using an incompatible wheat cultivar VP1620 and a compatible control cultivar WEN19 infected with H. avenae at 24 h, 3 d and 8 d. Infection assays showed that VP1620 failed to block penetration of H. avenae but disturbed the transition of developmental stages, leading to a significant reduction in cyst formation. Two types of expression profiles were established to predict candidate resistance genes after developing a novel strategy to generate clean RNA-seq data by removing the transcripts of H. avenae within the raw data before assembly. Using the uncoordinated expression profiles with transcript abundance as a standard, 424 candidate resistance genes were identified, including 302 overlapping genes and 122 VP1620-specific genes. Genes with similar expression patterns were further classified according to the scales of changed transcript abundances, and 182 genes were rescued as supplementary candidate resistance genes. Functional characterizations revealed that diverse defense-related pathways were responsible for wheat resistance against H. avenae. Moreover, phospholipase was involved in many defense-related pathways and localized in the connection position. Furthermore, strong bursts of reactive oxygen species (ROS) within VP1620 roots infected with H. avenae were induced at 24 h and 3 d, and eight ROS-producing genes were significantly upregulated, including three class III peroxidase and five lipoxygenase genes. CONCLUSIONS: Large-scale identification of wheat resistance genes were processed by comparative transcriptomic analysis. Functional characterization showed that phospholipases associated with ROS production played vital roles in early defense responses to H. avenae via involvement in diverse defense-related pathways as a hub switch. This study is the first to investigate the early defense responses of wheat against H. avenae, not only provides applicable candidate resistance genes for breeding novel wheat cultivars, but also enables a better understanding of the defense mechanisms of wheat against H. avenae.

Efficacy evaluation of fungus Syncephalastrum racemosum and nematicide avermectin against the root-knot nematode Meloidogyne incognita on cucumber.

The root-knot nematode (RKN) is one of the most damaging agricultural pests.Effective biological control is need for controlling this destructive pathogen in organic farming system. During October 2010 to 2011, the nematicidal effects of the Syncephalastrum racemosum fungus and the nematicide, avermectin, alone or combined were tested against the RKN (Meloidogyne incognita) on cucumber under pot and field condition in China. Under pot conditions, the application of S. racemosum alone or combined with avermectin significantly increased the plant vigor index by 31.4% and 10.9%, respectively compared to the M. incognita-inoculated control. However, treatment with avermectin alone did not significantly affect the plant vigor index. All treatments reduced the number of root galls and juvenile nematodes compared to the untreated control. Under greenhouse conditions, all treatments reduced the disease severity and enhanced fruit yield compared to the untreated control. Fewer nematodes infecting plant roots were observed after treatment with avermectin alone, S. racemosum alone or their combination compared to the M. incognita-inoculated control. Among all the treatments, application of avermectin or S. racemosum combined with avermectin was more effective than the S. racemosum treatment. Our results showed that application of S. racemosum combined with avermectin not only reduced the nematode number and plant disease severity but also enhanced plant vigor and yield. The results indicated that the combination of S. racemosum with avermectin could be an effective biological component in integrated management of RKN on cucumber.