Identification of two functional estrogen response elements complexed with AP-1-like sites in the human insulin receptor gene promoter.

This study was designed to explore the possible existence and location of estrogen response elements (EREs) in the human insulin receptor (hIR) gene promoter. Transfections of U-937 cells with the reported plasmids phIR(-1819)-GL2, phIR(-1473)-GL2, and phIR(-876)-GL2, that contain the -1819 to -271 bp fragment of the hIR promoter (wild-type promoter) and progressive 5' deletions of this promoter, revealed that while the activity of the wild-type promoter, was repressed 36% by treatment with 17beta-estradiol (E(2)), the activities of progressive 5' deletions of this promoter were reduced by 26% and by 0%, by this hormone. This suggests that E(2) needs the wild-type promoter for full transcriptional repression of this gene and it also suggests the presence of putative EREs in the region between -1819/-877 bp of this promoter. To identify these EREs we performed a computer search, using the SEQFIND programme developed in our laboratory, by homology with the consensus vit-ERE (5'GGTCAnnnTGACC3') of the Xenopus vitellogenin A(2) gene promoter. The results of our search indicated no sequence identical to this consensus ERE, and neither was any sequence found to show 9 or 8 of the 10 bases of this consensus in this promoter. Nevertheless, a putative hIR ERE1 (5'AGTGAaacTGGCC3') showing 7 bases of the consensus vit-ERE, and 10 bases of the optimal binding sequence ERE (5'CA/GGGTCAnnnTGACCT/CG3'), was identified between -1430/-1418bp of the hIR promoter. An AP-1-like site was covering the 3' half-element of this ERE; another AP-1-like site was overlapping the first AP-1-like site, and finally a third AP-1-like site was located beside to the 5' half-element. In addition, another putative hIR ERE2 (5'GCTCCtagCAAAC3') showing 5 bases of the consensus vit-ERE, and 9 bases of the optimal binding sequence ERE, was located upstream of the hIR promoter, between -1567/-1555 bp. An AP-1-like site was located downstream of the 3' half-element of this ERE, and another AP-1-like site was beside the 5' half-element. EMSA analysis using nuclear extracts of E(2)-treated cells and natural sequences, including these putative EREs, indicated that ERbeta - the only isoform expressed in U-937 cells - specifically recognized both EREs because ERbeta-DNA complexes were efficiently competed by the corresponding unlabelled probe and supershifted by the anti-human ERbeta (L-20) antibody. These data provide the first identification of EREs complexed with AP-1-like sites in the hIR promoter, which account for the transcriptional repression of the hIR gene mediated by ERbeta in U-937 cells.

17beta-Estradiol transcriptionally represses human insulin receptor gene expression causing cellular insulin resistance.

In this study, we demonstrate that 17beta-estradiol (E(2)) inhibits human insulin receptor (IR) gene expression in a dose- and time-dependent manner in U-937 human promonocytic cells. Using cells transfected with the -1819 to -271 bp fragment of the human IR promoter (wild type promoter) and treated with E(2), we show that this repression is regulated at the transcriptional level. The steroid was also found to diminish the insulin responsiveness of the cells in terms of cell survival, DNA synthesis, glucose transport, and glucose oxidation, this last effect possibly involving reduced phosphatidylinositol 3-kinase (PI3-kinase) activity. These data provide new information on the molecular mechanisms of estrogen-inducing insulin resistance in human cells.

HTLV-I: Enfermedades asociadas y seroprevalencia en la provincia de San Juan / HTLV-I: Associate diseases and seroprevalence in the state of San Juan

Presentamos nuestra experiencia en 5 casos clínicos: 3 ATLL (todos fallecidos) y 2 HAM/TSP. Incluímos ell º caso de ATLL sometido a TAMO alogénico en el país. Presentamos nuestra experiencia en 5 casos clínicos: 3 ATLL (todos fallecidos) y 2 HAM/TSP. Incluímos ell º caso de ATLL sometido a TAMO alogénico en el país. indeterminados". Palabras clave: Leucemia/Li

HTLV-I: Enfermedades asociadas y seroprevalencia en la provincia de San Juan / HTLV-I: Associate diseases and seroprevalence in the state of San Juan

Presentamos nuestra experiencia en 5 casos clínicos: 3 ATLL (todos fallecidos) y 2 HAM/TSP. Incluímos ell ° caso de ATLL sometido a TAMO alogénico en el país. Presentamos nuestra experiencia en 5 casos clínicos: 3 ATLL (todos fallecidos) y 2 HAM/TSP. Incluímos ell ° caso de ATLL sometido a TAMO alogénico en el país. indeterminados". Palabras clave: Leucemia/Linfoma T del Adulto (ATLL); Mielopatía asociada a HTLV-I (HAM/TSP) trasplante alogénico; donantes de sangre; HGIP

Transcriptional inhibition of the human insulin receptor gene by aldosterone.

In earlier studies, we reported reduced human insulin receptor (hIR) mRNA levels, insulin binding and insulin responsiveness in U-937 human promonocytic cells treated with aldosterone. The mechanism for this inhibition could be diminished IR gene transcription, since aldosterone did not affect hIR mRNA stability. All the effects were mediated by a downregulation of the mineralocorticoid receptor (MR, NR3C2) expressed at both the RNA and protein levels, suggesting that MR could act as a transcription factor that binds to hormone response elements in the hIR gene promoter. Indeed, MR has been shown to bind glucocorticoid response elements (GREs) in target genes. Given that five GREs have been characterized in the hIR promoter, we decided to test whether these elements could mediate the aldosterone-elicited inhibition of hIR expression detected by us in U-937 cells. In the present report, we demonstrate that aldosterone inhibits the activity of the hIR wild-type promoter by 23%, and causes 23 and 31% reductions in the activity of progressive deletions of this promoter comprised of fragments up to -1473 and -876bp, respectively. This indicates that the -876 to -271bp region of the hIR promoter may be sufficient for this transcriptional inhibition by aldosterone. We also provide evidence for direct MR interaction with some of the GREs of this promoter region, specifically with the cGRE1 and cGRE3, presumably as MR-MR homodimers, and with pGRE as a MR-GR heterodimer. This heterodimer may play the most relevant role and participate in the cross-talk between mineralocorticoids, glucocorticoids and insulin signalling in U-937 cells.

Identification of a Vitamin D response element in the human insulin receptor gene promoter.

The present study was designed to explore the possible presence and location of Vitamin D response elements (VDREs) in the human insulin receptor (hIR) gene promoter. To this end, the -1819 to -271 bp fragment of the hIR promoter (wild type promoter) and progressive 5' deletions of this promoter (up to -1473 and -876 bp) were linked to the luciferase pGL2-basic vector to construct the reported plasmids: phIR (-1819)-GL2, phIR(-1473)-GL2 and phIR(-876)-GL2, respectively. U-937 cells were transiently transfected with these plasmids, and then the cells were either untreated or treated for 24h with 10(-8) M 1,25-dihydroxyvitamin D(3) (1,25D(3)). Luciferase determinations revealed that, while the activity of the wild promoter was increased 1.6-fold by the hormone, the activities of progressive 5' deletions of this promoter were enhanced 1.7-, and 1.6-fold, respectively. Thus, the region extending from -876 to -271bp of the hIR promoter, appears to contain VDREs, and to be sufficient for induction by 1,25D(3). In order to identify these potential VDREs, we performed a computer search of candidate sequences by homology with a consensus VDRE sequence. This search yielded a sequence located between -761 and -732 bp (5'CGTCGGGCCTGTGGGGCGCCTCCGGGGGTC3'), which includes an overlapping AP-2 like sequence, as a good candidate. Electrophoretic mobility shift assays revealed that the Vitamin D receptor (VDR) specifically recognized this sequence, since a VDR-DNA complex was able to compete with the unlabeled probe and was cleared by the specific anti-VDR antibody 9A7. These data represent the first identification of a VDRE in the hIR gene promoter.

Growth hormone binding protein, insulin-like growth factor-I and short stature in two pygmy populations from the Philippines.

The molecular basis and biochemical mediators of genetic growth propensity and adult height achievement in the general population are largely unknown. Pygmies represent one extreme of the height spectrum that may provide important clues regarding this issue. Previous studies in pygmies from Africa and Papua-New Guinea have shown decreased serum levels of growth hormone binding protein (GHBP), the circulating ectodomain of the growth hormone receptor (GHR). By inference, a similar limitation in tissue GHR expression has been assumed to be responsible for the partial growth hormone (GH) resistance observed in African pygmies. It is not clear how generalizable this concept is to other populations. To address this question, we studied two pygmy populations from the Philippines (Aeta and Mamanwa people) that are unrelated to the African pygmies. Serum GHBP and IGF-I levels were significantly decreased in both pygmy populations, compared to normal-statured Philippino controls. The results, together with previous observations in African and New Guinean pygmies, indicate that short stature is associated with low serum GHBP levels in pygmy populations of diverse origins and in different parts of the world. This strengthens the tentative postulate that the GHBP/GHR system plays an important role in the genetic and perhaps nutritional determination of adult stature in humans. Molecular genetic studies of the GHR gene in various pygmy populations may shed further light on the mystery of pygmy short stature.