Bactericera cockerelli Picorna-like Virus and Three New Viruses Found Circulating in Populations of Potato/Tomato Psyllids (Bactericera cockerelli).

An investigation of viruses circulating in populations of field and laboratory potato/tomato psyllids (Bactericera cockerelli) was conducted using high-throughput sequencing (HTS) technology and conventional RT-PCR. Three new viruses were discovered: one from the family Tymoviridae and two from the family Solemoviridae. A tymo-like virus sequence represented a nearly complete 6843 nt genome of a virus named Bactericera cockerelli tymo-like virus (BcTLV) that spanned five open reading frames (ORFs) which encoded RNA-dependent RNA polymerase (RdRP), helicase, protease, methyltransferase, and a capsid protein. Phylogenetic analyses placed the RdRP of BcTLV inside a divergent lineage of the viruses from the family Tymoviridae found in insect and plant hosts in a sister clade to the genera Tymovirus, Marafivirus, and Maculavirus. Four solemo-like virus sequences were identified in the HTS outputs, representing two new viruses. One virus found only in field-collected psyllids and named Bactericera cockerelli solemo-like virus 1 (BcSLV-1) had a 5479 nt genome which spanned four ORFs encoding protease and RdRP. Three solemo-like sequences displayed 87.4-99.7% nucleotide sequence identity among themselves, representing variants or strains of the same virus named Bactericera cockerelli solemo-like virus 2 (BcSLV-2). The genome of BcSLV-2 spanned only two ORFs that encoded a protease and an RdRP. Phylogenetic analysis placed the RdRPs of BcSLV-1 and BcSLV-2 in two separate lineages as sister clades to viruses from the genus Sobemovirus found in plant hosts. All three new psyllid viruses were found circulating in psyllids collected from potato fields in southern Idaho along with a previously identified Bactericera cockerelli picorna-like virus. Any possible role of the three viruses in controlling populations of the field psyllids remains to be elucidated.

Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

Grapevine Endophyte Endornavirus and Two New Endornaviruses Found Associated with Grapevines (Vitis vinifera L.) in Idaho, USA.

Five virus genomes, ranging between 12.0 and 12.3 kb in length and identified as endornaviruses, were discovered through a high-throughput sequencing (HTS) analysis of the total RNA samples extracted from two wine grape cultivars collected in the State of Idaho. One was found in a declining Chardonnay vine and was determined to be a local isolate of grapevine endophyte endornavirus (GEEV), and four others represented two novel endornaviruses named grapevine endornavirus 1 (GEV1) and grapevine endornavirus 2 (GEV2). All three virus genomes span a large, single open reading frame encoding polyproteins with easily identifiable helicase (HEL) and RNA-dependent RNA polymerase (RdRP) domains, while the GEV2 polyprotein also contains a glycosyltransferase domain. The GEV1 genome found in an asymptomatic Cabernet franc vine was related to, but distinct from, GEEV: the 5'-proximal, 4.7 kb segment of the GEV1 genome had a 72% identical nucleotide sequence to that of GEEV, while the rest of the genome displayed no significant similarity to the GEEV nucleotide sequence. Nevertheless, the amino acid sequence of the RdRP domain of GEV1 exhibited the closest affinity to the RdRP of GEEV. GEV2 was found in declining Chardonnay and asymptomatic Cabernet franc vines as three genetic variants exhibiting a 91.9-99.8% nucleotide sequence identity among each other; its RdRP had the closest affinity to the Shahe endorna-like virus 1 found in termites. In phylogenetic analyses, the RdRP and HEL domains of the GEV1 and GEV2 polyproteins were placed in two separate clades inside the large lineage of alphaendornaviruses, showing an affinity to GEEV and Phaseolus vulgaris endornavirus 1, respectively.

Genome Sequences of Two Grapevine Rupestris Stem Pitting-Associated Virus Variants from Vitis vinifera cv. Riesling in Idaho, USA.

We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1.

First report of tomato chlorotic dwarf viroid infecting litchi tomato (Solanum sisymbriifolium).

Litchi tomato (LT) (Solanum sisymbriifolium) is a solanaceous weed that is considered a biological control tool to manage potato cyst nematode (PCN) in Europe and is being explored for use in Idaho. Two Several LT lines were clonally maintained as stocks in the university greenhouse since 2013 and were also established in tissue culture at the same time. In 2018, tomato (Solanum lycopersicum cv. Alisa Craig) scions were grafted onto two LT rootstocks originating either from healthy-looking greenhouse stocks or from tissue culture-maintained plants. Unexpectedly, tomatoes grafted onto the greenhouse-maintained rootstocks of LT displayed severe symptoms of stunting, foliar deformation, and chlorosis, while grafts onto the same LT lines from tissue culture produced healthy-looking tomato plants. Tests for the presence of several viruses known to infect solanaceous plants were conducted on symptomatic tomato scion tissues using ImmunoStrips (Agdia, Elkhard, IN) and RT-PCR (Elwan et al. 2017) but yielded negative results. High throughput sequencing (HTS) was then used to identify possible pathogens that could have been responsible for the symptoms observed in tomato scions. Samples from two symptomatic tomato scions, two asymptomatic scions grafted onto the tissue culture-derived plants, and two greenhouse-maintained rootstocks were subjected to HTS. Total RNA from the four tomato and two LT samples was depleted of ribosomal RNA and subjected to HTS on an Illumina MiSeq platform producing 300-bp paired-end reads and raw reads were adapter and quality cleaned. For the tomato samples, the clean reads were mapped against the S. lycopersicum L. reference genome, and unmapped paired reads were assembled producing between 4,368 and 8,645 contigs. For the LT samples, all clean reads were directly assembled, producing 13,982 and 18,595 contigs. In the symptomatic tomato scions and the two LT rootstock samples, a 487-nt contig was found, comprising an ~1.35 tomato chlorotic dwarf viroid (TCDVd) genome and exhibiting 99.7% identity with it (GenBank accession AF162131; Singh et al. 1999). No other virus-related or viroid contigs were identified. RT-PCR analysis using a pospiviroid primer set Pospi1-FW/RE (Verhoeven et al. 2004), and a TCDVd-specific primer set TCDVd-Fw/TCDVd-Rev (Olmedo-Velarde et al. 2019) produced 198-nt and 218-nt bands, respectively, thus confirming the presence of TCDVd in tomato and LT samples. These PCR products were Sanger sequenced and confirmed to be TCDVd-specific; the complete sequence of the Idaho isolate of TCDVd was deposited in GenBank under the accession number OQ679776. Presence of TCDVd in LT plant tissue was confirmed by the APHIS PPQ Laboratory in Laurel, MD. Asymptomatic tomatoes and LT plants from tissue culture were found negative for TCDVd. Previously, TCDVd was reported to affect greenhouse tomatoes in Arizona and Hawaii (Ling et al. et al. 2009; Olmedo-Velarde et al. 2019), however, this is the first report of TCDVd infecting litchi tomato (S. sisymbriifolium). Five additional greenhouse-maintained LT lines were found TCDVd-positive using RT-PCR and Sanger sequencing. Given the very mild or asymptomatic infection of TCDVd in this host, molecular diagnostic methods should be used to screen LT lines for the presence of this viroid to avoid inadvertent spread of TCDVd. Another viroid, potato spindle tuber viroid, was reported to be transmitted through LT seed (Fowkes et al. 2021), and transmission of TCDVd through LT seed may also be responsible for this TCDVd outbreak in the university greenhouse, although no direct evidence was collected. To the best of our knowledge, this is the first report of TCDVd infection in S. sisymbriifolium and also the first report of the TCDVd occurrence in Idaho.

A Novel Rhabdovirus Associated with the Idaho Population of Potato Cyst Nematode Globodera pallida.

Globodera pallida, a potato cyst nematode (PCN), is a quarantine endoparasitic pest of potato (Solanum tuberosum) in the US due to its effects on yield and quality of potato tubers. A new rhabdovirus, named potato cyst nematode rhabdovirus (PcRV), was revealed and characterized in the G. pallida populations collected in Idaho through use of high-throughput sequencing (HTS) and RT-PCR and found to be most closely related to soybean cyst nematode rhabdovirus (ScRV). PcRV has a 13,604 bp long, single-stranded RNA genome encoding five open reading frames, including four rhabdovirus-specific genes, N, P, G, and L, and one unknown gene. PcRV was found present in eggs, invasive second-stage juveniles, and parasitic females of G. pallida, implying a vertical transmission mode. RT-PCR and partial sequencing of PcRV in laboratory-reared G. pallida populations maintained over five years suggested that the virus is highly persistent and genetically stable. Two other Globodera spp. reproducing on potato and reported in the US, G. rostochiensis and G. ellingtonae, tested negative for PcRV presence. To the best of our knowledge, PcRV is the first virus experimentally found infecting G. pallida. Based on their similar genome organizations, the phylogeny of their RNA-dependent RNA polymerase domains (L gene), and relatively high identity levels in their protein products, PcRV and ScRV are proposed to form a new genus, provisionally named "Gammanemrhavirus", within the family Rhabdoviridae.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

A Novel Flavi-like Virus in Alfalfa (Medicago sativa L.) Crops along the Snake River Valley.

Alfalfa is an important perennial forage crop in Idaho supporting dairy and cattle industries that is typically grown in the same field for as many as 4 years. Alfalfa stands of different ages were subjected to screening for viruses using high-throughput sequencing and RT-PCR. The two most common viruses found were alfalfa mosaic virus and bean leafroll virus, along with Medicago sativa amalgavirus, two alphapartitiviruses, and one deltapartitivirus. Additionally, a new flavi-like virus with an unusual genome organization was discovered, dubbed Snake River alfalfa virus (SRAV). The 11,745 nt, positive-sense (+) RNA genome of SRAV encodes a single 3835 aa polyprotein with only two identifiable conserved domains, an RNA-dependent RNA polymerase (RdRP) and a predicted serine protease. Notably, unlike all +RNA virus genomes in the similar size range, the SRAV polyprotein contained no predicted helicase domain. In the RdRP phylogeny, SRAV was placed inside the flavi-like lineage as a sister clade to a branch consisting of hepaci-, and pegiviruses. To the best of our knowledge, SRAV is the first flavi-like virus identified in a plant host. Although commonly detected in alfalfa crops in southern Idaho, SRAV sequences were also amplified from thrips feeding in alfalfa stands in the area, suggesting a possible role of Frankliniella occidentalis in virus transmission.

A new picorna-like virus identified in populations of the potato psyllid Bactericera cockerelli.

The potato/tomato psyllid Bactericera cockerelli (Hemiptera: Triozidae) is a pest of Solanaceae plants and a vector of the pathogenic bacterium 'Candidatus Liberibacter solanacearum', which is associated with zebra chip disease in potato. This disease is controlled through insecticide treatments, and more environmentally friendly management options are desirable. The objective of this study was to identify viruses present in potato psyllid populations that might be used as biocontrol agents for this insect pest. A new picorna-like virus, tentatively named "Bactericera cockerelli picorna-like virus" (BcPLV), was discovered in B. cockerelli populations maintained in greenhouses, through the use of high-throughput sequencing data and subsequent confirmation by RT-PCR and Sanger sequencing. BcPLV has a positive-sense 9,939-nt RNA genome encoding a single 2,947-aa polyprotein and is related to the Diaphorina citri picorna-like virus (DcPLV) found in Asian citrus psyllid Diaphorina citri populations. Based on their genome organization and the phylogeny of their RNA-dependent RNA polymerase domains, BcPLV and DcPLV together are proposed to comprise a new genus, provisionally named "Psylloidivirus", within the family Iflaviridae.

First report of grapevine rupestris vein feathering virus in wine grapes in Idaho.

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3'-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5'- GAAGCAACAGTGCCCGTCTC -3') and GRVFV-R1 (5'- AGGTCGCTTTACGGACCTTTTCTT -3'). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

A Case of Gene Fragmentation in Plant Mitochondria Fixed by the Selection of a Compensatory Restorer of Fertility-Like PPR Gene.

The high mutational load of mitochondrial genomes combined with their uniparental inheritance and high polyploidy favors the maintenance of deleterious mutations within populations. How cells compose and adapt to the accumulation of disadvantageous mitochondrial alleles remains unclear. Most harmful changes are likely corrected by purifying selection, however, the intimate collaboration between mitochondria- and nuclear-encoded gene products offers theoretical potential for compensatory adaptive changes. In plants, cytoplasmic male sterilities are known examples of nucleo-mitochondrial coadaptation situations in which nuclear-encoded restorer of fertility (Rf) genes evolve to counteract the effect of mitochondria-encoded cytoplasmic male sterility (CMS) genes and restore fertility. Most cloned Rfs belong to a small monophyletic group, comprising 26 pentatricopeptide repeat genes in Arabidopsis, called Rf-like (RFL). In this analysis, we explored the functional diversity of RFL genes in Arabidopsis and found that the RFL8 gene is not related to CMS suppression but essential for plant embryo development. In vitro-rescued rfl8 plantlets are deficient in the production of the mitochondrial heme-lyase complex. A complete ensemble of molecular and genetic analyses allowed us to demonstrate that the RFL8 gene has been selected to permit the translation of the mitochondrial ccmFN2 gene encoding a heme-lyase complex subunit which derives from the split of the ccmFN gene, specifically in Brassicaceae plants. This study represents thus a clear case of nuclear compensation to a lineage-specific mitochondrial genomic rearrangement in plants and demonstrates that RFL genes can be selected in response to other mitochondrial deviancies than CMS suppression.

Haplotyping the Potato Psyllid (Hemiptera: Triozidae) and the Associated Pathogenic Bacterium 'Candidatus Liberibacter solanacearum' in Non-crop Alternative Hosts in Southern Idaho.

Zebra chip, is a potato disease associated with the bacterium 'Candidatus Liberibacter solanacearum' (Lso) and vectored by the potato psyllid, Bactericera cockerelli Sulc. Potato psyllids are native to North America, where four haplotypes have been described. They are able to colonize a wide range of solanaceous species, crops, and weeds. The epidemiology of zebra chip disease is still poorly understood and might involve the different haplotypes of psyllids as well as two haplotypes of Lso. As several perennial weeds have been recognized as potential host for potato psyllids and Lso, a yearly monitoring of several patches of bittersweet nightshade (Solanum dulcamara) and field bindweed (Convolvulus arvensis) located in the potato-growing region of southern Idaho was conducted from 2013 to 2017, to gain insight into psyllid dynamics in non-potato hosts and Lso presence in the fields. Potato psyllids caught on each host were individually tested for Lso, and a subset were haplotyped based on the CO1 gene, along with the haplotyping of Lso in positive samples. On bittersweet nightshade, the Northwestern haplotype was numerically dominant, with around 2.7% of psyllids found to be carrying either Lso haplotype A or B, suggesting a limited role in zebra chip persistence, which has infected Idaho fields at a low occurrence since the 2012 outbreak. Field bindweed was found to be a transient, non-overwintering host for potato psyllid of Northwestern, Western and Central haplotypes late in the season, suggesting minor, if any, role in persistence of Lso and field infestation by potato psyllids.

Prevalence of 'Candidatus Liberibacter solanacearum' Haplotypes in Potato Tubers and Psyllid Vectors in Idaho From 2012 to 2018.

'Candidatus Liberibacter solanacearum' (Lso) is an uncultured, phloem-associated bacterium causing a severe tuber disease in potato called zebra chip (ZC). Seven haplotypes of Lso have been described in different hosts, with haplotypes A and B found associated with infections in potato and tomato. In the field, Lso is transmitted by the potato psyllid (Bactericera cockerelli), and between 2011 and 2015, a significant change in Lso haplotype prevalence was previously reported in Idaho: from exclusively A haplotype found in tested psyllids in 2012 to mainly B haplotype found in collected psyllids in 2015. However, prevalence of Lso haplotypes in Idaho was not analyzed in potato tubers exhibiting symptoms of ZC. To fill in this knowledge gap, prevalence of Lso haplotypes was investigated in potato tubers harvested in southern Idaho between 2012 and 2018, and it was found to change from exclusively A haplotype in the 2012 season to an almost equal A and B haplotype distribution during the 2016 season. During the same period, haplotype distribution of Lso in psyllid vectors collected using yellow sticky traps also changed, but in psyllids, the shift from A haplotype of Lso to B haplotype was complete, with no A haplotype detected in 2016 to 2018. The changes in the haplotype prevalence of the Lso circulating in potato fields in southern Idaho may be, among other factors, responsible for a decrease in the ZC incidence in Idaho potato fields between an outbreak of the disease in 2012 and a very low level of ZC afterward.

Associations of the Potato Psyllid and "Candidatus Liberibacter solanacearum" in Idaho with the Noncrop Host Plants Bittersweet Nightshade and Field Bindweed.

Zebra chip disease (ZC) in potato (Solanum tuberosum L. [Polemoniales: Solanaceae]) can produce unmarketable tubers with striped necrotic patterns. ZC is associated with the bacterium "Candidatus Liberibacter solanacearum" (Lso), which is transmitted by the potato psyllid, Bactericera cockerelli (Sulc) (Hemiptera: Triozidae). Potato psyllids are associated with numerous noncrop host plants, especially from the Solanaceae and Convolvulaceae; however, the contribution and importance of these hosts to ZC epidemiology in potato is poorly understood. To clarify seasonal phenologies on two such hosts, we sampled potato psyllids from bittersweet nightshade, Solanum dulcamara L. (Polemoniales: Solanaceae), and field bindweed, Convolvulus arvensis L. (Polemoniales: Convolvulaceae), over 2013-2017 and 2014-2016, respectively. Adult psyllids were sampled using yellow sticky traps, vacuum samples, and beat sheets. Each psyllid was tested for the presence of Lso by polymerase chain reaction. Psyllids often were abundant on bittersweet nightshade during May to November, with low numbers observed over each winter. Vacuum samples often captured more psyllids than other methods. Lso incidence was low except during 2016 when vacuum samples showed 23% incidence. Potato psyllids regularly overwinter on bittersweet nightshade in Idaho; however, differences in psyllid populations and Lso incidence from those found on potato suggest that this host plant may only partly contribute to infestations in potato. Observations of psyllids on field bindweed suggest only transient visits to this plant around potato harvest, with no evidence of overwintering and no Lso detected. Further work is needed to clarify how potato psyllid use of other noncrop hosts is related to their abundance in Idaho potato fields.

A Novel Genetic Variant of Grapevine leafroll-associated virus-3 (GLRaV-3) from Idaho Grapevines.

Grapevine leafroll-associated virus-3 (GLRaV-3) is a major constraint on profitable grapevine cultivation. The virus is transmitted efficiently by mealybugs and soft scale insects, or through vegetative propagation by cuttings, and is present worldwide, wherever grapevines are grown. GLRaV-3 exists as a complex of genetic variants currently classified in several phylogenetic groups that can differ from each other by as much as 30% in nucleotide sequence of the whole genome. In the course of the GLRaV-3 testing of wine grapes in southern Idaho, plants of two grapevine cultivars were found to harbor a novel genetic variant of GLRaV-3, named ID45, which exhibited ≤80% nucleotide sequence identity level to the known GLRaV-3 isolates in its most conserved HSP70h gene. The ID45 variant caused no foliar symptoms in 'Cabernet Sauvignon' in the fall, and was demonstrated to have poor reactivity to commercial virus-specific antibodies. The entire 18,478-nt genome sequence of the GLRaV-3-ID45 was determined using a combination of high-throughput and conventional Sanger sequencing, and demonstrated to have typical organization for the genus Ampelovirus (family Closteroviridae), with only 70 to 77% identity level to the GLRaV-3 genomes from other established phylogroups. We concluded that ID45 represented a new phylogenetic group IX of GLRaV-3. Database search using ID45 nucleotide sequence as a query suggested that this novel ID45 variant is present in at least one other grape-growing state in the U.S., California, and in Brazil. An RT-PCR based test was developed to distinguish ID45 from the predominant GLRaV-3 phylogroup I found in Idaho in single and mixed infections.

Phenology of the Potato Psyllid, Bactericera cockerelli (Hemiptera: Triozidae), and "Candidatus Liberibacter solanacearum" in Commercial Potato Fields in Idaho.

Zebra chip disease (ZC) is an emerging disease of potato in which tubers are produced with striped necrotic patterns that make them unmarketable. ZC is associated with the bacterium "Candidatus Liberibacter solanacearum" (Lso), which is transmitted by the potato psyllid, Bactericera cockerelli (Sulc; Hemiptera: Triozidae). First found in Idaho during 2011, ZC now contributes to increased production costs each season via additional insecticide sprays. To clarify the extent and severity of the threat of ZC in Idaho, we sampled potato psyllids in commercial potato fields across the state over four growing seasons (2012-2015). All life stages of psyllids were sampled using a combination of methods (yellow sticky traps, vacuum samples, and leaf samples), and adult psyllids were tested for the presence of Lso by Polymerase Chain Reaction (PCR). Abundance of potato psyllids initially increased gradually over each growing season, then exhibited a sharp late-season rise and a sharp decline as most fields were being harvested. Abundance of psyllids was higher at warmer, lower elevation sites, but infestation onset did not differ between growing regions. Fewer psyllids were collected in vacuum samples than in sticky trap samples. Nymphs and eggs were found only late season and during years with high abundance of adults. Overall incidence of Lso was similar among all years but one. The results presented here clarify our understanding of the seasonal phenology of potato psyllids and Lso in Idaho potato fields and will aid in developing integrated management strategies against this important pest of potato.

Using NextRAD sequencing to infer movement of herbivores among host plants.

Herbivores often move among spatially interspersed host plants, tracking high-quality resources through space and time. This dispersal is of particular interest for vectors of plant pathogens. Existing molecular tools to track such movement have yielded important insights, but often provide insufficient genetic resolution to infer spread at finer spatiotemporal scales. Here, we explore the use of Nextera-tagmented reductively-amplified DNA (NextRAD) sequencing to infer movement of a highly-mobile winged insect, the potato psyllid (Bactericera cockerelli), among host plants. The psyllid vectors the pathogen that causes zebra chip disease in potato (Solanum tuberosum), but understanding and managing the spread of this pathogen is limited by uncertainty about the insect's host plant(s) outside of the growing season. We identified 1,978 polymorphic loci among psyllids separated spatiotemporally on potato or in patches of bittersweet nightshade (S. dulcumara), a weedy plant proposed to be the source of potato-colonizing psyllids. A subset of the psyllids on potato exhibited genetic similarity to insects on nightshade, consistent with regular movement between these two host plants. However, a second subset of potato-collected psyllids was genetically distinct from those collected on bittersweet nightshade; this suggests that a currently unrecognized source, i.e., other nightshade patches or a third host-plant species, could be contributing to psyllid populations in potato. Oftentimes, dispersal of vectors of pathogens must be tracked at a fine scale in order to understand, predict, and manage disease spread. We demonstrate that emerging sequencing technologies that detect genome-wide SNPs of a vector can be used to infer such localized movement.

LIM-Only Protein FHL2 Is a Negative Regulator of Transforming Growth Factor ß1 Expression.

Transforming growth factor ß1 (TGF-ß1) is a master cytokine in many biological processes, including tissue homeostasis, epithelial-to-mesenchymal transition, and wound repair. Here, we report that four and a half LIM-only protein 2 (FHL2) is a critical regulator of TGF-ß1 expression. Devoid of a DNA-binding domain, FHL2 is a transcriptional cofactor that plays the role of coactivator or corepressor, depending on the cell and promoter contexts. We detected association of FHL2 with the TGF-ß1 promoter, which showed higher activity in Fhl2-/- cells than in wild-type (WT) cells in a reporter assay. Overexpression of FHL2 abrogates the activation of the TGF-ß1 promoter, whereas the upregulation of TGF-ß1 gene transcription correlates with reduced occupancy of FHL2 on the promoter. Moreover, ablation of FHL2 facilitates recruitment of RNA polymerase II on the TGF-ß1 promoter, suggesting that FHL2 may be involved in chromatin remodeling in the control of TGF-ß1 gene transcription. Enhanced expression of TGF-ß1 mRNA and cytokine was evidenced in the livers of Fhl2-/- mice. We tested the in vivo impact of Fhl2 loss on hepatic fibrogenesis that involves TGF-ß1 activation. Fhl2-/- mice developed more severe fibrosis than their WT counterparts. These results demonstrate the repressive function of FHL2 on TGF-ß1 expression and contribute to the understanding of the TGF-ß-mediated fibrogenic response.

Relative Abundance of Potato Psyllid Haplotypes in Southern Idaho Potato Fields During 2012 to 2015, and Incidence of 'Candidatus Liberibacter solanacearum' Causing Zebra Chip Disease.

Zebra chip (ZC) disease, a serious threat to the potato industry, is caused by the bacterium 'Candidatus Liberibacter solanacearum' (Lso). Five haplotypes (hapA to hapE) of this pathogen have been described so far in different crops, with only hapA and hapB being associated with ZC in potato. Both haplotypes are vectored and transmitted to a variety of solanaceaeous plants by the tomato/potato psyllid, Bactericera cockerelli (Sulc). Psyllids are native to North America, and four haplotypes have been identified and named based on their predominant geographic association: Northwestern, Central, Western, and Southwestern. Although all psyllid haplotypes have been found in southern Idaho potato fields, data on relative haplotype abundances and dynamic changes in the fields over time have not previously been reported. Here, psyllid samples collected in Idaho potato fields from 2012 to 2015 were used to clarify spatial and temporal patterns in distribution and abundance of psyllid and Lso haplotypes. A shift from hapA toward hapB population of Lso was revealed during these four seasons, indicating possible evolution of Lso in Idaho fields. Although we confirmed that Western psyllids were the most abundant by far during the four seasons of observation, we also observed changes in abundance of other haplotypes, including increased diversity of psyllid haplotypes during 2015. Seasonal changes observed for the Northwestern and Central haplotypes could potentially be linked to psyllid migration and/or habitat changes. South-central Idaho exhibited more diversity in psyllid haplotypes than southwestern Idaho.