[New ultra rapid test for detection of bacteria]. / Nouveau test ultrarapide pour la détection de bactéries.

INTRODUCTION: Bacteriological testing is aimed to reduce the risk of transmission of infections. However, the detection of Bacteria by culture requires from 18hours to 14 days and may produce erroneous results for fastidious species. The goal of this work was to design and validate a new tool for bacterial testing. METHODS: The test is based on the fast real-time PCR (frt PCR). The DNA extracted from samples containing internal controls are introduced into four tubes containing primers and probes for the frt PCR. The cycling program consists in 1×at 95°C for 10min and 45×(15s at 95°C, 8s) at 52°C and 10s at 72°C. RESULTS: The frt PCR detects 0,01 CFU/µl of Bacteria and identifies eight Genera without interferences from the environment or from fungi and with no need for melting curve analysis or additional sequencing. DISCUSSION: The frt PCR detects and quantifies Bacteria identifying and assessing the load of Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria. CONCLUSION: Cultures require at least 24hours but the new frt PCR reduces the time to 90minutes. Larger series of samples are necessary to confirm the usefulness of this new test for routine bacterial sterility controls.

New tool for the simultaneous detection of 10 different genotypes of Acanthamoeba available from the American Type Culture Collection.

BACKGROUND: Acanthamoeba keratitis (AK) is a sight-threatening infection, and none of the current diagnosis tests are able to detect in one reaction low levels of the vast majority of strains associated with pathology. The goal of this work was to validate a new tool for the detection of the American Type Cell Collection (ATCC) referenced Acanthamoeba monitoring simultaneously DNA extraction yields and PCR inhibitors. Performances were assessed on corneal scrapings. METHODS: Primers were selected in a region bracketing a 41 591 bp of the A castellanii mitochondrion gene. DNA extraction and PCR inhibitors were monitored by adding an internal control (virus). Acanthamoeba were detected and quantified by the real-time fast-duplex TaqMan PCR (f-d-real-t PCR) and negativity confirmed by SYBR Green real-time PCR. RESULTS: The f-d-real-t PCR detects 0.1 cyst/microl or less of the 10 referenced strains (sensitivity slightly lower for A astronyxis). Bacteria, fungi and herpesviruses do not cross-react. The specificity and sensitivity of the f-d-real-t PCR were higher than culture and other real-time PCR on 20 keratitis samples. CONCLUSION: The f-d-real t PCR detects in less than 2 h the Acanthamoeba strains available from the ATCC with a higher sensitivity and specificity than techniques previously reported. Larger trials are necessary to validate its usefulness for disease management and environmental studies.

New test for the diagnosis of bacterial endophthalmitis.

BACKGROUND: Diagnosis of bacterial endophthalmitis (BE) often fails due to: (1) insufficient volumes of vitreous fluid (VF) and aqueous humour (AH); (2) lack of sensitivity of culture; (3) antibiotic treatments; (4) polymerase chain reaction (PCR) cross-contamination; and (5) limitations on the interpretation of the real-time PCR melting curve. We developed a fast real-time (f-real-t) PCR to improve the performance of the laboratory diagnosis of BE. METHODS: The following samples were processed after adding an internal control: phosphate buffered saline (PBS); VF, AH and cell suspensions spiked with Bacteria (Bac); VF and AH from patients with endophthalmitis; and VF and AH from non-infective patients. DNA was extracted (MagNA Pure) and added to four tubes containing selected primers and probes for the identification and quantification of all Bac and eight genera by f-real-t PCR. Diagnostic performances based on direct microscopic examination, culture and f-real-t PCR were compared. RESULTS: The f-real-t PCR detected at least 0.01 colony-forming units (CFU) of Bac/microl with no cross-reactivity with fungi. Correlation with culture-positive results was 100%. Sixty per cent of BE samples tested culture-positive, but f-real-t PCR tested positive for 90%. Samples from non-infective cases were negative. CONCLUSION: The f-real-t PCR detected and quantified Bac, Staphylococci, Streptococci, Haemophilus, Pseudomonas, Enterobacteria, Acinetobacter, Propionibacteriacae and Corynebacteria in one run. Cultures required several hours to days (with a non-negligible number of false-negative results) and the f-real-t PCR was completed in 90 min. The f-real-t PCR is presented as a new tool for the diagnosis of BE: its usefulness requires validation with larger series of samples.

Rapid detection and quantification of Propionibacteriaceae.

BACKGROUND: Propionibacteriaceae (Propioni) are anaerobic bacteria associated with human and animal infections. Present-day methods of diagnosis for Propioni are unsatisfactory due to a lack of sensitivity of culture, time required for culture results (3 to 14 days) and difficulties in interpreting SYBR Green real-time PCR results. The goal of this work was to validate a new rapid and sensitive test for the diagnosis of Propioni infections (endophthalmitis, corneal ulcers and others). MATERIAL AND METHODS: DNA was extracted using the MagNA Pure isolation kit (Roche), and bacterial detection and quantification were carried out with a set of original primers and probe (5'ATACGTAGGGTGCGAGCGTTGTCC; 5'TGGTGTTCCTCCTGATATCTGCGC and [Amino C6+JOE]-GATCGCGTCGGAAGTGTAATCTTGGGG-Black Hole Quencher). The PCR cycling programme consisted of one cycle at 95 degrees C, 20 s and 45 cycles at 95 degrees C, 3 s and 30 s at 60 degrees C. DNA extraction yields were assessed in the same tube. RESULTS: This test detects as few as 0.01 Equivalent PFU/microl Propioni in phosphate-buffered saline (PBS), aqueous humour, vitreous or cell suspensions. Propioni is detected as a single contaminant or mixed with other bacteria, fungi or human cells. CONCLUSION: The new real-time PCR is able to detect 0.01 Eq/CFU microl of Propioni suspended in PBS, vitreous, aqueous humour and human cells in less than 1.30 h.

Resistance of Acanthamoeba to classic DNA extraction methods used for the diagnosis of corneal infections.

AIMS: Sensitive diagnosis of Acanthamoeba infections may prevent the clinical condition from becoming worse. In order to improve the diagnosis tool performances, we studied the implication of the DNA extraction procedures on the detection of Acanthamoeba by real-time PCR. METHODS: Acanthamoeba cysts mixed with a tag virus were processed according to different DNA preparation procedures: heat, Proteinase K (ProtK), alkali lysis, QIAmp kit, MagNA Pure (DNA Mini kit, MagNA Pure Nucleic Acid isolation kit), ProtK+QIAmp and ProtK+MagNA Pure. Parasite-DNA loads were assessed by real-time PCR. RESULTS: The results show that the structures of Acanthamoeba cysts are resistant to reagents releasing the DNA from other cells and viruses. Heat, NaOH or ProtK did not allow the DNA extraction yields to be assessed or the inhibitors to be eliminated The QIAmp and the MagNA Pure partially improved the sensitivity of the PCR and eliminated the inhibitors. A significant increase in positive results was obtained with a ProtK treatment before commercial extraction kits. ProtK+MagNA Pure yielded the highest rates of positivity. CONCLUSION: To minimise false negative results, the nucleic-acid based Acanthamoeba diagnosis requires, first, the efficient lysis of cysts (without affecting the DNA) to make the DNA available for extraction and amplification, and, second, the elimination of PCR inhibitors. A significant increase in the detection rates is obtained by adding a ProtK treatment (10 min at 56 degrees C) before the commercial procedures. ProtK+MagNA Pure yielded the best results in 30 min, followed by ProtK+QIAmp (150 min).