Identification of novel pathogenic copy number variations in Charcot-Marie-Tooth disease.

Charcot-Marie-Tooth disease (CMT) is a hereditary sensory-motor neuropathy characterized by a strong clinical and genetic heterogeneity. Over the past few years, with the occurrence of whole-exome sequencing (WES) or whole-genome sequencing (WGS), the molecular diagnosis rate has been improved by allowing the screening of more than 80 genes at one time. In CMT, except the recurrent PMP22 duplication accounting for about 60% of pathogenic variations, pathogenic copy number variations (CNVs) are rarely reported and only a few studies screening specifically CNVs have been performed. The aim of the present study was to screen for CNVs in the most prevalent genes associated with CMT in a cohort of 200 patients negative for the PMP22 duplication. CNVs were screened using the Exome Depth software on next generation sequencing (NGS) data obtained by targeted capture and sequencing of a panel of 81 CMT associated genes. Deleterious CNVs were identified in four patients (2%), in four genes: GDAP1, LRSAM1, GAN, and FGD4. All CNVs were confirmed by high-resolution oligonucleotide array Comparative Genomic Hybridization (aCGH) and/or quantitative PCR. By identifying four new CNVs in four different genes, we demonstrate that, although they are rare mutational events in CMT, CNVs might contribute significantly to mutational spectrum of Charcot-Marie-Tooth disease and should be searched in routine NGS diagnosis. This strategy increases the molecular diagnosis rate of patients with neuropathy.

Molecular screening of MECP2 gene in a cohort of Lebanese patients suspected with Rett syndrome: report on a mild case with a novel indel mutation.

BACKGROUND: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the MECP2 gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. METHODS: We report here the molecular study of two isoforms, MECP2_e1 and MECP2_e2, in 45 Lebanese girls presenting developmental delay and at least one of the following features: microcephaly, neurodegeneration, abnormal behaviour, stereotypical hand movements, teeth grinding and difficulty in walking. Mutation screening was performed by denaturating high-performance liquid chromatography combined with direct sequencing. RESULTS: Sixteen variants were noted, of which 14 have been previously reported: five suspected polymorphisms and nine mutations. Two variants were novel mutations in exon 4: c.1093_1095delGAG (p.E365del) and c.1164_1184delACCTCCACCTGAGCCCGAGAGinsCTGAGCCCCAGGACTTGAGCA (p.P388PfsX389). The deletion was found in an 8-year-old girl with typical clinical features of RTT. The indel was found in a 6-year-old girl with a very mild phenotype. CONCLUSION: Genotype/phenotype correlation is discussed and the importance of a molecular study of MECP2 gene in patients with very mild features or a regression after the age of 2 is raised.

A novel deletion in ZBTB24 in a Lebanese family with immunodeficiency, centromeric instability, and facial anomalies syndrome type 2.

The immunodeficiency, centromeric instability and facial anomalies (ICF) syndrome is a rare autosomal recessive disease characterized by targeted chromosome breakage, directly related to a genomic methylation defect. It manifests with phenotypic and clinical variability, with the most consistent features being developmental delay, facial anomalies, cytogenetic defects and immunodeficiency with a reduction in serum immunoglobulin levels. From the molecular point of view, ICF syndrome was always divided into ICF type I (ICF1) and ICF type 2 (ICF2). Mutations in DNMT3B gene are responsible for ICF1, while mutations in ZBTB24 have been reported to be responsible for ICF2. In this study, we describe a Lebanese family with three ICF2 affected brothers. Sanger sequencing of the coding sequence of ZBTB24 gene was conducted and revealed a novel deletion: c.396_397delTA (p.His132Glnfs*19), resulting in a loss-of-function of the corresponding protein. ZBTB24 belongs to a large family of transcriptional factors and may be involved in DNA methylation of juxtacentromeric DNA. Detailed molecular and functional studies of the ZBTB24 and DNMT3B genes are needed to understand the pathophysiology of ICF syndrome.

A novel locus for autosomal recessive primary torsion dystonia (DYT17) maps to 20p11.22-q13.12.

Primary torsion dystonia is a clinically and genetically heterogeneous group of movement disorders. Fifteen different types of dystonia have been described to date, of whom 14 loci have been mapped, but only seven genes identified. Several different modes of inheritance have been described, including autosomal dominant transmission with reduced penetrance (12 loci), recessive X-linked (one locus), and autosomal recessive transmission (three loci). In this study, we describe the localization of a novel form of autosomal recessive, primary focal torsion dystonia using a genomewide search in a large consanguineous Lebanese family with three affected individuals. Homozygosity mapping with 382 microsatellite markers was conducted. Linkage analysis and haplotype construction allowed us to identify a novel locus designated as DYT17, within a 20.5-Mb interval on chromosome 20. Of the 270 known genes spread on this interval, 27 candidate genes were tested and excluded as responsible for the disease. Fine mapping by identification of other dystonia families linked to chromosome 20 and sequencing of candidate genes in the refined interval is required in order to identify the causative gene in DYT17.

Founder effect and estimation of the age of the c.892C>T (p.Arg298Cys) mutation in LMNA associated to Charcot-Marie-Tooth subtype CMT2B1 in families from North Western Africa.

CMT2B1, an axonal subtype (MIM 605588) of the Charcot-Marie-Tooth disease, is an autosomal recessive motor and sensory neuropathy characterized by progressive muscular and sensory loss in the distal extremities with chronic distal weakness. The genetic defect associated with the disease is, to date, a unique homozygous missense mutation, p.Arg298Cys (c.892C>T), in the LMNA gene. So far, this mutation has only been found in affected individuals originating from a restricted region of North Western Africa (northwest of Algeria and east of Morocco), strongly suggesting a founder effect. In order to address this hypothesis, genotyping of both STRs and intragenic SNPs was performed at the LMNA locus, at chromosome 1q21.2-q21.3, in 42 individuals affected with CMT2B1 from 25 Algerian families. Our results indicate that the affected individuals share a common ancestral haplotype in a region of about 1.0 Mb (1 cM) and that the most recent common ancestor would have lived about 800-900 years ago (95% confidence interval: 550 to 1300 years).

Population structure in the Mediterranean basin: a Y chromosome perspective.

The Mediterranean region has been characterised by a number of pre-historical and historical demographic events whose legacy on the current genetic landscape is still a matter of debate. In order to investigate the degree of population structure across the Mediterranean, we have investigated Y chromosome variation in a large dataset of Mediterranean populations, 11 of which are first described here. Our analyses identify four main clusters in the Mediterranean that can be labelled as North Africa, Arab, Central-East and West Mediterranean. In particular, Near Eastern samples tend to separate according to the presence of Arab Y chromosome lineages, suggesting that the Arab expansion played a major role in shaping the current genetic structuring within the Fertile Crescent.

Revisiting the craniosynostosis-radial ray hypoplasia association: Baller-Gerold syndrome caused by mutations in the RECQL4 gene.

Baller-Gerold syndrome (BGS) is a rare autosomal recessive condition with radial aplasia/hypoplasia and craniosynostosis (OMIM 218600). Of >20 cases reported so far, a few appear atypical and have been reassigned to other nosologic entities, including Fanconi anaemia, Roberts SC phocomelia, and Pfeiffer syndromes after demonstration of corresponding cytogenetic or molecular abnormalities. Clinical overlap between BGS, Rothmund-Thomson syndrome (RTS), and RAPADILINO syndrome is noticeable. Because patients with RAPADILINO syndrome and a subset of patients with RTS have RECQL4 mutations, we reassessed two previously reported BGS families and found causal mutations in RECQL4 in both. In the first family, four affected offspring had craniosynostosis and radial defect and one of them developed poikiloderma. In this family, compound heterozygosity for a R1021W missense mutation and a g.2886delT frameshift mutation of exon 9 was found. In the second family, the affected male had craniosynostosis, radial ray defect, poikiloderma, and short stature. He had a homozygous splice site mutation (IVS17-2A>C). In both families, the affected offspring had craniosynostosis, radial defects, and growth retardation, and two developed poikiloderma. Our results confirm that BGS in a subgroup of patients is due to RECQL4 mutations and could be integrated into a clinical spectrum that encompasses RTS and RAPADILINO syndrome.

An autosomal recessive cerebellar ataxia syndrome with upward gaze palsy, neuropathy, and seizures.

The authors describe three siblings born to consanguineous parents with early onset ataxia, dysarthria, myoclonic, generalized tonic clonic seizures, upward gaze palsy, extensor plantar reflexes, sensory neuropathy, and normal cognition. Direct screening excluded mutations in FRDA, TDP1,and SACS genes and at 8344, 3243, and 8993 positions of mitochondrial DNA. Linkage analysis excluded AOA-1, EPM1, EPM2A, EPM2B, CAMOS, and recessive ataxias linked to chromosome 9q34-9qter. This clinical constellation may represent a distinct form of early onset cerebellar ataxia.

Nonprogressive autosomal recessive ataxia maps to chromosome 9q34-9qter in a large consanguineous Lebanese family.

Congenital ataxias are a heterogeneous group of predominantly nonprogressive disorders characterized by hypotonia, developmental delay followed by the appearance of ataxia, and often associated with dysarthria, mental retardation, and atrophy of the cerebellum. We performed a genome-wide screen on a large inbred Lebanese family presenting a nonprogressive autosomal recessive congenital cerebellar ataxia associated with short stature (MIM 213200), already described by Mégarbané and colleagues. The disease locus was assigned to a 12.1 cM interval on chromosome 9q34-9qter between D9S67 and D9S312. Differential diagnosis with other hereditary ataxias linked to the same region is discussed.

New autosomal recessive cerebellar ataxia disorder in a large inbred Lebanese family.

A large inbred Lebanese pedigree with congenital spastic ataxia, microcephaly, optic atrophy, short stature, speech defect, abnormal osmiophilic pattern of skin vessels, cerebellar atrophy, and severe mental retardation transmitted as an autosomal recessive trait has been studied. None of the children had any evidence of a metabolic disease, and the analysis of respiratory chain complex abnormalities was unremarkable. Only one child had a history of perinatal difficulties. Differential diagnosis and the possibility that this disorder is a hitherto unreported one are discussed.

Segregation of a mutation in CNGB1 encoding the beta-subunit of the rod cGMP-gated channel in a family with autosomal recessive retinitis pigmentosa.

Retinitis pigmentosa (RP) is a clinically and genetically heterogeneous group of retinal diseases leading to blindness. By performing full genome linkage analysis in a consanguineous French family affected with severe autosomal recessive RP, we have excluded linkage to known loci involved in RP and mapped a novel locus to chromosome 16q13-q21 (Zmax=2.83 at theta=0 at the D16S3089 locus). Two candidate genes KIFC3 and CNGB1 mapping to this critical interval have been screened for mutations. The CNGB1 gene, which encodes the beta-subunit of the rod cGMP-gated channel, is mutated in the family presented in this study.

A mutation in periaxin is responsible for CMT4F, an autosomal recessive form of Charcot-Marie-Tooth disease.

Charcot-Marie-Tooth (CMT) disease is a heterogeneous group of inherited peripheral motor and sensory neuropathies characterized by chronic distal weakness with progressive muscular atrophy and sensory loss in the distal extremities. Inheritance can be autosomal dominant, X-linked or autosomal recessive (ARCMT). Recently, a locus responsible for a demyelinating form of ARCMT disease, named CMT4F, has been mapped on 19q13 in a large consanguineous Lebanese family. L- and S-periaxin are proteins of myelinating Schwann cells and homozygous periaxin-null mice display extensive demyelination of myelinated fibers in the peripheral nervous system, which suggests that the periaxin gene is a good candidate gene for an ARCMT disease. The human gene encoding the periaxins (PRX) was mapped to 19q13, in the CMT4F candidate interval. After characterizing the human PRX gene, we identified a nonsense R196X mutation in the Lebanese family which cosegregated with CMT. Histopathological and immunohistochemical analysis of a sural nerve biopsy of one patient revealed common features with the mouse mutant and the absence of L-periaxin from the myelin sheath. These data confirm the importance of the periaxin proteins to normal Schwann cell function and substantiate the utility of the periaxin-null mouse as a model of ARCMT disease.

Familial Mediterranean fever in Lebanon: mutation spectrum, evidence for cases in Maronites, Greek orthodoxes, Greek catholics, Syriacs and Chiites and for an association between amyloidosis and M694V and M694I mutations.

Seventy-nine unrelated Lebanese patients were tested for 15 mutations in the MEFV gene: A761H, A744S, V726A, K695R, M694V, M694I, M694del, M6801 (G --> C), M680I (G --> A) in exon 10, F479L in exon 5, P369S in exon 3, T267I, E167D and E148Q in exon 2, using PCR digestion, ARMS, DGGE and/or sequencing. Mutations were detected in patients belonging to all communities, most interestingly the Maronite, Greek orthodox, Greek catholic, Syriac and Chiite communities. The most frequent mutations are M694V and V726A (27% and 20% of the total alleles respectively). M694I, E148Q and M680I mutations account respectively for 9%, 8% and 5%. Each of the K695R, E167D and F479L mutations was observed once and all the remaining mutations were not encountered. Of the alleles 33% do not carry any of the studied mutations. The mutation spectra, clinical features and severity of the disease differed among the Lebanese communities. The genotype-phenotype analysis showed a significant association (P < 0.001) between amyloidosis and the presence of mutations at codon 694 in exon 10 (both M694V and M694I). None of the patients carrying other mutations developed amyloidosis.

Familial Mediterranean Fever: association of elevated IgD plasma levels with specific MEFV mutations.

Familial Mediterranean Fever (FMF) is a recessively inherited disorder, characterized by episodic fever, abdominal and arthritic pain, as well as other forms of inflammation. Some FMF patients present higher IgD serum levels, and it is not yet known whether such an elevation is related to specific genotypes or correlated with a specific phenotype. In order to evaluate the association between known FMF-related mutations and IgD levels in confirmed patients, as well as the correlation between those levels and the presence of specific clinical signs, genotypic analysis and IgD plasma measurements were performed for 148 Lebanese and Jordanian FMF patients. Most common mutational patterns were M694V heterozygotes (19%) and homozygotes (17%), and V726A heterozygotes (18%) and homozygotes (5%), with an additional 11% combining both mutations. Twenty-one patients had higher IgD levels (superior to 100 microg/ml). The risk for higher IgD levels was significantly associated with M694V homozygote status (OR = 6.25) but not with heterozygotic one (OR = 1). Similarly, the risk for higher IgD was also found with V726A homozygotes (OR = 2.2) but not with heterozygotes (OR = 1.05). The use of colchicine was not statistically associated with IgD levels. Clinically, hyper IgD was also found significantly associated with arthritis (OR = 18). Thus, homozygotic status for M694V, and to a lesser extent V726A, is associated with increased risk for higher IgD plasma levels, regardless of colchicine use. Elevated IgD plasma levels are also correlated with the severity of FMF manifestations, and especially with arthritis.

Mutational analysis in Lebanese patients with congenital adrenal hyperplasia due to a deficit in 21-hydroxylase.

Molecular defects in the gene encoding steroid 21-hydroxylase (CYP21) result in impairment of adrenal steroid synthesis in patients affected with autosomal-recessive congenital adrenal hyperplasias (CAH). In this study, we report on the molecular screening of six point mutations, large deletions, gene conversion events and duplications in 25 unrelated Lebanese families affected by CAH due to steroid 21-hydroxylase. The methods used (PCR-digestion and southern blot) allowed the detection of 96% of the disease chromosomes. In classical forms, the most frequent mutation was the splice site mutation in intron 2 accounting for 39% of the disease alleles. Gene conversion events accounted for 14% of the alleles, but no large deletions were found. In nonclassical forms, the V281L mutation in exon 7 represent 86% of the tested alleles. Genotype-phenotype correlations were as expected: Delta 8nt, Q318X and gene conversion correspond to SW forms, whereas the intron 2 splice site mutation may give either SW or SV forms; the V281L mutation was responsible for nonclassical forms. The spectrum of mutations underlines the genetic diversity of the Lebanese population. No correlation could be drawn out between mutations and some specific religious communities, except for the Delta 8nt mutation, which is present only in the Christian Maronite group. Molecular study of the CYP21 gene might constitute a good support for clinicians, especially in consanguineous families, for whom we could provide genetic counselling.