[RET/PTC rearrangement affects multifocal formation of papillary thyroid carcinoma].

Objective:RET/PTC gene rearrangement can lead to aberrant activation of tyrosine kinase receptors, which is a common mutation in papillary thyroid carcinoma (PTC). This study focuses on the association of RET/PTC rearrangements with PTC clinical factors. Methods: From January 2011 to December 2013, a total of 114 patients with PTC were enrolled in this study. Clinicopathological parameters, lifestyle, and thyroid hormone levels were collected. RET/PTC rearrangements were detected by TaqMan PCR and verified by Sanger sequencing.Data were analyzed with SPSS software, including chi-square test, Fisher's exact test, Mann-Whitney U test, Student's t-test, and Logistic regression. Results:RET/PTC rearrangements were not found in all paracancerous normal thyroid tissues, and were detected in 23.68% (27/114) of PTC. Further analysis revealed no correlation between RET/PTC rearrangement and thyroid function, clinicopathologic parameters, and lifestyle in the total PTC group or in the subgroup of patients with concomitant diseases (including Hashimoto's thyroiditis and nodular goiter). But in the subgroup of PTC without concomitant disease, RET/PTC rearrangement was associated with tumor multifocal (P=0.018), and RET/PTC-positive PTC patients had an increased risk of tumor multifocal (OR=5.57, 95% CI 1.39-22.33). It was also found that RET/PTC rearrangement was associated with an abnormal increase in TSH level of one month after surgery (P= 0.037). Conclusion: Nodular goiter and Hashimoto 's thyroiditis may be a confounding factor in PTC. RET/PTC rearrangement may play an important role in the occurrence of thyroid carcinoma multifocal after exclusion of this confounding factor.

First Report of Euphorbia leaf curl virus and Papaya leaf curl Guangdong virus on Passion Fruit in Taiwan.

Passion fruit (Passiflora edulis × Passiflora edulis f. flavicarpa) 'Tainung No. 1' is the main variety cultivated in Taiwan, which is a hybrid and propagated only by grafting. In the spring of 2011, plants with systemic mottle and malformation on leaves were found in some orchards located in Puli and Nantou in central Taiwan. Interestingly, after 3 months of growth, most of these diseased plants became symptomless when the weather became warmer. Nevertheless, some striped concaves were observed on immature fruit surfaces of diseased plants. In March of 2011, two leaf samples exhibiting mosaic and three samples showing malformation were collected and tested by DAS-ELISA; none positively reacted with antibodies against the Cucumber mosaic virus (CMV), East Asian passiflora virus (EAPV), Passion fruit mottle virus (PaMV), or Passion fruit crinkle virus (PCV) that have previously occurred in Taiwan. Rolling-circle amplification (RCA) with hexamer primers were adopted to analyze potential begomoviruses that were prevalent on the other crops in Taiwan (3). The RCA amplified products were digested with BamHI and separated on 1.2% agarose by gel electrophoresis. A fragment, about 3 kb, was purified from each gel and cloned into the respective site of pBluescript SK(-) individually. Clones were screened by EcoRI digestion and two types of restriction fragment length patterns were found among them. One type of a clone containing 2,745 nucleotides (Accession No. KC161185) with 98.5% identity to Euphorbia leaf curl virus (EuLCV) (1) and the other type of a clone containing 2,732 nucleotides (KC161184) with 91.7% identity to Papaya leaf curl Guangdong virus (PaLCuGDV) (2) were revealed by nucleotide comparisons of their DNA-A in GenBank. Accordingly, we confirmed the existence of passiflora isolates of EuLCV and PaLCuGDV. PCR primers CPup/Edw/Pdw (5'TGTGAAGG(A/C/G/T)CC(A/G/T)TGTAA(A/G)GT3'/5'CGCAGTTT CTGGAGGATATTAAG3'/5'TCGCATGCCACTTCCTCAGT3') were designed to differentiate these viruses by amplifying a 235 bp DNA fragment for EuLCV and 345 bp for PaLCuGDV. In a brief survey, all 26 passion fruit leaf samples collected from seven orchards were double infected with EuLCV and PaLCuGDV; only six samples collected from a specific orchard were found to harbor the PaLCuGDV infection. Thirty-seven seedlings from passion fruit (P. edulis f. flavicarpa) seeds were indexed and all were free from both viruses. Five virus-free plantlets of P. edulis f. flavicarpa, one EuLCV and PalCuGDV double infected P. edulis × P. edulis f. flavicarpa, and 20 whiteflies were put into one net tent for 2 months, and then the five plantlets were tested by PCR. The two EuLCV and PalCuGDV specific fragments were amplified from all five plantlets. The two begomoviruses cause mild symptoms on passion fruit plant but the appearance of the fruit was affected. To our knowledge, this is the first report of begomoviruses infecting passion fruit in Taiwan and in Asia. References: (1) X. Ma et al. J. Phytopathol. 152:215. (2) X. Wang et al. Virus Genes 29:303. (3) C. Wu et al. J. Virol. Methods 147:355.

First Report of Maize chlorotic mottle virus on Sweet Corn in Taiwan.

In February 2014, a severe disease on maize (Zea mays L.) broke out in the fields of central and southwestern Taiwan and caused yield losses in sweet corn production. Chlorotic spots first appeared at the base of infected leaves and later developed into systemic mottling. Diffused necrotic patches were also found on leaves or husks of the diseased plants. Moreover, severe rosetting and stunting accompanied by abnormalities in ear production were observed on mature plants. Eighteen leaf samples from symptomatic plants were collected and submitted to our Plant Diagnostic Clinic for virus diagnosis. All of the samples were first tested by reverse transcriptase (RT)-PCR to detect Maize stripe virus (MSpV) and by indirect ELISA to detect Maize dwarf mosaic virus (MDMV) or Sugarcane mosaic virus (SCMV), which were endemic to this area (1). Only 2 out of 18 samples were positive for MDMV, SCMV, or mixed infection of both viruses. Sap inoculation tests conducted on seedlings of sweet corn cv. Honey 236 indicated that the MDMV- and SCMV-negative samples still had an unknown pathogen causing original symptoms in the receptor plants. The isolate from Yunlin county reacted only with the antibody to Maize chlorotic mottle virus (MCMV) (AC Diagnostics, Fayetteville, AR) in ELISA. For further identification, the MCMV-specific primers (forward: MCMVg3514F-GGGAACAACCTGCTCCA; reverse MCMVg4014R-GGACACGGAGTACGAGA) were designed from the nucleotide sequence of MCMV coat protein (CP) gene. In RT-PCR using the AccuPower RT/PCR PreMix kit (Bioneer, Daejeon, Korea), an expected 500-bp DNA fragment was observed. This PCR product was cloned and its nucleotide sequence was determined by Mission Biotech Co., Taipei, Taiwan. BLAST analysis of the CP gene of the MCMV-Yunlin revealed the maximum nucleotide identities (99%) with Chinese Sichuan isolates (GenBank Accession No. JQ984270) and 98% identities to four Chinese Yunnan isolates (GU138674, JQ982468, JQ982469, and KF010583) and one Kenya isolate (JX286709), compared with 97% to Kansas isolate (X14736) and 96% to Nebraska isolate (EU358605). Subsequently, the complete nucleotide sequence of the viral genome (KJ782300) was determined from five overlapping DNA fragments obtained from independent RT-PCR amplification. The virus isolate was infectious to sweet corn cultivars Bai-long-wang, Devotion, SC-34, SC2015, and Zheng-zi-mi, on which similar symptoms were developed after mechanical inoculation. During the spring of 2014, a total of 224 sweet corn samples were collected from the epidemic areas of Taichung, Yunlin, Chiayi, and Kaohsiung counties. Samples (n= 161) reacted positive for MCMV in ELISA and/or RT-PCR. In the field survey, more than 20 adult thrips might be observed on an MCMV-infected plant. Two species of Frankliniella were found on maize plants: F. williamsi Hood and F. intonsa Trybom. Maize thrips (F. williamsi), an occasional pest of maize occurring during winter and spring in Taiwan, was characterized by its abdominal sternite II on which 1 or 2 discal setae of equal length with posteromarginal setae were borne (2). Samples with 1, 5, 10, and 30 F. williamsi collected in the field were tested by RT-PCR; MCMV was detectable not only in the pooled crushed bodies but also in a single maize thrips. This is the first report of MCMV occurrence on maize in Taiwan and of the virus transmitted by maize thrips. References: (1) C. T. Chen et al. Taiwan Sugar 37(4):9, 1990. (2) C.-L. Wang et al. Zool. Stud. 49:824, 2010.

First Report of Pepper mottle virus in Bell Pepper in Taiwan.

Bell pepper (Capsicum annuum L.) plants exhibiting systemic mild mosaic, vein yellowing, and leaf malformation were collected from Puli City in 2006. Double-antibody sandwich (DAS)-ELISA was used to test these samples for Chilli veinal mottle virus (ChiVMV) infection using polyclonal antibodies. In addition, Chenopodium quinoa, C. amaranticolor, and Nicotiana benthamiana plants were mechanically inoculated with sap extracted from collected samples. Ten days postinoculation, chlorotic local lesions were observed on inoculated leaves of C. quinoa and C. amaranticolor plants, whereas, systemic mosaic and foliar distortion symptoms were developed on upper leaves of N. benthamiana plants. The DAS-ELISA test showed that field-collected pepper samples and inoculated leaves of C. quinoa and C. amaranticolor were infected with ChiVMV, while N. benthamiana with mosaic symptoms did not react with ChiVMV antibodies. To confirm ChiVMV, field-collected samples as well as mechanically inoculated plants were tested by reverse transcription (RT)-PCR using the potyvirus degenerate primers Hrp5/Pot1 (2). Amplified RT-PCR products were cloned and sequenced. Sequence analysis of amplified fragments (1.4 kb) revealed that field-collected pepper samples were infected with ChiVMV and Pepper mottle virus (PepMoV). The DNA fragment amplified from C. quinoa and C. amaranticolor showed high (99.2%) sequence identities with the CP gene of ChiVMV (3) (GenBank Accession No. AM909717). However, amplicons obtained from N. benthamiana plants (GenBank Accession No. HQ329082) that showed mosaic symptoms showed 83.6% to 98.7% nucleotide identities with PepMoV (GenBank Accession Nos. AB126033, AF227728, AF440801, AF501591, EU586133, and M96425). Next, a pure isolate of PepMoV was established on N. benthamiana by mechanical inoculation of diluted plant sap obtained from a PepMoV-infected N. benthamiana plant. Bell pepper plants inoculated with the Taiwan isolate of PepMoV developed mosaic and leaf distortion symptoms. Antiserum against the PepMoV Taiwan isolate was subsequently prepared by immunizing rabbits with purified virus particles. Using the prepared antiserum and specific primers (1) to detect PepMoV, ChiVMV, and Pepper veinal mottle virus (PVMV), three viruses could be readily detected and differentiated from diseased bell peppers in the field. In a survey done in 2007, 18 of 33 pepper samples from southern Taiwan were found with mixed infections of PepMoV and ChiVMV, seven samples were infected with PepMoV and PVMV, five samples were infected with PVMV, and another three samples were infected with ChiVMV. To our knowledge, this is the first report of the occurrence of PepMoV in bell peppers in Taiwan. References: (1) Y. H. Cheng et al. Plant Dis. 93:107, 2009. (2) S. S. Pappu et al. Plant Dis. 82:1121, 1998. (3) W. S. Tsai et al. Plant Pathol. 58:408, 2008.

First Report of Cucumber mosaic virus on Vigna marina in Taiwan.

Vigna marina (Burm.) Merr., the dune bean or notched cowpea, is a tropical creeping vine that grows on sand dunes along the coastal regions of Taiwan. Although V. marina is a weed, some varieties are also grown for fodder and food. This legume is a natural host of Bean common mosaic virus in the Solomon Islands (1) and Alfalfa mosaic virus or Beet western yellows virus in Australia (2). In April 2009, plants of V. marina showing severe mosaic and chlorotic ringspots on the foliage were found in the coastal region of Hualien County in eastern Taiwan. Indirect ELISA on a single diseased plant showed positive results with antibodies against the cucumber isolate of Cucumber mosaic virus (CMV) but negative to Broad bean wilt virus-1, Broad bean wilt virus-2, and some potyviruses (Agdia Inc., Elkhart, IN). A pure isolate of CMV was obtained from V. marina through three successive passages of single lesion isolation in sap-inoculated Chenopodium quinoa. Results of mechanical inoculations showed that the CMV-V. marina isolate was successfully transmitted to C. amaranticolor, C. murale, C. quinoa, Chrysanthemum coronarium, Gomphrena globosa, Nicotiana benthamiana, N. tabacum cv. Vam-Hicks, Phaseolus limensis, P. lunatus, P. vulgaris, Tetragonia tetragonioides, V. marina, V. radiata, and V. unguiculata subsp. sesquipedalis. These results of artificial inoculations were confirmed by ELISA. Homologous reactions of the CMV-V. marina isolate with a stock polyclonal antiserum against the CMV-cucumber isolate (4) were observed in sodium dodecyl sulfate-immunodiffusion. To determine the specific CMV subgroup, total RNA was extracted from inoculated leaves of C. quinoa using the Total Plant RNA Extraction Miniprep System (Viogene, Sunnyvale, CA). A DNA fragment of 940 bp covering the 3' end of the coat protein gene and C-terminal noncoding region of RNA-3 was amplified using the Cucumovirus-specific primers (3) after reverse transcription (RT)-PCR with AccuPower RT/PCR PreMix Kit (Bioneer, Daejeon, Korea). The product was gel purified by Micro-Elute DNA/Clean Extraction Kit (GeneMark Technology Co., Tainan, Taiwan) and cloned in yT&A Cloning Vector System (Yeastern Biotech Co., Taipei, Taiwan) for sequencing (Mission Biotech Co., Taipei, Taiwan) and the sequence was submitted to GenBank (No. HM015286). Pairwise comparisons of the sequence of CMV-V. marina isolate with corresponding sequences of other CMV isolates revealed the maximum (95 to 96%) nucleotide identities with CMV subgroup IB isolates (strains Nt9 and Tfn) compared with 94 to 95% identities with subgroup IA isolates (strains Y and Fny) or 77 to 78% identities with subgroup II (strains LS and Q). These results suggest that CMV is the causal agent for the mosaic disease of V. marina in Taiwan and the isolate belongs to subgroup I. To our knowledge, this is the first report of V. marina as a natural host of CMV. This strain of CMV with specific pathogenicity could threaten crop production in the coastal zones. In addition, V. marina associated with native coastal vegetation was injured by CMV infection, which might lead to ecological impacts on shoreline fading. References: (1) A. A. Brunt. Surveys for Plant Viruses and Virus Diseases in Solomon Islands. FAO, Rome, 1987. (2) C. Büchen-Osmond, ed. Viruses of Plants in Australia. Retrieved from http://www.ictvdb.rothamsted.ac.uk/Aussi/aussi.htm . September, 2002. (3) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (4) S. H. Hseu et al. Plant Prot. Bull. (Taiwan) 29:233, 1987.

Full-length sequence analysis of a distinct isolate of Bidens mottle virus infecting sunflower in Taiwan.

The full-length genome of a potyvirus, previously known as sunflower chlorotic spot virus isolate SF-1 (SCSV-SF-1) which causes novel symptoms on sunflowers (Helianthus annuus), was sequenced and analyzed. The genome of SCSV-SF-1 is 9,741 nucleotides long, encoding a polyprotein of 3,071 amino acids containing the consensus motifs of potyviruses. Sequence comparison revealed that the 3'-terminus of SCSV-SF-1 shared over 96% similarities with isolates of Bidens mottle virus (BiMoV). However, SCSV-SF-1 has a very narrow host range, excluding the diagnostic host species for BiMoV, Bidens pilosa and Zinnia elegans. Therefore, SCSV-SF-1 is a distinct isolate of BiMoV. This is the first report of the full-length nucleotide sequence of BiMoV infecting sunflower in Taiwan.

Differentiation of Allium carlaviruses isolated from different parts of the world based on the viral coat protein sequence.

Common primers which amplify the 3' terminal genomic RNAs of Allium carlaviruses were designed based on the nucleotide sequence of shallot latent virus (SLV), garlic latent virus (GLV) and garlic common latent virus (GCLV). A total of fifteen cDNAs encoding the coat protein (CP) of the carlaviruses, including the biologically identified isolates SLV, GLV and GCLV as well as viruses from infected Allium plants cultivated in different parts of the world, were amplified by RT-PCR with the common primers. The cDNAs were then cloned and sequenced. The predicted viral CP amino acid sequence as well as the nucleotide sequence revealed that SLV and GLV, previously considered as separate viruses on the basis of their biological and physical properties, belong to the same species of the genus Carlavirus. Both viruses are clearly differentiated from GCLV. In addition, every SLV and GLV isolate from the Allium plants in Taiwan showed characteristic and common variations in their CP sequences, suggesting the possible presence of geographical variants. However, no apparent sequence variations of SLV and GLV related to their host plant species, including A. sativum, A. wakegi, A. chinense, A. fistulosum, A. cepa and A. ampeloprasum, were observed. These findings suggested that the sequence variations observed in the respective virus isolates do not correlate with the specificity of their infectivities for Allium species.