Evaluation of Soybean for Resistance to Neohyadatothrips variabilis (Thysanoptera: Thripidae) Noninfected and Infected With Soybean Vein Necrosis Virus.

Soybean vein necrosis virus (SVNV) was first identified in Arkansas and Tennessee in 2008 and is now known to be widespread in the United States and Canada. Multiple species of thrips transmit this and other tospoviruses with Neohydatothrips variabilis (Beach) (soybean thrips) cited as the most efficient vector for SVNV. In this study, 18 soybean, Glycine max (L.) Merr., genotypes were evaluated in four experiments by infesting plants with noninfected and SVNV-infected thrips using choice and no-choice assays. In both choice experiments with noninfected and SVNV-infected thrips, the lowest number of immature soybean thrips occurred on plant introductions (PIs) 229358 and 604464 while cultivars Williams 82 and Williamsfield Illini 3590N supported higher counts of mature thrips. The counts between the two assays (noninfected and SVNV-infected thrips) were positively correlated. In both no-choice experiments with noninfected and SVNV-infected thrips, counts of thrips did not differ by soybean genotypes. Further studies are needed to characterize the inheritance and mechanisms involved in the resistance found in the choice assay.

Soybean mosaic virus: a successful potyvirus with a wide distribution but restricted natural host range.

TAXONOMY: Soybean mosaic virus (SMV) is a species within the genus Potyvirus, family Potyviridae, which includes almost one-quarter of all known plant RNA viruses affecting agriculturally important plants. The Potyvirus genus is the largest of all genera of plant RNA viruses with 160 species. PARTICLE: The filamentous particles of SMV, typical of potyviruses, are about 7500 Å long and 120 Å in diameter with a central hole of about 15 Å in diameter. Coat protein residues are arranged in helices of about 34 Å pitch having slightly less than nine subunits per turn. GENOME: The SMV genome consists of a single-stranded, positive-sense, polyadenylated RNA of approximately 9.6 kb with a virus-encoded protein (VPg) linked at the 5' terminus. The genomic RNA contains a single large open reading frame (ORF). The polypeptide produced from the large ORF is processed proteolytically by three viral-encoded proteinases to yield about 10 functional proteins. A small ORF, partially overlapping the P3 cistron, pipo, is encoded as a fusion protein in the N-terminus of P3 (P3N + PIPO). BIOLOGICAL PROPERTIES: SMV's host range is restricted mostly to two plant species of a single genus: Glycine max (cultivated soybean) and G. soja (wild soybean). SMV is transmitted by aphids non-persistently and by seeds. The variability of SMV is recognized by reactions on cultivars with dominant resistance (R) genes. Recessive resistance genes are not known. GEOGRAPHICAL DISTRIBUTION AND ECONOMIC IMPORTANCE: As a consequence of its seed transmissibility, SMV is present in all soybean-growing areas of the world. SMV infections can reduce significantly seed quantity and quality (e.g. mottled seed coats, reduced seed size and viability, and altered chemical composition). CONTROL: The most effective means of managing losses from SMV are the planting of virus-free seeds and cultivars containing single or multiple R genes. KEY ATTRACTIONS: The interactions of SMV with soybean genotypes containing different dominant R genes and an understanding of the functional role(s) of SMV-encoded proteins in virulence, transmission and pathogenicity have been investigated intensively. The SMV-soybean pathosystem has become an excellent model for the examination of the genetics and genomics of a uniquely complex gene-for-gene resistance model in a crop of worldwide importance.

First Report of Soybean vein necrosis-associated virus in Ohio Soybean Fields.

Soybean vein necrosis-associated virus (SVNaV), a newly discovered tospovirus that infects soybean, was first described as widespread in a number of southern and midwestern states, but so far has not been reported in Ohio (1). Here we describe its occurrence in six different soybean leaf samples collected from five Ohio counties: Champaign, Hardin, Sandusky, Seneca, and Wyandot. Specifically, SVNaV was initially identified through a comprehensive survey during the summer of 2011 that used high throughput sequencing to detect genome sequences of viruses present in a pool of 110 field samples collected from 24 Ohio counties. Three assembled contigs, with sizes of 7,551, 4,937, and 1,554 nucleotides (nt) respectively, share 99% nt identity with the three SVNaV genomic RNAs (L, M, and S), and thus constitute partial sequences of the SVNaV Ohio (OH) isolate. The distribution of this virus was further delineated using reverse transcription (RT)-PCR with primers SVNaV-1734F (5' CCATCTTTCTTTCCAGGCATTTCA 3') and SVNaV-S-2421R (5' GATTCAAGTTCAGCGAGTTCTACAA 3'). All plants from which the SVNaV-positive samples were collected showed typical virus symptoms, including systemic mosaic accompanied by leaf deformation, chlorosis, vein necrosis, and rusty spots on mature leaves. These symptoms are largely consistent with the previous report by Zhou and colleagues (1). Intriguingly, further analysis with RT-PCR revealed that five out of the six SVNaV-positive samples also contained a second virus, with Bean pod mottle virus found in four of the samples, and Tobacco ringspot virus in the fifth. Since it is not yet possible to initiate SVNaV infection mechanically, it is difficult to determine whether the co-infecting viruses contribute to the disease symptoms and yield losses. It should be noted that SVNaV may have been in Ohio for some time since symptoms similar to those reported by Zhou and colleagues (1) have been observed in soybean fields of this state since at least 2009. Furthermore, while in 2011 these symptoms were observed in only a few fields, as reflected by the detection of SVNaV in six of the 110 samples, the 2012 growing season has seen a big jump of symptomatic plants and fields. The current report confirms its presence with molecular evidence and lays the groundwork for further assessment of its impact on soybean production. Reference: (1) J. Zhou et al. Virus Genes 43:289, 2011.

First Report of Alfalfa mosaic virus and Soybean dwarf virus on Soybean in North Dakota.

Soybean (Glycine max L.) is the major oilseed crop in North Dakota, with production concentrated in the eastern half of the state. Only one virus, Soybean mosaic virus, has been reported from soybean in North Dakota (4). In July and August of 2010, 200 soybean fields from 25 counties were surveyed for Alfalfa mosaic virus (AMV) and Soybean dwarf virus (SbDV). AMV and SbDV have been detected infecting soybean in multiple Midwestern states and are reported to reduce yields in soybean (1,3). Each field was sampled with a grid pattern across the area with at least 8 km between fields. From each field, leaves were collected from 20 plants without regard for symptoms along a transect of approximately 170 m. Leaves from each field were bulked and sap was extracted in phosphate buffer and stored at -80°C until tested using double-antibody sandwich (DAS)-ELISA with positive controls and reagents and protocols from Agdia Inc. (Elkhart, IN). Using DAS-ELISA, AMV was detected in eight of the 200 soybean fields. For sequence-based virus detection, total RNA was extracted from all field samples using a Qiagen RNeasy Plant Mini Kit (Germantown, MD), pooled, depleted of ribosomal RNA (RiboZero Epicentre, Madison, WI), reverse transcribed, sequenced using an Illumina HiSeq2000 (San Diego, CA), and compared to all available viral amino acid and nucleotide sequences. The analysis detected AMV and SbDV sequences in the pool of 200 fields. The presence of AMV and SbDV was confirmed by quantitative real-time reverse transcription (qRT)-PCR (1,3). For AMV, total RNA extracted from bulked leaves from each of the 200 fields was tested using AMVspecific primers (5'-ATGCTACCCAGGCATGTATATTT-3' and 5'-GCTGCATCTTTCGCCAGAA-3') and a FAM-labeled minor-groove binding TaqMan probe (5'-TGGACGTTACCCCCGGA-3'). One field sample from Cass county positive for AMV by ELISA was also positive for AMV by qRT-PCR, confirming the presence of AMV in the field sample. For SbDV, an RNA pool representing all 200 fields, subpools, and individual field samples was analyzed by qRT-PCR (1) and DAS-ELISA. One field sample from Grand Forks County tested positive for SbDV by qRT-PCR and DAS-ELISA, confirming the presence of SbDV in the field sample. Because leaf samples were collected and pooled prior to analysis, the symptom phenotypes of individual field plants could not be correlated with positive ELISA or qRT-PCR results. AMV was reported by the American Phytopathological Society Virus Working Group (2007 to 2008) to be widely prevalent in North Dakota, but we found no peer-reviewed reports of verified AMV identification on any crop in the state. To our knowledge, this is the first confirmed report of AMV and SbDV infecting soybean in North Dakota. Serious infestations by the soybean aphid, Aphis glycines, requiring chemical control, have occurred in recent years in North Dakota. Because A. glycines is a vector for both viruses (1,2), the distribution, incidence, and agronomic impact of AMV and SbDV could be affected in years when A. glycines infestations are high. In addition, AMV is seedborne in soybean and may cause seed mottling, a concern for the food-grade soybean industry where production is primarily for export. References: (1) V. D. Damsteegt et al. Plant Dis. 95:945, 2011 (2) J. H. Hill et al. Plant Dis. 85:561, 2001. (3) H. A. Hobbs et al. Plant Health Progress doi:10.1094/PHP-2010-0827-01-BR, 2010. (4) B. D. Nelson and L. L. Domier. Plant Dis. 93:760, 2009.

Acquisition and Transmissibility of U.S. Soybean dwarf virus Isolates by the Soybean Aphid, Aphis glycines.

Soybean dwarf virus (SbDV) exists as several distinct strains based on symptomatology, vector specificity, and host range. Originally characterized Japanese isolates of SbDV were specifically transmitted by Aulacorthum solani. More recently, additional Japanese isolates and endemic U.S. isolates have been shown to be transmitted by several different aphid species. The soybean aphid, Aphis glycines, the only aphid that colonizes soybean, has been shown to be a very inefficient vector of some SbDV isolates from Japan and the United States. Transmission experiments have shown that the soybean aphid can transmit certain isolates of SbDV from soybean to soybean and clover species and from clover to clover and soybean with long acquisition and inoculation access periods. Although transmission of SbDV by the soybean aphid is very inefficient, the large soybean aphid populations that develop on soybean may have epidemiological potential to produce serious SbDV-induced yield losses.

Sequence diversity of readthrough proteins of Soybean dwarf virus isolates from the Midwestern United States.

The amino acid sequence diversity of readthrough proteins (RTPs) of 24 dwarfing isolates of Soybean dwarf virus (SbDV) from Wisconsin and Illinois was analyzed. The RTP, a minor component of viral capsids, has a significant role in specificity of aphid transmission of luteovirids. Among the isolates, nucleotide sequence identities ranged from 95 to 100%. The predicted amino acid sequences differed at 56 amino acid positions in the 54 kDa RTD compared to only five positions in the 22 kDa CP. Phylogenetic analysis of both amino acid and nucleotide sequences showed three distinct clusters of SbDV isolates.

First Report of Soybean yellow mottle mosaic virus in Soybean in North America.

Soybean yellow mottle mosaic virus (SYMMV) is a soybean-infecting virus recently discovered in Korea that initially induces bright yellow mosaic on leaves followed by stunting and reduced growth of older leaves (1). Nucleotide sequence analysis of genomic RNA of the Korean SYMMV isolate suggested that the virus is a new member of the genus Carmovirus in the family Tombusviridae. To determine whether SYMMV is present in the United States, single leaflets were collected without regard for symptoms from 7 to 10 plants in each of 136 plots in August 2008 from a research field in Stoneville, MS that contained 16 plant introductions (including five from Korea) and 'Williams 82'. Samples were grouped into 10 pools of 100 leaves from which total RNA was extracted with the Qiagen RNeasy Plant Mini Kit (Germantown, MD), reverse transcribed, and amplified with SuperScript III Platinum SYBR Green One-Step Quantitative Real-time Reverse Transcriptase-PCR Kit (Invitrogen, Carlsbad, CA) and two pairs of oligonucleotide primers (5'-CGTCTGCCAGGGTTTAATACTA-3', and 5'-GATTAGCATGTCAGGGTGGTCG-3'; and 5'-ACTGAGTCCCCTGCTTAT-3' and 5'-CATCACTAGCGTCYGGATCA-3') that were designed from regions conserved between SYMMV and Cowpea mottle virus (CPMoV; a related and seed-transmitted carmovirus). Six 100-leaflet pools were positive with both primer sets and four pools were negative with both primer sets. Total RNA extracted from one positive pool was reverse transcribed using SuperScript II reverse transcriptase and a primer complementary to nt 4,000 to 4,009 of the SYMMV genome and amplified using iProof DNA polymerase (Bio-Rad, Hercules, CA) as two overlapping DNA fragments using primers corresponding to nt 1 to 21 and complementary to nt 3,483 to 3,508 and corresponding to nt 3,366 to 3,391 and complementary to nt 4,000 to 4,009. DNA fragments were sequenced using a BigDye Terminator Cycle Sequencing Kit and ABI 3730XL capillary sequencers (Applied Biosystems, Foster City, CA). The 4,009-nt sequence of the Mississippi SYMMV isolate (GenBank Accession No. FJ707484) was 96% identical to the Korean SYMMV isolate and 65% identical to CPMoV. Because of the sampling techniques used, it was not possible to associate SYMMV-positive plants with disease symptoms in Mississippi. To our knowledge, this is the first report of SYMMV in North America. Reference: (1) M. Nam et al. Online publication. doi:10.1077/s00705-009-0480. Arch. Virol., 2009.

First Report of Soybean mosaic virus on Soybean in North Dakota.

Soybean, Glycine max L, is grown on 1,420,000 ha in North Dakota and is the most important oilseed crop in the state. Viruses in soybean have not previously been reported from North Dakota (2). In July and August of 2007, 64 soybean fields in Cass, Richland, and Sargent counties in southeastern North Dakota were surveyed for Soybean mosaic virus (SMV). These counties have a high concentration of soybean hectares, a long history of soybean production, and soybean aphid infestations that were observed in 2004 and 2006. Fields were sampled with a grid pattern across the area with at least 8 km (5 miles) between fields. A transect of approximately 60 m through each field was made and 20 leaves were collected at random. Sap was extracted in phosphate buffer and stored at -80°C until tested first using double antibody sandwich (DAS)-ELISA with positive controls and reagents and protocol from Agdia Inc. (Elkhart, IN). Using DAS-ELISA, SMV was detected in 19 of the 64 soybean fields sampled. To confirm the presence of SMV, 12 samples that were positive for SMV by DAS-ELISA also were tested by reverse transcription (RT)-PCR. RNA was extracted from sap by a Qiagen RNeasy Plant Mini Kit (Germantown, MD), reverse transcribed, and amplified with SuperScrip III Platinum SYBR Green One-Step qRT-PCR Kit (Invitrogen Inc., Carlsbad, CA) and SMV-specific primers (5'-TTCAGCACAATGGGTGAGGATG-3' and 5'-AATTCTGTGTGGCTTGATGTTGC-3') (1). Eight of the twelve ELISA-positive samples were positive for SMV by RT-PCR, confirming the presence of SMV in the samples. To our knowledge, this is the first report of SMV infecting soybean in North Dakota. References: (1) L. L. Domier et al. (Abstr.). Phytopathology 98(suppl.):S47, 2008. (2) B. D. Nelson and G. Danielson. (Abstr.). Phytopathology 95(suppl.):S164, 2005.

Quantification of Fusarium solani f. sp. glycines isolates in soybean roots by colony-forming unit assays and real-time quantitative PCR.

Fusarium solani f. sp. glycines (FSG; syn. F. virguliforme Akoi, O'Donnell, Homma & Lattanzi) is a soil-borne fungus that infects soybean roots and causes sudden death syndrome (SDS), a widespread and destructive soybean disease. The goal of this study was to develop and use a real-time quantitative polymerase chain reaction (QPCR) assay to compare the accumulation of genomic DNA among 30 FSG isolates in inoculated soybean roots. Isolates differed significantly (P < or = 0.05) in their DNA accumulation on a susceptible soybean cultivar when detected and quantified using a FSG-specific probe/primers set derived from the sequences of the nuclear-encoded, mitochondrial small subunit ribosomal RNA gene. QPCR results that were normalized as the fold change over the sample collection times after inoculation were significantly (P < or = 0.001) correlated with the log(10) transformed colony-forming unit (CFU) values of FSG obtained from plating of inoculated ground roots on FSG semi-selective agar medium. Several isolates were identified that accumulated more FSG DNA and had higher CFU values than the reference isolate FSG1 (Mont-1). Compared to other isolates, FSG5 was the most aggressive root colonizer based on DNA accumulation and CFU values in infested roots. The described QPCR assay should provide more specificity, greater sensitivity, and less variability than alternatives to the culturing-dependent and time-consuming plating assays. Evaluation of isolate relative DNA differences on host plants using the QPCR approach provides useful information for evaluating isolates based on the extent and/or degree of colonization on soybean roots and for selecting isolates for breeding SDS-resistant soybean lines.

Genomic DNA sequence comparison between two inbred soybean cyst nematode biotypes facilitated by massively parallel 454 micro-bead sequencing.

Heterodera glycines, the soybean cyst nematode (SCN), is a damaging agricultural pest that could be effectively managed if critical phenotypes, such as virulence and host range could be understood. While SCN is amenable to genetic analysis, lack of DNA sequence data prevents the use of such methods to study this pathogen. Fortunately, new methods of DNA sequencing that produced large amounts of data and permit whole genome comparative analyses have become available. In this study, 400 million bases of genomic DNA sequence were collected from two inbred biotypes of SCN using 454 micro-bead DNA sequencing. Comparisons to a BAC, sequenced by Sanger sequencing, showed that the micro-bead sequences could identify low and high copy number regions within the BAC. Potential single nucleotide polymorphisms (SNPs) between the two SCN biotypes were identified by comparing the two sets of sequences. Selected resequencing revealed that up to 84% of the SNPs were correct. We conclude that the quality of the micro-bead sequence data was sufficient for de novo SNP identification and should be applicable to organisms with similar genome sizes and complexities. The SNPs identified will be an important starting point in associating phenotypes with specific regions of the SCN genome.

First Report of Soybean dwarf virus in Soybean in Northern Illinois.

Soybean dwarf virus (SbDV), a member of the Luteoviridae, is transmitted persistently by colonizing aphids and causes significant yield losses in soybean (Glycine max L.) in Japan. In the United States, SbDV is endemic in red and white clover (Trifolium pratense L. and T. repens L.) (1,3). Even so, SbDV has been detected in soybean only in Virginia (2) and Wisconsin (4). A study conducted in Illinois during 2001 and 2002 detected SbDV in clover but not soybean (3). During August of 2006, two surveys for virus diseases in soybean were conducted in Illinois. In the first survey, 30 soybean leaf samples were collected without regard for symptoms from each of 10 fields in each of five northern Illinois counties (Carroll, Jo Daviess, Ogle, Stephenson, and Winnebago). In the second survey, 10 random soybean leaf samples and 10 samples with virus-like symptoms were collected from each of 30 soybean rust sentinel plots spread throughout Illinois. Total RNA was extracted from pools of 90 to 100 plants and analyzed by quantitative real-time reverse transcriptase (QRT)-PCR using a fluorescently labeled minor groove binding probe (VIC-5'-AGCATATCCAAAGACGC-3'-MGBNFQ, nt 2358-2374) and flanking primers (5'-TGGCTATTATAGAATGGTGCGTAAAC-3', nt 2327-2351; and 5'-GCCATGGAAATGAGGGAATG-3', nt 2395-2376). From the first survey, pools from Carroll, Jo Daviess, and Ogle were positive for SbDV. Analysis of individual leaf samples from positive pools by double-antibody sandwich-ELISA (Agdia, Elkhart, IN) showed that one sample in each county was positive for SbDV. On the basis of the number of randomly sampled plants, the incidence of SbDV infection in northern Illinois was approximately 0.3%. In the second survey, SbDV was detected in one pool containing symptomatic plants from five soybean rust sentinel plots. Further QRT-PCR analysis showed that the sentinel plot in Bureau County was positive for SbDV. Because of the sampling protocols used, it was not possible to determine symptom phenotypes of SbDV-positive samples. Sequence analysis of the combined coat protein (CP) and readthrough domain (RTD) encoding region (nt 3019-5094) of SbDV isolates from Bureau (GenBank Accession No. EU095847) and Carroll (GenBank Accession No. EU095846) counties showed that the predicted amino acid sequences were 96 and 95% identical to a Japanese dwarfing isolate of SbDV (GenBank Accession No. AB038150), respectively. The predicted CP amino acid sequences of the Illinois isolates were identical and RTD amino acid sequences differed at six positions. To our knowledge, this is the first report of infection of soybean plants in Illinois with SbDV. References: (1) V. D. Damsteegt et al. Phytopathology 89:374, 1999. (2) A. Fayad et al. Phytopathology (Abstr.) 90(suppl.):S132, 2000. (3) B. Harrison et al. Plant Dis. 89:28, 2005. (4) A. Phibbs et al. Plant Dis. 88:1285, 2004.

Green Stem Disorder of Soybean.

Green stem disorder of soybean (Glycine max) is characterized by delayed senescence of stems with normal pod ripening and seed maturation. Three different field research approaches were designed to determine the relationship of green stem disorder to Bean pod mottle virus (BPMV) and other potential factors that may be involved in causing this disorder. The first research approach surveyed green stem disorder and BPMV in individual plants monitored in several commercial soybean fields during three growing seasons. Leaf samples from maturing plants (growth stage R6) were tested by enzyme-linked immunosorbent assay (ELISA) for BPMV. The percentage of monitored plants infected with BPMV at growth stage R6 in some fields was higher than the incidence of green stem disorder at harvest maturity. Many plants infected with BPMV did not develop green stem disorder, and conversely, many plants that had green stem disorder were not infected with BPMV. According to a chi-square test of independence, the data indicated that green stem disorder was independent of BPMV infection at growth stage R6 (P = 0.98). A second research approach compared green stem disorder incidence in an identical set of soybean entries planted in two locations with different levels of natural virus infection. Despite differences in virus infection, including BPMV incidence, 20 of 24 entries had similar green stem disorder incidence at the two locations. A third research approach completed over two growing seasons in field cages showed that green stem disorder developed without BPMV infection. BPMV infection did not increase green stem disorder incidence in comparison to controls. Bean leaf beetle, leaf hopper, or stinkbug feeding did not have an effect on the incidence of green stem disorder. The cause of the green stem disorder remains unknown.

A genetic linkage map of the soybean cyst nematode Heterodera glycines.

A genetic linkage map of the soybean cyst nematode (SCN) Heterodera glycines was constructed using a population of F2 individuals obtained from matings between two highly inbred SCN lines, TN16 and TN20. The AFLP fingerprinting technique was used to genotype 63 F2 progeny with two restriction enzyme combinations (EcoRI/MseI and PstI/TaqI) and 38 primer combinations. The same F2 population was also genotyped for Hg-cm-1 (H. glycines chorismate mutase-1), a putative virulence gene, using real-time quantitative PCR. Some of the markers were found to be distributed non-randomly. Even so, of the 230 markers analyzed, 131 could be mapped onto ten linkage groups at a minimum LOD of 3.0, for a total map distance of 539 cM. The Hg-cm-1 locus mapped to linkage group III together with 16 other markers. The size of the H. glycines genome was estimated to be in the range of 630-743 cM, indicating that the current map represents 73-86% of the genome, with a marker density of one per 4.5 cM, and a physical/genetic distance ratio of between 124 kb/cM and 147 kb/cM. This genetic map will be of great assistance in mapping H. glycines markers to genes of interest, such as nematode virulence genes and genes that control aspects of nematode parasitism.

First Report of Soybean dwarf virus on Soybean in Wisconsin.

Soybean dwarf virus (SbDV) causes widespread economic losses on soybean (Glycine max (L.) Merr.) in Japan (4), and has been reported on soybean in Virginia (2), in various legumes in the southeastern United States (1), and in peas in California (3). During late July and early August of 2003, soybean plants in Wisconsin were surveyed for SbDV. In 286 soybean fields at the R2-R4 growth stage, the uppermost fully unfurled leaf was collected from 10 plants at each of five sites. Samples were collected at random without regard to symptoms. SbDV symptom information was not recorded. Samples were stored on ice until frozen at -80°C. Five fields in four Wisconsin counties (Columbia, Lafayette, Sauk, and Waushara) tested positive for SbDV using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). DAS-ELISA testing was conducted with reagents from Agdia, Inc (Elkhart, IN) following the manufacturer's protocol. Absorbance was read at 405 nm with a Stat Fax 2100 microplate reader (Awareness Technology, Inc., Palm City, FL) or visually evaluated. DAS-ELISA did not discriminate between strains of SbDV. The presence of SbDV was confirmed, and strain identity was inferred as dwarfing strain using reverse transcription-polymerase chain reaction (RT-PCR). Total RNA was extracted from homogenized leaf tissue, reverse transcribed, and amplified with the SuperScript One Step RT-PCR System (Invitrogen, Carlsbad, CA) and SbDV-specific primers (5'-CTGCTTCTGGTGATTACACTGCCG-3' and 5'-CGCTTTCATTTAACGYCATCAAAGGG-3'). Size of the RT-PCR products (110 bp) was consistent with the dwarfing strain, SbDV-D. All locations that tested positive for SbDV showed soybean aphids, Aphis glycines Matsumura (Homoptera: Aphididae), on 100% of soybean plants. Several aphid species have been reported to vector SbDV, but at this time, vector relations in the Wisconsin infections are unknown. To our knowledge, this is the first report of SbDV infecting soybean in Wisconsin. References: (1) V. D. Damsteegt et al. Plant Dis. 79:48, 1995. (2) A. Fayad et al. Phytopathology (Abstr.) 90(Suppl.):S132, 2000. (3) G. R. Johnstone et al. Phytopathology (Abstr.) 74:795(A43), 1984. (4) T. Tamada et al. Ann. Phytopathol. Soc. Jpn. 35:282, 1969.

Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

Occurrence of Seed Coat Mottling in Soybean Plants Inoculated with Bean pod mottle virus and Soybean mosaic virus.

Soybean seed coat mottling often has been a problematic symptom for soybean growers and the soybean industry. The percentages of seed in eight soybean lines with seed coat mottling were evaluated at harvest after inoculating plants during the growing season with Bean pod mottle virus (BPMV), Soybean mosaic virus (SMV), and both viruses inside an insect-proof cage in the field. Results from experiments conducted over 2 years indicated that plants infected with BPMV and SMV, alone or in combination, produced seed coat mottling, whereas noninoculated plants produced little or no mottled seed. BPMV and SMV inoculated on the same plants did not always result in higher percentages of mottled seed compared with BPMV or SMV alone. There was significant virus, line, and virus-line interaction for seed coat mottling. The non-seed-coat-mottling gene (Im) in Williams isoline L77-5632 provided limited, if any, protection against mottling caused by SMV and none against BPMV. The Peanut mottle virus resistance gene Rpv1 in Williams isoline L85-2308 did not give any protection against mottling caused by SMV, whereas the SMV resistance gene Rsv1 in Williams isoline L78-379 and the resistance gene or genes in the small-seeded line L97-946 gave high levels of protection against mottling caused by SMV. The correlations (r = 0.77 for year 2000 and r = 0.89 for year 2001) between virus infection of the parent plant and seed coat mottling were significant (P = 0.01), indicating that virus infection of plants caused seed coat mottling.

Distribution of Leaf-Feeding Beetles and Bean pod mottle virus (BPMV) in Illinois and Transmission of BPMV in Soybean.

Bean leaf beetles (BLB; Cerotoma trifurcata) were collected in soybean (Glycine max) fields in 58 and 99 Illinois counties surveyed during the 2000 and 2001 growing seasons, respectively. In 2000, BLB counts were highest in the central portion of the state. BLB counts were lower the following year, but were more uniformly distributed throughout the state. BLB tested positive for Bean pod mottle virus (BPMV) in 37 of 41 counties assayed in 2000. In 2001, BLB tested positive for BPMV in 86 of 99 counties sampled. In 2000 and 2001, western corn rootworm (WCR; Diabrotica virgifera virgifera) adults were abundant in soybean fields only in east central Illinois. WCR adults tested positive for BPMV in 21 of 21 east central Illinois counties in 2000 and 20 of 24 sampled in 2001. BPMV was detected in soybean plants in 38 of 46 counties sampled in 2000. Field-collected WCR adults transmitted BPMV to potted soybean plants at low rates either directly from BPMV-infected soybean fields or with prior feeding on BPMV-infected plants. This is the first report of the distribution of BLB, WCR adults, and BPMV in Illinois and of BPMV transmission by adult WCR.

Effect of individual Sumai 3 chromosomes on resistance to scab spread within spikes and deoxynivalenol accumulation within kernels in wheat.

Two sets of substitution lines were developed by crossing individual monosomic lines of Chinese Spring (recipient) with scab (Fusarium graminearum) resistant cultivar Sumai 3 (donor) and then using the monosomics as the recurrent male parent for four backcrosses (without selfing after each backcross). The disomic substitution lines were separated from selfed BC4F2 plants. Chromosome specific SSR markers were analyzed for polymorphism between Sumai 3 and Chinese Spring. Polymorphic markers were used to identify substitution lines for specific chromosomes. Based on the specific SSR markers, chromosome substitutions occurred in thirty-six lines, and six lines segregated alleles from the two parents or were homozygous for the allele from Chinese Spring. These substitution lines were used to evaluate Type II (spread within the head) and Type V (deoxynivalenol accumulation within kernels) scab resistance. The objective was to use the substitution lines to evaluate the effect of individual chromosomes of Sumai 3 on Type 11 and Type V scab resistance in the greenhouse. Significant differences in Type II scab resistance and deoxynivalenol (DON) levels among different Chinese Spring (Sumai 3) substitution lines were detected. Positive chromosome substitution effects on Type II scab resistance were found on chromosomes 2B, 3B. 6B, and 7A from Sumai 3. Chromosomes 3B and 7A also reduced DON accumulation within the kernels, while chromosomes IB, 2D, and 4D from Sumai 3 increased DON concentration. Chromosome 7A from Sumai 3 had the largest effect on resistance to scab spread and DON accumulation. Additional research is in progress on the scab resistance conferred by chromosome 7A.

Oral immunization of mice with transgenic tomato fruit expressing respiratory syncytial virus-F protein induces a systemic immune response.

Respiratory syncytial virus (RSV) is one of the most important pathogens of infancy and early childhood. Here a fruit-based edible subunit vaccine against RSV was developed by expressing the RSV fusion (F) protein gene in transgenic tomato plants. The F-gene was expressed in ripening tomato fruit under the control of the fruit-specific E8 promoter. Oral immunization of mice with ripe transgenic tomato fruits led to the induction of both serum and mucosal RSV-F specific antibodies. The ratio of immunoglobulin subclasses produced in response to immunization suggested that a type 1 T-helper cell immune response was preferentially induced. Serum antibodies showed an increased titer when the immunized mice were exposed to inactivated RSV antigen.

Phylogenetic position of the North American isolate of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, as inferred from 16S rDNA sequence analysis.

A 1341 bp sequence of the 16S rDNA of an undescribed species of Pasteuria that parasitizes the soybean cyst nematode, Heterodera glycines, was determined and then compared with a homologous sequence of Pasteuria ramosa, a parasite of cladoceran water fleas of the family Daphnidae. The two Pasteuria sequences, which diverged from each other by a dissimilarity index of 7%, also were compared with the 16S rDNA sequences of 30 other bacterial species to determine the phylogenetic position of the genus Pasteuria among the Gram-positive eubacteria. Phylogenetic analyses using maximum-likelihood, maximum-parsimony and neighbour-joining methods showed that the Heterodera glycines-infecting Pasteuria and its sister species, P. ramosa, form a distinct line of descent within the Alicyclobacillus group of the Bacillaceae. These results are consistent with the view that the genus Pasteuria is a deeply rooted member of the Clostridium-Bacillus-Streptococcus branch of the Gram-positive eubacteria, neither related to the actinomycetes nor closely related to true endospore-forming bacteria.