Specific and overlapping functions of the nuclear hormone receptors CAR and PXR in xenobiotic response.

The products of the cytochrome P450 (CYP) genes play an important role in the detoxification of xenobiotics and environmental contaminants, and many foreign chemicals or xenobiotics can induce their expression. We have previously shown that the nuclear hormone receptor CAR (Constitutive Androstane Receptor, NR113) mediates the well studied induction of CYP2B10 gene expression by phenobarbital (PB) and 1, 4-bis-[2-(3, 5,-dichloropyridyloxy)] benzene (TCPOBOP). We have used the CAR knockout mouse model to explore the broader functions of this xenobiotic receptor. In addition to the liver, CAR is expressed in the epithelial cells of the villi in the small intestine, and this expression is required for CYP2B10 induction in response to PB and TCPOBOP in those cells. In agreement with previous observations that CAR can bind to regulatory elements in CYP3A genes, CAR is also required for induction of expression of CYP3A11 in response to both PB and TCPOBOP in liver. In males, CAR is also required for induction of liver CYP2A4 expression. In wild type animals, pretreatment with the CAR inverse agonist androstenol blocks the response of both the CYP2B10 and CYP3A11 genes to PB and TCPOBOP, and decreases basal CYP3A11 expression. CAR is also required for the response of CYP2B10 to several additional xenobiotic inducers, including chlorpromazine, clotrimazole and dieldrin, but not dexamethasone, an agonist for both the xenobiotic receptor PXR (Pregnane X Receptor NR112) and the glucocorticoid receptor. Chlorpromazine induction of CYP3A11 is also absent in CAR-deficient animals, but the responses to clotrimazole and dieldrin are retained, indicating that both of these inducers can also activate PXR (Pregnane X Receptor NR112). We conclude that CAR has broad functions in xenobiotic responses. Some are specific to CAR but others, including induction of the important drug metabolizing enzyme CYP3A, overlap with those of PXR.

The farnesoid X-activated receptor mediates bile acid activation of phospholipid transfer protein gene expression.

Bile acids facilitate the absorption of dietary lipids and fat-soluble vitamins and are physiological ligands for the farnesoid X-activated receptor (FXR), a member of the nuclear hormone receptor superfamily. FXR functions as a heterodimer with the retinoid X receptor and in the presence of ligand, the heterodimer binds to specific DNA sequences in the promoters of target genes to regulate gene transcription. Phospholipid transfer protein (PLTP) has been identified as a possible target gene for FXR because the human promoter contains a potential FXR response element, an inverted repeat in which consensus receptor-binding hexamers are separated by one nucleotide (inverted repeat-1). PLTP is essential in the transfer of very low density lipoprotein phospholipids into high density lipoprotein (Jiang, X. C., Bruce, C., Mar, J., Lin, M., Ji, Y., Francone, O. L., and Tall, A. R. (1999) J. Clin. Invest. 103, 907-914). Here we report the regulation of PLTP gene expression by FXR and bile acids. In CV-1 cells, cotransfection of FXR and the retinoid X receptor resulted in bile acid-dependent transactivation of a luciferase reporter construct containing the human PLTP promoter. Mutation analysis demonstrated that the inverted repeat-1 (IR-1) in the PLTP promoter is required for this transactivation. Finally, we demonstrate that bile acids are able to regulate PLTP gene expression in vivo. Mice fed a chow diet supplemented with bile acid showed increased hepatic PLTP mRNA levels. These results suggest that FXR may play a role in high density lipoprotein metabolism via the regulation of PLTP gene expression.

The steroid receptor coactivator, GRIP-1, is necessary for MEF-2C-dependent gene expression and skeletal muscle differentiation.

Nuclear receptor-mediated activation of transcription involves coactivation by cofactors collectively denoted the steroid receptor coactivators (SRCs). The process also involves the subsequent recruitment of p300/CBP and PCAF to a complex that synergistically regulates transcription and remodels the chromatin. PCAF and p300 have also been demonstrated to function as critical coactivators for the muscle-specific basic helix-loop-helix (bHLH) protein MyoD during myogenic commitment. Skeletal muscle differentiation and the activation of muscle-specific gene expression is dependent on the concerted action of another bHLH factor, myogenin, and the MADS protein, MEF-2, which function in a cooperative manner. We examined the functional role of one SRC, GRIP-1, in muscle differentiation, an ideal paradigm for the analysis of the determinative events that govern the cell's decision to divide or differentiate. We observed that the mRNA encoding GRIP-1 is expressed in proliferating myoblasts and post-mitotic differentiated myotubes, and that protein levels increase during differentiation. Exogenous/ectopic expression studies with GRIP-1 sense and antisense vectors in myogenic C2C12 cells demonstrated that this SRC is necessary for (1) induction/activation of myogenin, MEF-2, and the crucial cell cycle regulator, p21, and (2) contractile protein expression and myotube formation. Furthermore, we demonstrate that the SRC GRIP-1 coactivates MEF-2C-mediated transcription. GRIP-1 also coactivates the synergistic transactivation of E box-dependent transcription by myogenin and MEF-2C. GST-pulldowns, mammalian two-hybrid analysis, and immunoprecipitation demonstrate that the mechanism involves direct interactions between MEF-2C and GRIP-1 and is associated with the ability of the SRC to interact with the MADS domain of MEF-2C. The HLH region of myogenin mediates the direct interaction of myogenin and GRIP-1. Interestingly, interaction with myogenic factors is mediated by two regions of GRIP-1, an amino-terminal bHLH-PAS region and the carboxy-terminal region between amino acids 1158 and 1423 (which encodes an activation domain, has HAT activity, and interacts with the coactivator-associated arginine methyltransferase). This work demonstrates that GRIP-1 potentiates skeletal muscle differentiation by acting as a critical coactivator for MEF-2C-mediated transactivation and is the first study to ascribe a function to the amino-terminal bHLH-PAS region of SRCs.

The orphan nuclear receptor SHP inhibits hepatocyte nuclear factor 4 and retinoid X receptor transactivation: two mechanisms for repression.

The orphan nuclear hormone receptor SHP interacts with a number of other nuclear hormone receptors and inhibits their transcriptional activity. Several mechanisms have been suggested to account for this inhibition. Here we show that SHP inhibits transactivation by the orphan receptor hepatocyte nuclear factor 4 (HNF-4) and the retinoid X receptor (RXR) by at least two mechanisms. SHP interacts with the same HNF-4 surface recognized by transcriptional coactivators and competes with them for binding in vivo. The minimal SHP sequences previously found to be required for interaction with other receptors are sufficient for interaction with HNF-4, although deletion results indicate that additional C-terminal sequences are necessary for full binding and coactivator competition. These additional sequences include those associated with direct transcriptional repressor activity of SHP. SHP also competes with coactivators for binding to ligand-activated RXR, and based on the ligand-dependent interaction with other nuclear receptors, it is likely that coactivator competition is a general feature of SHP-mediated repression. The minimal receptor interaction domain of SHP is sufficient for full interaction with RXR, as previously described. This domain is also sufficient for full coactivator competition. Functionally, however, full inhibition of RXR transactivation requires the presence of the C-terminal repressor domain, with only weak inhibition associated with this receptor interaction domain. Overall, these results suggest that SHP represses nuclear hormone receptor-mediated transactivation via two separate steps: first by competition with coactivators and then by direct effects of its transcriptional repressor function.

Exogenous expression of a dominant negative RORalpha1 vector in muscle cells impairs differentiation: RORalpha1 directly interacts with p300 and myoD.

ROR/RZR is an orphan nuclear receptor that has no known ligand in the 'classical sense'. In the present study we demonstrate that RORalpha is constitutively expressed during the differentiation of proliferating myoblasts to post-mitotic multinucleated myotubes, that have acquired a contractile phenotype. Exogenous expression of dominant negative RORalpha1DeltaE mRNA in myogenic cells significantly reduces the endogenous expression of RORalpha1 mRNA, represses the accumu-lation and delays the activation of mRNAs encoding MyoD and myogenin [the muscle-specific basic helix-loop-helix (bHLH) proteins] and p21(Waf-1/Cip-1) (a cdk inhibitor). Immunohistochemistry demonstrates that morpho-logical differentiation is delayed in cells expressing the RORDeltaE transcript. Furthermore, the size and development of mutlinucleated myotubes is impaired. The E region of RORalpha1 interacts with p300, a cofactor that functions as a coactivator in nuclear receptor and MyoD-mediated transactivation. Consistent with the functional role of RORalpha1 in myogenesis, we observed that RORalpha1 directly interacts with the bHLH protein MyoD. This interaction was mediated by the N-terminal activation domain of the bHLH protein, MyoD, and the RORalpha1 DNA binding domain/C region. Furthermore, we demonstrated that p300, RORalpha1 and MyoD interact in a non-competitive manner. In conclusion, this study provides evidence for a biological role and positive influence of RORalpha1 in the cascade of events involved in the activation of myogenic-specific markers and cell cycle regulators and suggests that crosstalk between theretinoid-relatedorphan (ROR) nuclear receptors and the myogenic bHLH proteins has functional consequences for differentiation.

Guidelines for the use of imaging techniques for the investigation of venous thromboembolic disease.

The diagnosis of venous thromboembolic disease remains a difficult challenge. Chest radiography, ventilation/perfusion lung scanning, noninvasive leg testing, and pulmonary angiography were evaluated with regard to sensitivity, specificity, positive and negative predictive values. The need for treatment, observation, or serial testing with respect to risks and benefits of treatment and likelihood of serious outcomes was evaluated. The evidence for conclusions was based on the methodology and values of the Canadian Task Force on the Periodic Health Examination. The Diagnostic Imaging Advisory Group of the Canadian Association of Emergency Physicians developed eight recommendations.

Transcriptional repression by COUP-TF II is dependent on the C-terminal domain and involves the N-CoR variant, RIP13delta1.

COUP-TF II/ARP-1 is an 'orphan' steroid receptor that inhibits basal transcription, and represses trans-activation by the vitamin D, thyroid hormone and retinoid receptors. The molecular basis of repression by COUP-TF II remains obscure. In this study we utilized the GAL4 hybrid system to demonstrate that COUP-TF II contains sequences within the C-terminal region that encode a dominant transcriptional repressor that inhibits the ability of the potent chimeric transactivator GAL4VP16 to induce transcription. Mammalian two hybrid analysis demonstrated that COUP-TF II did not efficiently interact with either interaction domains I or II from N-CoR and RIP13. However, COUP-TF II efficiently interacts with a region comprised of interaction domains I + II from the corepressor, RIP13delta1. Efficient interaction of the orphan receptor with the corepressor was critically dependent on a large region comprised of the C, D and E domains of COUP-TF II, which correlated with the domain that maximally represses transcription. This investigation suggested that the N-CoR variant, RIP13delta1 interacts with a region of COUP-TF II that functions as a dominant transcriptional repressor.

Characterization of the AB (AF-1) region in the muscle-specific retinoid X receptor-gamma: evidence that the AF-1 region functions in a cell-specific manner.

The retinoid X receptors alpha, beta and gamma (RXRs) share a highly conserved 'C' region or DNA binding domain (DBD). The conserved 'DE' region or ligand binding domain (LBD) of the RXRs is functionally complex, mediating dimerization and a ligand-dependent activation function (AF-2). The AB or N-terminal region of the RXRs is poorly conserved and encodes a ligand-independent activation function (AF-1). RXR gamma mRNA is preferentially expressed in skeletal and cardiac muscle, however, cell-specific steroid receptor-mediated trans-activation is a poorly understood phenomenon. We utilized the GAL4 hybrid assay system and have demonstrated that RXR gamma contains two functional domains in the AB and DE regions that activate transcription in a ligand-independent and -dependent manner respectively. The functions of the AB (AF-1) and DE (AF-2) domains were regulated by cAMP-dependent protein kinases, furthermore, the function of AF-2 in the LBD was activated by 8-Br-cAMP, independent of 9-cis-retinoic acid treatment. Deletion analysis demonstrated that the AF-1 of RXR gamma, is located between amino acids 1 and 103 and contained multiple motifs that were targets of cAMP-dependent protein kinases. Transfection analyses in non-muscle and myogenic cells clearly demonstrated that: (i) the AF-1 of RXR gamma functions in a muscle-specific manner and is required for optimal ligand-dependent trans-activation from an RXRE; (ii) RXR gamma trans-activates more efficiently in a myogenic background.

Trans-activation and DNA-binding properties of the transcription factor, Sox-18.

Sox-18 is a member of the Sox multi-gene family (Sry-related HMG-box gene). We have bacterially expressed this 378 amino acid protein and demonstrated sequence-specific binding to the Sox DNA-binding motif AACAAAG. A distinct 95 amino acid activation domain was mapped in Sox-18 using GAL4-Sox-18 fusions (amino acids 160-225). Furthermore, Sox-18 was capable of trans-activating gene expression through the AACAAA motif. Our results suggest that Sox-18 functions as a classical trans-activator of gene expression.

Regulation of vertebrate muscle differentiation by thyroid hormone: the role of the myoD gene family.

Skeletal myoblasts have their origin early in embryogenesis within specific somites. Determined myoblasts are committed to a myogenic fate; however, they only differentiate and express a muscle-specific phenotype after they have received the appropriate environmental signals. Once proliferating myoblasts enter the differentiation programme they withdraw from the cell cycle and form post-mitotic multinucleated myofibres (myogenesis); this transformation is accompanied by muscle-specific gene expression. Muscle development is associated with complex and diverse protein isoform transitions, generated by differential gene expression and mRNA splicing. The myofibres are in a state of dynamic adaptation in response to hormones, mechanical activity and motor innervation, which modulate differential gene expression and splicing during this functional acclimatisation. This review will focus on the profound effects of thyroid hormone on skeletal muscle, which produce alterations in gene and isoform expression, biochemical properties and morphological features that precipitate in modified contractile/mechanical characteristics. Insight into the molecular events that control these events was provided by the recent characterisation of the MyoD gene family, which encodes helix-loop-helix proteins; these activate muscle-specific transcription and serve as targets for a variety of physiological stimuli. The current hypothesis on hormonal regulation of myogenesis is that thyroid hormones (1) directly regulate the myoD and contractile protein gene families, and (2) induce thyroid hormone receptor-transcription factor interactions critical to gene expression.

Identification of deoxyribonucleic acid sequences that bind retinoid-X receptor-gamma with high affinity.

The retinoid-X receptor (RXR) family (-alpha, -beta and -gamma) forms homodimers that bind to a number of retinoid-X response elements and trans-activate gene expression in a retinoid-dependent manner. Although, the RXRs are known to bind tandem direct repeats (DR) of the hexamer, RGGTCA, separated by 1 nucleotide, it is not known whether these represent the optimal and/or only recognition sequences. We, therefore, used a nonbiased strategy to identify sequences that efficiently bound RXR gamma, an isoform preferentially expressed in cardiac and skeletal muscle tissue. We performed binding site selection with bacterially expressed RXR gamma bound to glutathione-agarose and a pool of random sequences to derive a consensus DNA-binding site for RXR gamma. We analyzed a total of 41 individually selected oligonucleotides and found that RXR gamma bound with high affinity to motifs that were accommodated by the consensus AARGRNCAAAGGTCAA/cR. We observed that the majority of the sequences that formed complexes with RXR gamma in electrophoretic mobility shift analysis were DR-1 motifs; however, DR- motifs separated by 2, 4, and 8 nucleotides and a palindrome-0 motif were also demonstrated to interact with RXR gamma. Mutagenesis of the derived sequences indicated that both RGGTCA motifs were required for high affinity binding to RXR gamma. These derived sequences conferred appropriate 9-cis- and all-trans-retinoic acid (RA) responses to a thymidine kinase promoter. Furthermore, supershift experiments with a RXR antibody verified that these sequences specifically interacted with RXR in nuclear extracts derived from C2C12 muscle cells. In conclusion, this study rigorously defines the range of DR motifs that can recognize RXR and regulate gene expression in a RA-dependent fashion. The derived consensus accommodates retinoid-X response elements that have been identified in a diverse range of genes trans-activated by 9-cis-RA via the RXR family.

Activation of myoD gene transcription by 3,5,3'-triiodo-L-thyronine: a direct role for the thyroid hormone and retinoid X receptors.

Thyroid hormones are major determinants of skeletal muscle differentiation in vivo. Triiodo-L-thyronine treatment promotes terminal muscle differentiation and results in increased MyoD gene transcription in myogenic cell lines; furthermore myoD and fast myosin heavy chain gene expression are activated in rodent slow twitch muscle fibers (Molecular Endocrinology 6: 1185-1194, 1992; Development 118: 1137-1147, 1993). We have identified a T3 response element (TRE) in the mouse MyoD promoter between nucleotide positions -337 and -309 (5' CTGAGGTCAGTACAGGCTGGAGGAGTAGA 3'). This sequence conferred an appropriate T3 response to an enhancerless SV40 promoter. In vitro binding studies showed that the thyroid hormone receptor alpha (TR alpha) formed a heterodimeric complex, with either the retinoid X receptor alpha or gamma 1 isoforms (RXR alpha, RXR gamm), on the MyoD TRE that was specifically competed by other well characterised TREs and not by other response elements. Analyses of this heterodimer with a battery of steroid hormone response elements indicated that the complex was efficiently competed by a direct repeat of the AGGTCA motif separated by 4 nucleotides as predicted by the 3-4-5 rule. EMSA experiments demonstrated that the nuclear factor(s) present in muscle cells that bound to the myoD TRE were constitutively expressed during myogenesis; this complex was competed by the myosin heavy chain, DR-4 and PAL-0 TREs in a sequence specific fashion. Western blot analysis indicated that TR alpha 1 was constitutively expressed during C2C12 differentiation. Mutagenesis of the myoD TRE indicated that the sequence of the direct repeats (AGGTCA) and the 4 nucleotide gap were necessary for efficient binding to the TR alpha/RXR alpha heterodimeric complex. In conclusion our data suggest that the TRE in the helix loop helix gene, myoD, is a target for the direct heterodimeric binding of TR alpha and RXR alpha/gamma. These results provide a molecular mechanism/model for the effects of triiodo-L-thyronine on in vitro myogenesis; the activation of myoD gene expression in the slow twitch fibres and the cascade of myogenic events regulated by thyroid hormone.

Nuclear overhauser effect studies on the conformation of magnesium adenosine 5'-triphosphate bound to rabbit muscle creatine kinase.

Nuclear Overhauser effects were used to determine interproton distances on MgATP bound to rabbit muscle creatine kinase. The internuclear distances were used in a distance geometry program that objectively determines both the conformation of the bound MgATP and its uniqueness. Two classes of structures were found that satisfied the measured interproton distances. Both classes had the same anti glycosidic torsional angle (chi = 78 +/- 10 degrees) but differed in their ribose ring puckers (O1'-endo or C4'-exo). The uniqueness of the glycosidic torsional angle is consistent with the preference of creatine kinase for adenine nucleotides. One of these conformations of MgATP bound to creatine kinase is indistinguishable from the conformation found for Co(NH3)4ATP bound to the catalytic subunit of protein kinase, which also has a high specificity for adenine nucleotides [chi = 78 +/- 10 degrees, O1'-endo; Rosevear, P.R., Bramson, H.N., O'Brian, C., Kaiser, E.T., & Mildvan, A.S. (1983) Biochemistry 22, 3439]. Distance geometry calculations also suggest that upper limit distances, when low enough (less than or equal to 3.4 A), can be used instead of measured distances to define, within experimental error, the glycosidic torsional angle of bound nucleotides. However, this approach does not permit an evaluation of the ribose ring pucker.