Wilt, Crown, and Root Rot of Common Rose Mallow (Hibiscus moscheutos) Caused by a Novel Fusarium sp.

A new crown and root rot disease of landscape plantings of the malvaceous ornamental common rose mallow (Hibiscus moscheutos) was first detected in Washington State in 2012. The main objectives of this study were to complete Koch's postulates, document the disease symptoms photographically, and identify the causal agent using multilocus molecular phylogenetics. Results of the pathogenicity experiments demonstrated that the Fusarium sp. could induce vascular wilt and root and crown rot symptoms on H. moscheutos 'Luna Rose'. Maximum-likelihood and maximum-parsimony phylogenetic analyses of portions of translation elongation factor 1-α and DNA-directed RNA polymerase II largest and second-largest subunit indicated that the Hibiscus pathogen represents a novel, undescribed Fusarium sp. nested within the Fusarium buharicum species complex.

A New Postharvest Fruit Rot in Apple and Pear Caused by Phacidium lacerum.

During surveys for postharvest diseases of apple and pear, an unknown postharvest fruit rot was observed in Washington State. The disease appeared to originate from infection of the stem and calyx tissue of the fruit or wounds on the fruit. An unknown pycnidial fungus was consistently isolated from the decayed fruit. Isolates from apple and pear were characterized and identified by molecular phylogenetic analysis and morphology. Pathogenicity of representative isolates on apple and pear fruit was tested under laboratory or field conditions. A BLAST search in GenBank showed that isolates differed from Phacidium lacerum and its synonym, Ceuthospora pinastri, by only 0 to 4 bp in sequences within part of the combined large ribosomal subunit + internal transcribed spacer + small ribosomal subunit regions. The phylogenetic analysis confirmed the taxonomic placement of the unknown fungus in the genus Phacidium, with the highest match being C. pinastri (formerly anamorphic P. lacerum) and with closely related taxa from GenBank forming congeneric clades. The fungus grew at 0 to 30°C and formed unilocular to multilocular pycnidial conidiomata on artificial media after approximately 5 to 7 days at room temperature. On potato dextrose agar incubated for a 12-h photoperiod, semi-immersed globose to subglobose pycnidial conidiomata were 250 to 1,000 µm in diameter (mean = 350), with 1 to 3 nonpapillate to slightly papillate ostioles and a buff conidial matrix. Conidia produced on phialides were 8 to 13 by 1.5 to 2.5 µm, hyaline, aseptate, cylindrical, with an abruptly tapered, typically slightly protuberant base, 2 to 3 guttules, and sometimes with a mucilaginous, flexuous, unbranched appendage which is attached to the apex of the conidium and disappears with age. Conidiogenous cells were flask shaped and 6 to 15 ×1.5 to 3 µm. Colony characteristics included felt-like aerial white mycelium, gray olivaceous at the center becoming greenish to colorless toward the margin, in concentric rings, with pycnidia forming in 5 to 7 days originating from the center of the plate. Morphological characteristics of the fungus had the greatest conformity with the description for C. pinastri. Based on molecular and morphological data, the fungus is identified as P. lacerum. 'Fuji' apple fruit and 'd'Anjou' pear fruit that were wounded, inoculated with representative isolates, and incubated at 0°C yielded the same symptoms as seen on decayed fruit collected from commercial fruit packinghouses. Stem-end rot, calyx-end rot, and wound-associated rot developed on fruit inoculated in the orchard after 3 months of cold storage. The fungus was reisolated from the diseased fruit. This is the first report of a fruit rot in apple and pear caused by P. lacerum. We propose Phacidium rot as the name of this disease.

A Postharvest Fruit Rot of Apple Caused by Lambertella corni-maris in Washington State.

During surveys for postharvest diseases of apple conducted in Washington State, an unknown fruit rot was observed on stored apple fruit collected from commercial fruit packinghouses. This disease was present in 66 of the 179 grower lots sampled, accounting for an average 1 to 3% of the total decayed fruit sampled. The disease appeared to originate from infection of wounds on the fruit skin. Lesions were brown and decayed tissues were spongy. A Lambertella sp. was consistently isolated from the decayed fruit. Sequences of the fungus and those of Lambertella corni-maris in GenBank differed by 0 to 4 bp across the combined small ribosomal subunit + internal transcribed spacer + large ribosomal subunit regions with a maximum identity ranging from 99 to 100%. The fungus grew at 0 to 20°C and formed apothecia on artificial media after 8 to 24 weeks. On potato dextrose agar under a 12-h photoperiod, apothecial dimensions were variable, ranging from 1 to 6 mm in diameter with stipes of 1 to 4 by 0.5 mm. Asci were 76 to 125 by 3.5 to 5.5 µm, inoperculate, eight-spored, clavate, and narrowed at the base. Ascospores were aseptate, 7 to 10 by 2.5 to 4.5 µm, uniseriate to biseriate, and orange-brown at maturity in the ascus. Colony characteristics included little or no aerial mycelium, dark-yellow to gray-black mycelium, gray-black pseudosclerotia, and yellow pigmentation in the agar. Morphological characteristics of the fungus overlapped with the description of L. corni-maris. 'Fuji' apple fruit that were wounded, inoculated with representative isolates, and incubated at 0°C yielded the same symptoms as seen in packinghouses, and the fungus was reisolated from the diseased fruit. This is the first report of a fruit rot in stored apple caused by L. corni-maris in the United States. We propose Lambertella rot as the name of this disease.

First Report of Dodder (Cuscuta pentagona) on Chickpea (Cicer arietinum) in the United States.

Chickpea (Cicer arietinum L.) is an important rotational and an emerging specialty crop in the Pacific Northwest of the United States, in California, and in the Northern Great Plains of the United States and Canada. Dodders (Cuscuta spp.) are widespread parasitic weeds on many crops worldwide. Several Cuscuta species (primarily C. campestris Yuncker) have been reported to parasitize chickpea, and dodder is important on chickpea in the Indian subcontinent, the Middle East, and recently in Australia (4), but has previously not been reported from North America. On 28 July 2012, a chickpea field near Walla Walla, WA, was found parasitized by dodder. The chickpea was at late flowering and early pod filling stages and there were no other visible green weedy plants as observed from the canopy. There were about 15 dodder colonies varying in size from 2 to 15 meters in diameter in the field of about 500 acres. Chickpea plants in the center of the dodder colonies were wilting or dead. The colonies consisted of orange leafless twining stems wrapped around chickpea stems and spreading between chickpea plants. Haustoria of the dodder penetrating chickpea stems were clearly visible to the naked eye. Flowers, formed abundantly in dense clusters, were white and five-angled, with capitate stigmas, and lobes on developing calyxes were clearly overlapping. The dodder keyed to C. pentagona Engelm. in Hitchcock and Cronquest (3) and in Costea (1; and www.wlu.ca/page.php?grp_id=2147&p=8968 ). Specimens of dodder plants wrapping around chickpea stems with visible penetrating haustoria were collected on 28 July 2013 and vouchers (WS386115, WS386116, and WS386117) were deposited at the Washington State University Ownbey Herbarium. All dodder colonies in the field were eradicated before seed formation to prevent establishment of dodder. Total genomic DNA was isolated from dodder stems, and PCR primers ITS1 (5'TCCGTAGGTGAACCTGCGG) and ITS4 (5'TCCTCCGCTTATTGATATGC) were used to amplify the internal transcribed spacer (ITS) region of the nuclear rDNA. The ITS region was sequenced. BLAST search of the NCBI nucleotide database using the ITS sequence as query found that the most similar sequence was from C. pentagona (GenBank Accession No. DQ211589.1), and our ITS sequence was deposited in GenBank (KC832885). Dodder (C. approximata Bab.) has been historically a regional problem on alfalfa (Washington State Noxious Weed Control Board 2011). Another species stated to be "mainly" associated with legumes is C. epithymum Murr., and C. pentagona is "especially" associated with legumes (3). The latter species has sometimes been considered a variety (var. calycina) of C. campestris Yuncker (1,3). Although chickpea has been cultivated in the Walla Walla region for over 20 years, to our knowledge, this is the first time dodder has been observed on chickpea in North America. The likely source is from nearby alfalfa or other crop fields, with transmission by farm machinery or wild animals. Some chickpea germplasm exhibits partial resistance to C. campestris (2). References: (1) M. Costea et al. SIDA 22:151, 2006. (2) Y. Goldwasser et al. Weed Res. 52:122, 2012. (3) C. L. Hitchcock and A. Cronquist. Flora of the Pacific Northwest: An Illustrated Manual. University of Washington Press, Seattle, 1973. (4) D. Rubiales et al. Dodder. Page 98 in: Compendium of Chickpea and Lentil Diseases and Pests. W. Chen et al., eds. APS Press, St. Paul, Minnesota, 2011.

Species and ecological diversity within the Cladosporium cladosporioides complex (Davidiellaceae, Capnodiales).

The genus Cladosporium is one of the largest genera of dematiaceous hyphomycetes, and is characterised by a coronate scar structure, conidia in acropetal chains and Davidiella teleomorphs. Based on morphology and DNA phylogeny, the species complexes of C. herbarum and C. sphaerospermum have been resolved, resulting in the elucidation of numerous new taxa. In the present study, more than 200 isolates belonging to the C. cladosporioides complex were examined and phylogenetically analysed on the basis of DNA sequences of the nuclear ribosomal RNA gene operon, including the internal transcribed spacer regions ITS1 and ITS2, the 5.8S nrDNA, as well as partial actin and translation elongation factor 1-α gene sequences. For the saprobic, widely distributed species Cladosporium cladosporioides, both a neotype and epitype are designated in order to specify a well established circumscription and concept of this species. Cladosporium tenuissimum and C. oxysporum, two saprobes abundant in the tropics, are epitypified and shown to be allied to, but distinct from C. cladosporioides. Twenty-two species are newly described on the basis of phylogenetic characters and cryptic morphological differences. The most important phenotypic characters for distinguishing species within the C. cladosporioides complex, which represents a monophyletic subclade within the genus, are shape, width, length, septation and surface ornamentation of conidia and conidiophores; length and branching patterns of conidial chains and hyphal shape, width and arrangement. Many of the treated species, e.g., C. acalyphae, C. angustisporum, C. australiense, C. basiinflatum, C. chalastosporoides, C. colocasiae, C. cucumerinum, C. exasperatum, C. exile, C. flabelliforme, C. gamsianum, and C. globisporum are currently known only from specific hosts, or have a restricted geographical distribution. A key to all species recognised within the C. cladosporioides complex is provided.

Morphological plasticity in Cladosporium sphaerospermum.

A morphologically distinct isolate of Cladosporium sphaerospermum from a North American patent collection, referenced as Cladosporium lignicola in the patent, was examined. Generic affinity was confirmed by scanning electron microscopic examination of conidiogenous loci and conidial hila. Species identity as C. sphaerospermum was indicated by DNA sequence data derived from actin and translation elongation factor 1-alpha genes, and the internal transcribed spacer region. The isolate broadens the morphological limits of C. sphaerospermum by production of obclavate, occasionally transversely septate conidia with subrostrate conidiogenous apices ('alternarioid' conidia), and by production of conidia larger than those in prior standard descriptions. Type material of C. lignicola was re-examined and compared with the North American fungus, from which it is morphologically distinct. The decision to reduce C. lignicola to synonymy under C. herbarum was confirmed.

Baseline Sensitivity of Ascochyta rabiei to Azoxystrobin, Pyraclostrobin, and Boscalid.

Ascochyta rabiei, causal agent of Ascochyta blight on chickpea (Cicer arietinum), can cause severe yield loss in the United States. Growers rely on applications of fungicides with site-specific modes of action such as the quinone outside inhibiting (QoI) fungicides azoxystrobin and pyraclostrobin, and the carboximide fungicide boscalid, to manage disease. In all, 51 isolates collected prior to QoI fungicide registration and 71 isolates collected prior to boscalid registration in the United States were tested in an in vitro assay to determine the effective fungicide concentration at which 50% of conidial germination was inhibited (EC50) for each isolate-fungicide combination. The effect of salicylhydroxamic acid (SHAM) on conidia of A. rabiei in the presence and absence of azoxystrobin also was assessed to determine whether the fungus is capable of using alternative respiration. Five of nine A. rabiei isolates tested had significantly higher (P ≤ 0.05) EC50 values when SHAM was not included in media amended with azoxystrobin, indicating that A. rabiei has the potential to use alternative respiration to overcome fungicide toxicity in vitro. EC50 values of azoxystrobin and pyraclostrobin ranged from 0.0182 to 0.0338 µg/ml and from 0.0012 to 0.0033 µg/ml, with mean values of 0.0272 and 0.0023 µg/ml, respectively. EC50 values of boscalid ranged from 0.0177 to 0.4960 µg/ml, with a mean of 0.1903 µg/ml. Establishment of these baselines is the first step in developing a monitoring program to determine whether shifts in sensitivity to these fungicides are occurring in the A. rabiei pathogen population.

Wild Allium spp. as Natural Hosts of Iris yellow spot virus.

The incidence of Iris yellow spot virus (IYSV) of genus Tospovirus, family Bunyaviridae in a commercial onion crop was first confirmed in Washington state during 2003 (1). First found in Adams County, IYSV has rapidly spread to all onion-producing counties in the state, affecting seed and bulb crops. The USDA-ARS Western Regional Plant Introduction Station (WRPIS) collects, maintains, and distributes various Allium (garlic and onion) accessions. As part of the regeneration process, accessions are grown under field conditions at the WRPIS farms in two locations: Pullman and Central Ferry, WA. Symptoms indicative of viral infection, now known to be caused by IYSV, first appeared in field-grown accessions in 1999. In June 2005, leaf and scape tissues were collected from WRPIS accessions of wild onions (Allium pskemense, A. vavilovii, and A. altaicum) in Central Ferry that had symptoms indicative of IYSV infection (2). IYSV infection was confirmed using enzyme-linked immunosorbent assay with a commercially available kit (Agdia Inc., Elkhart, IN). Virus infection was further verified using reverse transcription-polymerase chain reaction (RT-PCR) with primers derived from the small (S) RNA of IYSV. The primers flanked the IYSV N gene (5'-TAA AAC AAA CAT TCA AAC AA-3' and 5'-CTC TTA AAC ACA TTT AAC AAG CAC-3'). RT-PCR gave a PCR product of expected size (≈1.2 kb). The DNA amplicon was cloned and sequenced. Nucleotide sequence comparisons with known IYSV N gene sequences showed 95 to 98% sequence identity. The prevalence of the vector, onion thrips (Thrips tabaci), combined with the widespread incidence of IYSV in seed and bulb production areas of the state may have resulted in natural infection of wild relatives of cultivated onion. The potential role of wild Allium spp. in IYSV epidemiology remains to be determined. Information on the extent of IYSV infection of onion germplasm would be useful in identifying potential sources of host plant resistance to IYSV. References: (1) L. J. du Toit et al. Plant Dis. 88:222, 2004. (2) B. Hellier et al. APSnet Image of the Week. Online publication, iw000049.asp, 2004.

First Report of Onion yellow dwarf virus, Leek yellow stripe virus, and Garlic common latent virus in Garlic in Washington State.

Washington State ranks fourth in the country in garlic (Allium sativum) production (2). The impact of viruses on garlic production may be significant in Washington State, but little is known about the occurrence or identity of specific viruses (2). The USDA-ARS Western Regional Plant Introduction Station (WRPIS) collects, maintains, and distributes garlic accessions. As part of the regeneration process, accessions are grown in field conditions at the WRPIS farm in Pullman, WA. In June 2004, several WRPIS accessions developed symptoms indicative of viral infection, primarily chlorotic spots and yellow stripes on leaves and scapes. Cultivars Georgia Fire and Georgia Crystal showed more than 90% incidence of symptomatic plants. Some chlorotic spots appeared similar to those caused by Iris yellow spot virus on other Allium spp. such as A. cepa. However, enzyme-linked immunosorbent assay (ELISA), as well as polymerase chain reaction (PCR) with IYSV-specific primers (1) did not reveal the presence of IYSV. Degenerate, group-specific primers to potyviruses (3) and carlaviruses (courtesy of S. D. Wyatt) were used on total nucleic acids extracted from each symptomatic plant with reverse transcription (RT)-PCR. The samples (n = 26) gave an RT-PCR product of the expected size with the group-specific potyvirus RT-PCR test. One sample was positive with the carlavirus group RT-PCR test. RT-PCR products from both tests were cloned and sequenced. Comparisons with sequences in GenBank showed that all but one had Onion yellow dwarf virus (OYDV), whereas one sample had a mixed infection of OYDV and Leek yellow stripe virus. Sequence analysis showed that the carlavirus was Garlic common latent virus. Sequence identities ranged from 95 to 99% for each of the viruses when compared with those available in GenBank. All samples were then tested for each of these viruses with commercially available antisera. Results of ELISA confirmed the findings of RT-PCR. To our knowledge, this is the first report for each of these garlic viruses from Washington State. This finding prompts the need for evaluating all garlic accessions for the potential impact of these viruses on garlic germ plasm conservation and distribution. References: (1) L. J. du Toit et al. Plant Dis. 88:222, 2004. (2) R. M. Hannan and E. J. Sorensen. Crop Profile for Garlic in Washington. Washington State University Coop Extension and the U.S. Department of Agriculture, 2002. (3) S. S. Pappu et al. J. Virol. Methods 41:9, 1993.

First Report of Onion Rust Caused by Puccinia allii on Allium pskemense and A. altaicum.

In June 2003, uredinial and telial pustules were seen on leaves of accession W6-12755 Allium pskemense B. Fedtsch. originating from Uzbekistan and grown for germplasm increase in Pullman, WA. W6-18947 A. altaicum Pall., originating from Mongolia, displayed similar symptoms in the same garden in June 2000. A. altaicum is a wild onion exploited for food in its native range and is ancestral to A. fistulosum L., bunching onion (2). A. pskemense is a wild perennial sometimes propagated under cultivation (2). Both species have been exploited for research in breeding and systematics of Allium and used to a lesser degree in screening for pest or disease resistance. Clustered, golden orange, amphigenous uredinia were approximately 1 × 0.5 mm and surrounded by stromatic, subepidermal, blackish telia of variable size. Urediniospores (thick-walled, pale orange, echinulate, (25-) 27 to 32 (-34) × (19-) 21 to 25 µm, with as many as 10 scattered, indistinct pores), teliospores (two-celled, smooth, golden brown, 42 to 65 × 18 to 26 µm), and mesospores (27 to 42 × 15 to 21 µm, and approximately 30% as frequent as teliospores) all approximated the description for P. allii Rudolphi (4), but were more strongly congruent with the description of Puccinia blasdalei Diet. & Holw. (1), now considered a synonym (4). Specimens are deposited with WSP, Washington State University, Pullman. P. allii or its synonyms have been recorded from over 30 species of Allium (1,3,4), but to our knowledge, this is the first report of this rust on A. pskemense or A. altaicum. References: (1) J. C. Arthur. Manual of the Rusts in United States and Canada, Hafner Publishing, N.Y., 1962. (2) J. L. Brewster. Onions and Other Vegetable Alliums. CABI, Wallingford, Oxon, U.K, 1994. (3) D. F. Farr et al. Fungal Databases, Systematic Botany and Mycology Laboratory, On-line publication. ARS, USDA, 2003. (4) G. F. Laundon and J. M. Waterston. Puccinia allii. No. 52 in: Descriptions of Pathogenic Fungi and Bacteria. CMI, Kew, Surrey, U.K., 1965.

First Report of Pink Seed of Pea Caused by Erwinia rhapontici in the United States.

In March 2001, the USDA Federal Grain Inspection Service sent for analysis to USDA-ARS, Pullman, WA, 12 discolored seeds of field pea (Pisum sativum L.) from northeastern Montana. Symptoms consisted of pale pinkish brown-to-bright pink discoloration throughout the seed coat. Unlike the pink coloration resulting from application of pink pesticidal seed treatments, the coloration was permanent and could not be removed by extended washing. Ten discolored seeds were disinfested in 0.5% NaOCl for 1 to 2 min and rinsed in sterile distilled water. Five seeds were placed on malt extract agar amended with streptomycin sulfate and tetracycline hydrochloride at 50 mg per liter each, and five seeds were placed on nutrient broth yeast extract agar (NBY) (3) and incubated under ambient lab conditions. No organisms were isolated from peas on the antibiotic agar, but pale pink bacterial colonies were recovered from each of the five peas on NBY. The pink colonies were streaked for selection of single colonies, stored at 4°C, and revived for growth in shaken (120 rpm) NBY broth to optical density (OD) = 0.1 at 640 nm (≈108 CFU/ml). Three pea plants and one control plant were grown in the greenhouse until pods were sufficiently developed to be syringe-inoculated at the suture with 100 µl of bacterial culture. The experiment was repeated using a second bacterial isolate. In each experiment, pods on inoculated plants, but not the control plant, exhibited pale pinkish areas and later produced seeds discolored in shades of pink matching those from the original sample. Some symptomatic seeds were shriveled or aborted as well as discolored. Discolored seeds from the two experiments were plated to NBY and pale pinkish colonies were recovered as before, but no such colonies were recovered from the controls. Two isolates from the original sample and two recovered from the experimental inoculations were tested for anaerobic and aerobic growth using API 50 CHE and API 20 NE tests (bio Mérieux Vitek, Inc., Hazlewood, MO). Known strains of Erwinia rhapontici and E. rubrifaciens from the collection of Dennis Gross (Texas A&M University) were identically analyzed for comparison. All four isolates from pea were gram-negative, facultatively anaerobic, motile rod-shaped bacteria that produced a diffusible pink pigment on NBY. Tests indicated that these strains were E. rhapontici, because the results agreed with previously published data (1,2). Results with the known strain of E. rhapontici were congruent with those from the pea strains. The strain of E. rubrifaciens also produced a pink pigment on NBY, but unlike the other strains, it grew well at 37°C and was negative for acetoin production, nitrate reduction, esculin hydrolysis, and maltose, rhamnose, inositol, and melibiose fermentation and did not assimilate citrate aerobically. Pink seed of pea has been previously reported from Alberta, Canada (2). References: (1) J. G. Holt et al. Bergey's Manual of Determinative Bacteriology, Williams & Wilkins, Baltimore, MD, 1994. (2) H. C. Huang et al. Can. J. Plant Pathol. 12:445, 1990. (3) A. K. Vidaver. Appl. Microbiol. 15:1523, 1967.

Filamentous fungi quiescent in seeds and culm nodes of weedy and forage grass species endemic to the Palouse Region of Washington and Idaho.

Asymptomatic seeds of forage and weedy grasses from germplasm accessions and from uncultivated sites in eastern Washington and western Idaho were assayed for the presence of quiescent filamentous fungi. Asymptomatic culm nodes of the same species were similarly assayed. The predominant taxa isolated were strains of dematiaceous hyphomycetes, principally strains of Alternaria and Cladosporium. A. infectoria was the species most frequently isolated from seed. A. tenuissima was common and A. alternata was rare. Aspergillus, Penicillium and Fusarium were very rare or absent in stored germplasm. Pathogenic coelomycetes were common in asymptomatic node samples, occasionally present in asymptomatic field seed, but were not detected in germplasm accessions. Previous reports of frequent occurrence of A. alternata in grass seed are probably the results of misidentification of various small-spored Alternarias, especially A. infectoria, as A. alternata.

Novel bioactive breviane spiroditerpenoids from Penicillium brevicompactum Dierckx.

The structures of four new, naturally occurring bioactive spiroditerpenoids, (+)-breviones B, C, D, and E, potential allelopathic agents, have been determined from extracts of semisolid fermented Penicillium brevicompactum Dierckx. The structures display the novel breviane spiroditerpenoid skeleton. Structure elucidation was performed by chemical transformations and by homo- and heteronuclear 2D-NMR spectral data. On the basis of combined studies of the theoretical conformations and NOEDIFF data, their relative stereochemistry is proposed. A mixed biogenesis for this novel family of spiroditerpenoids is tendered. The levels of activity shown by breviones B, C, and E in the etiolated wheat coleoptiles bioassay, especially breviones E (100% inhibition) and C (80% inhibition) both at 10(-4) M, suggest them as lead compounds for new agrochemicals.

The use of 3-dimensional models in auricular reconstruction.

Reconstruction of the microtic auricle is a difficult process requiring considerable experience and dedication to detail. It is a multistage proposition requiring the talents of both the reconstructive surgeon and the otologic surgeon. Reconstruction of the external ear usually precedes the reconstruction of the middle ear. Often, a template is used by the reconstructive surgeon to aid in this complicated process. Traditionally, templates used by the reconstructive surgeon have been 2 dimensional (usually x-ray paper) and made from the opposite normal ear or another normal ear in cases of bilateral microtia. Use of a 2-dimensional model only provides a rough estimate of the cartilage framework needed. Considerable experience is therefore needed to get this cartilage framework "just right." We have developed a number of 3-dimensional synthetic templates to aid in the creation of an accurate cartilage framework implant. These templates serve as a more accurate guide in the complex cartilage carving and assembly process. The use of 3-dimensional templates has improved our technical reconstructive results in a small number of patients. We present these results and propose future application of these ideas.

Ruakuric acid: a natural product from Aspergillus fumigatus.

A new chroman derivative, named ruakuric acid, was isolated from a strain of Aspergillus fumigatus growing in conjunction with a coral lichen. The structure was determined as 6-acetyl-5-hydroxy-4-methoxy-chroman-2-carboxylic acid (mixture of 2,4-cis,trans isomers).