RESUMO
The adsorption process of three aptamers with gold nanosheet (GNS) as a drug carrier has been investigated with the help of molecular dynamics simulations. The sequencing of the considered aptamers are as (CUUCAUUGUAACUUCUCAUAAUUUCCCGAGGCUUUUACUUUCGGGGUCCU) and (CCGGGUCGUCCCCUACGGGGACUAAAGACUGUGUCCAACCGCCCUCGCCU) for AP1 and AP2, respectively. AP3 is a muted version of AP1 in which nucleotide positions 4, 6, 18, 28 and 39 have C4A, U6G, A18G, G28A, and U39C mutations. At positions 24, and 40, a deletion mutation is seen to eliminate U24 and U40 bases. These aptamers are inhibitors for HIV-1 protease and can be candidates as potential pharmaceutics for treatment of AIDS in the future. The interactions between considered aptamers and GNS have been analyzed in detail with help of structural and energetic properties. These analyses showed that all three aptamers could well adsorb on GNS. Overall, the final results show that the adsorption of AP2 on the GNS is more favorable than other considered ones and consequently GNS can be considered as a device in order to immobilize these aptamers.
Assuntos
Fármacos Anti-HIV/química , Aptâmeros de Nucleotídeos/química , Sistemas de Liberação de Medicamentos , Ouro/química , Nanopartículas Metálicas/química , Simulação de Dinâmica Molecular , Portadores de Fármacos/química , Ligação de HidrogênioRESUMO
The prediction of deep eutectic composition is hard and so far, has been distinguished by trial and error. Therefore, in this work, molecular dynamics simulations were performed for specifying the composition of the eutectic point of phenyl propionic acid (Phpr) and choline chloride (ChCl) mixtures. The distinctive properties of the Phpr and ChCl eutectic mixture at the composition of the eutectic point were investigated and were compared to other eutectic mixtures with the different mole fractions of Phpr and ChCl. Structural properties such as radial distribution function (RDF), coordination number, hydrogen-bond number, interaction energies, and dipole moment of species, as well as dynamical properties such as mean square displacement (MSD), viscosity, and self-diffusion coefficient were analyzed. The obtained results of structural properties indicated that each chloride anion is surrounded by two Phpr molecules for deep eutectic point states that is in good agreement with available experimental reports. Moreover, the viscosity of studied mixtures evaluated by the Green-Kubo method was found to be consistent with the reported experimental data. Besides, the stress-autocorrelation function (SACF) and convergency of viscosity with time were calculated. Finally, the eutectic point could be detected by the changes in the trends of total van der Waals interaction energies and the viscosity.