Clinical effects of TB sequelae in patients with COPD.

BACKGROUND: TB is a risk factor for chronic obstructive pulmonary disease (COPD) development and causes the global burden of COPD to increase. The impact of TB sequelae on COPD has been ignored for years.OBJECTIVE: To determine the prevalence of TB sequelae in patients with COPD and investigate the effect of TB sequelae on COPD clinic burden.METHODS: A total of 172 patients who attended the chest diseases outpatient clinic were included in the study. Detailed anamneses of their TB were taken, and pulmonary function tests were performed. The COPD Assessment Test (CAT) questionnaire was administered to determine the health status, and the modified Medical Research Council (mMRC) scale was used to assess the severity of dyspnoea. Thorax computed tomography images were reviewed. The patients were divided into two groups based on the presence of TB sequelae. All data from the two groups were compared.RESULTS: Of 172 patients with COPD, 66 (38%) had TB sequelae; 28 (46%) patients with TB sequelae had no history of TB. Two patients with TB history had no TB sequelae. The group with TB sequelae had lower body mass index (P < 0.001), more emergency admissions (P = 0.018), and higher CAT and mMRC scores (P = 0.002 and P = 0.004, respectively). In the group with TB sequelae, bronchiectasis was more common (P = 0.001).CONCLUSION: In patients with COPD, TB sequelae are very common and increase the COPD clinic burden. The presence of TB sequelae causes an increase in the use of healthcare services by patients with COPD and, therefore, an increase in the burden of COPD. Prevention, early diagnosis and timely treatment of TB are therefore very important.

First Report of Artichoke yellow ringspot virus in Globe Artichoke in Turkey.

Turkey is one of the main globe artichoke (Cynara cardunculus L. subsp. scolymus (L.) Hayek) producers in the world. Cultivation of this crop is done mainly in the Aegean and Eastern Marmara regions with asexually propagated cultivars such as Bayrampasa and Sakiz. More than half of total globe artichoke production in Turkey is obtained from the provinces of Izmir, Aydin, and Mugla in the Aegean region. Surveys in 2011 and 2012 were carried out to look for the presence of Artichoke yellow ringspot virus (AYRSV), Tobacco mosaic virus (TMV), and Tomato spotted wilt virus (TSWV) in the globe artichoke production areas in these three provinces. Double antibody sandwich (DAS)-ELISA and reverse transcriptase (RT)-PCR assays conducted for TMV and TSWV showed that the samples were not infected with these two viruses. Due to the lack of commercial ELISA kits against AYRSV, RT-PCR and biological indexing were used for its identification. Leaf tissues from 35 symptomatic and 25 symptomless plants were sampled and analyzed by RT-PCR using as template total RNAs extracted by a silica gel method (1). RT-PCR was conducted as previously reported (1). A PCR product of the expected size (about 530 bp) was obtained from five plant samples that were collected from Izmir province and had symptoms of bright yellow spots and line patterns on the leaves. The incidence of diseased plants in the fields ranged from 1 to 5%. In previously conducted studies, these symptoms were defined as typical symptoms of AYRSV on artichokes (2,3,4). One of the PCR products was cloned and sequenced. BLASTn analysis of the obtained sequence (GenBank Accession No. KC622054) showed 92% nucleotide identity with the partial RNA1 sequence of an AYRSV isolate from Allium cepa (AM087671.2). Furthermore, selected test plants were mechanically inoculated with sap from plant samples that were positive in RT-PCR. Chlorotic local lesions and systemic mottling symptoms were observed on Chenopodium quinoa; chlorotic lesions, mosaic, and deformation on Cucumis sativus; and systemic mosaic, reddish necrotic local lesions, and malformation on Phaseolus vulgaris (French bean). Results of the biological tests were confirmed by RT-PCR. AYRSV has a wide host range including artichoke and six other cultivated plant species and can be easily transmitted by seed, plant sap, and vegetative propagation (3). To our knowledge, this is the first report of natural infection of globe artichoke by AYRSV in Turkey. AYRSV infections can have a detrimental effect on the growth and yield of artichoke plantings. This assay will be useful for further epidemiological studies. References: (1) X. Foissac et al. Acta Hortic. 550:37, 2001. (2) D. Galliitelli et al. Adv. Virus Res. 84:289, 2012. (3) P. E. Kyriakopoulou et al. Ann. Inst. Phytopathol. Benaki 14:139, 1985. (4) V. I. Maliogka et al. Phytopathology 96:622, 2006.

First Report of Grapevine Leafroll-associated Virus 4 in Vineyards of Turkey.

Turkey is one of the main grape producers in the world, with an annual production of about 4 million tons on approximately 500,000 hectares of viticulture areas, mainly in the Aegean, Southeast Anatolia, and Central Anatolia regions. Nearly 29% of the vineyards in Turkey are located in the Aegean region, with major growing districts including the provinces of Manisa and Izmir. Previous studies have shown that Grapevine leafroll-associated viruses (GLRaV-1, -2, -3, -5, -6, and -7), which cause Grapevine Leafroll Disease (GLD), were present in Turkish vineyards (1,2). Surveys in 2009 and 2011 were conducted to determine other viruses associated with this disease in commercial vineyards of the provinces of Manisa and Izmir. Leaves and young canes were randomly collected from individual symptomatic and symptomless grapevines (Vitis vinifera L.) of red or white cultivars in late summer and autumn. Symptoms observed in plants were reddening and downward rolling of leaves in red cultivars and yellowing of leaf tissue between main veins and leaf curling in white cultivars. In addition, affected grapevines appeared to have reduced growth resulting in smaller canopies. Samples were analyzed first by double antibody sandwich (DAS)-ELISA using commercial diagnostic kits (Bioreba, Switzerland) to GLRaV-4-9 according to the manufacturer's instructions. The results from serological assays on 145 samples revealed that five samples of cv. Syrah and three of cv. Round seedless from Izmir-Menderes and from Manisa-Alasehir, respectively, reacted positively with specific antibodies to GLRaV-4-9. The identification of GLRaV-4 was confirmed by reverse transcriptase-PCR and total nucleic acids were extracted by a silica capture method from fresh, symptomatic plant samples (3). The synthesis of complementary DNA (cDNA) was performed by a Fermentas cDNA synthesis kit in accordance with the procedure specified by the manufacturer and specific primers (Forward: CCAACTGTCGTGGGTATAAGGAAT, Reverse: CCCAGACACCGGTCCTATACT) were used according to methods described by Maliogka et al. (4). An expected PCR product of approximately 200 nt was obtained from symptomatic samples that were GLRaV-4 positive in DAS-ELISA. GLRaV, comprising GLRaV-4 as quarantine pests, are under official control in Turkey. To our knowledge, this is the first report of natural GLRaV-4 infection of grapevines in Turkey. References: (1) B. Akbas et al., J. Phytopathol. 155:122, 2007. (2) N. Buzkan et al., J. Phytopathol. 158:448, 2010. (3) X. Foissac et al., Acta Hortic. 550:37, 2001. (4) V. I. Maliogka et al., J. Virol. Methods 154:41, 2008.

Optimization of cDNA amplification of Apricot Latent Virus (ApLV) from various plant tissues sources.

Although the reverse transcriptase polymerase chain reaction (RT-PCR) procedure is basically simple operation, often it is not possible to achieve optimum results without optimizing the protocols. An RT-PCR method targeting a 200 bp sequence of the CP gene of Apricot Latent Virus (ApLV) was used as a model to improve the detection limit and to compare the behavior of three different plant tissues in a RT-PCR assay. A number of factors should be considered when selecting the optimal system for RT-PCR. Important considerations include the optimal concentrations of MgCl2, dNTP, Taq DNA polymerase enzyme, specific primer and the amount of cDNA for the downstream applications. This study therefore discusses a series of critical PCR parameters and feasible strategies for optimization of RT-PCR detection of ApLV.

Women's quality of life in the premenopausal and postmenopausal periods.

PURPOSE: The purpose of this research was to determine the relationship between menopausal symptoms and quality of life in women in the pre and postmenopausal periods. METHODS AND INSTRUMENTS: All 171 women in the climacteric period who registered at the Pamukkale University Education and Research Hospital Obstetrics and Gynecology Clinic between January and July 2001 were included in the study. A questionnaire asking for sociodemographic information, complaints related to the climacteric period, and HRT use, as well as the WHOQOL brief, were used in order to obtain data. FINDINGS: One hundred of the women who participated in the study were premenopausal and 71 were postmenopausal and the mean age was 47.39 (SD=6.65). No significant difference was found in pre and postmenopausal women in the comparison of their quality of physical life, psychological, social relationships and environment scores (p>0.05). The physical quality of life scores for those without vasomotor complaints in the pre and postmenopausal periods were significantly higher in those with a high educational level and women who had been menopausal between 1-5 years and more than 10 years (p<0.05). Age and HRT use in postmenopausal women were not found to affect quality of life scores (p>0.05). RESULT: We did not find any significant difference in the quality of life of pre and postmenopausal women.

Primary psoas muscle abscess diagnosed and treated during pregnancy: case report and literature review.

BACKGROUND: Primary psoas muscle abscess is rare and can be difficult to diagnose, particularly during pregnancy. CASE: To our knowledge, this is the first case of primary psoas muscle abscess diagnosed during pregnancy. Clinical investigation did not reveal any infection spreading from adjacent structures. Surgical drainage and simultaneous Cesarean delivery of the infant, combined with appropriate antibiotics, enabled a cure. CONCLUSION: The possibility of psoas muscle abscess should be taken into account when investigating lower back pain during pregnancy if conventional approaches are unsatisfactory.