[Relationship between blood uric acid levels and body composition in patients with polycystic ovary syndrome].

Objective: To analyze the difference in blood uric acid levels between patients with polycystic ovary syndrome (PCOS) and healthy women of childbearing age, and to investigate the correlation between body composition and blood uric acid levels. Methods: A total of 153 eligible childbearing age patients with PCOS treated at Tianjin Medical University General Hospital from January 2018 to March 2022 were selected, and 153 healthy women with normal menstruation were selected as the control group. Fasting blood uric acid levels were measured by venous blood test, and body composition was measured by a body composition analyzer. Group comparisons were made to analyze the correlation between body composition and blood uric acid levels. Results: The incidence of hyperuricemia was higher in patients with PCOS than that in the control group [30.1% (46/153) vs 2.0% (3/153)], with a statistically significant difference (χ2=44.429, P<0.001). Blood uric acid level was also significantly higher in patients with PCOS than that in the control group [(371±98) vs (265±67) µmol/L; t=11.170, P<0.001]. Among PCOS patients, there were statistically significant differences in weight, body mass index (BMI), body fat mass, skeletal muscle mass, percent body fat, lean body weight, fat mass/lean body weight, percent skeletal muscle, and visceral fat level between the hyperuricemia group and the normal blood uric acid group (all P<0.001), but no significant difference was observed in waist-hip ratio (P=0.348). The following body composition indicators: weight, BMI, waist-hip ratio, body fat mass, skeletal muscle mass, percent body fat, visceral fat level, lean body weight, and fat mass/lean body weight in all subjects, the PCOS patients and the control group, were positively correlated with blood uric acid levels (all P<0.01). The blood uric acid level in PCOS obese patients was higher than that in non-obese PCOS patients, and the difference was statistically significant [(425±83) vs (336±91) µmol/L; t=6.133, P<0.001]. The blood uric acid level in central obesity PCOS patients was also higher than that in non-central obesity PCOS patients [(385±95) vs (299±79) µmol/L], the difference was statistically significant (t=4.261, P<0.001). The blood uric acid level in normal-weight obese PCOS patients was higher than that in normal-weight non-obese PCOS patients [(333±73) vs (277±54) µmol/L], and the difference was statistically significant (t=2.848, P=0.006). Blood uric acid levels in normal-weight [(315±74) vs (255±67) µmol/L], overweight [(362±102) vs (276±57) µmol/L], and obese PCOS patients [(425±83) vs (303±74) µmol/L] were all higher than those in the corresponding control groups, with statistically significant differences (all P<0.001). Conclusions: PCOS patients have a higher incidence of hyperuricemia than healthy women of childbearing age. Blood uric acid levels are closely correlated with body composition indicators, such as weight, BMI, waist-hip ratio, body fat mass, skeletal muscle mass, percent body fat, and visceral fat level. Body composition analysis of women with PCOS could help identify potentially obese people more accurately and carry out individualized treatment, thereby reducing the risk of metabolic abnormalities.

Secondary mental health service utilisation following emergency department contact for suicidal behaviour: A systematic review.

OBJECTIVE: Engagement with secondary mental health services after an emergency department presentation with suicidal behaviours may be an important strategy for reducing the risk of repeat attempts. Our aim was to examine secondary mental health service contact following a presentation to emergency department with suicidal behaviours. METHODS: A systematic review of papers published between 2000 and 2020 was undertaken. This identified 56 papers relating to 47 primary studies. Data were extracted and summarised separately by age group: (1) young people, (2) older adults and (3) adults and studies with participants of 'all ages'. RESULTS: Studies in young people (n = 13) showed, on average, 44.8% were referred and 33.7% had contact with secondary mental health services within 4 weeks of emergency department discharge. In comparison, in adult/all ages studies (n = 34), on average, 27.1% were referred to and 26.2% had mental health service contact within 4 weeks. Only three studies presented data on contact with mental health services for older adults, and proportions ranged from 49.0% to 86.0%. CONCLUSION: This review highlights poor utilisation of secondary mental health service following emergency department presentation for suicidal behaviours, and further research is needed to identify the reasons for this. Crucially, this information could assist in the allocation of resources to facilitate the timely implementation of suicide prevention services.

[Associations of genetic variations in pyroptosis related genes with acute adverse events in postoperative rectal cancer patients receiving concurrent chemoradiotherapy].

Objective: This study aims to investigate the associations between genetic variations of pyroptosis pathway related key genes and adverse events (AEs) of postoperative chemoradiotherapy (CRT) in patients with rectal cancer. Methods: DNA was extracted from the peripheral blood which was collected from 347 patients before CRT. Sequenom MassARRAY was used to detect the genotypes of 43 haplotype-tagging single nucleotide polymorphisms (htSNPs) in eight pyroptosis genes, including absent in melanoma 2 (AIM2), caspase-1 (CASP1), caspase-4(CASP4), caspase-5 (CASP5), caspase-11 (CASP11), gasdermin D (GSDMD), gasdermin E (GSDME) and NLR family pyrin domain containing 3 (NLRP3). The associations between 43 htSNPs and AEs were evaluated by the odd ratios (ORs) and 95% confidence intervals (CIs) by unconditional logistic regression models, adjusted for sex, age, clinical stage, tumor grade, Karnofsky performance status (KPS), surgical procedure, and tumor location. Results: Among the 347 patients with rectal cancer underwent concurrent CRT with capecitabine after surgery, a total of 101(29.1%) occurred grade ≥ 2 leukopenia. rs11226565 (OR=0.41, 95% CI: 0.21-0.79, P=0.008), rs579408(OR=1.54, 95% CI: 1.03-2.29, P=0.034) and rs543923 (OR=0.63, 95% CI: 0.41-0.98, P=0.040) were significantly associated with the occurrence of grade ≥ 2 leukopenia. One hundred and fifty-six (45.0%) had grade ≥ 2 diarrhea, two SNPs were significantly associated with the occurrence of grade ≥ diarrhea, including CASP11 rs10880868 (OR=0.55, 95% CI: 0.33-0.91, P=0.020) and GSDME rs2954558 (OR=1.52, 95% CI: 1.01-2.31, P=0.050). In addition, sixty-six cases (19.0%) developed grade ≥2 dermatitis, three SNPs that significantly associated with the risk of grade ≥2 dermatitis included GSDME rs2237314 (OR=0.36, 95% CI: 0.16-0.83, P=0.017), GSDME rs12540919 (OR=0.52, 95% CI: 0.27-0.99, P=0.045) and NLRP3 rs3806268 (OR=1.51, 95% CI: 1.03-2.22, P=0.037). There was no significant difference in the association between other genetic variations and AEs of rectal cancer patients (all P>0.05). Surgical procedure and tumor location had great impacts on the occurrence of grade ≥2 diarrhea and dermatitis (all P<0.01). Conclusion: The genetic variants of CASP4, CASP11, GSDME and NLRP3 are associated with the occurrence of AEs in patients with rectal cancer who received postoperative CRT, suggesting they may be potential genetic markers in predicting the grade of AEs to achieve individualized treatment of rectal cancer.

[Genetic variations in apoptosis genes are associated with acute adverse events in postoperative rectal cancer patients receiving concurrent chemoradiotherapy].

Objective: To investigate the associations between the genetic variations of apoptosis genes and the adverse events of postoperative concurrent chemoradiotherapy in patients with rectal cancer. Methods: We enrolled 362 patients with stage Ⅱ to Ⅲ rectal cancer who received concurrent chemoradiotherapy. Whole blood sample (2 ml) was collected from patient at the time of enrollment before therapy. Sequenom MassARRAY was used to detect the genotypes of 29 haplotype-tagging single nucleotide polymorphisms (htSNPs) in eight apoptosis genes, including Fas cell surface death receptor(FAS), Fas ligand(FASL), apoptotic peptidase activating factor 1(APAF1), BCL2 associated X(BAX), TNF-related apoptosis-inducing ligand(TRAIL), TNF-related apoptosis-inducing ligand receptor 1(TRAILR1), TNF-related apoptosis-inducing ligand receptor 2(TRAILR2) and caspase-7(CASP7). The associations between genotypes and adverse events of chemoradiotherapy were measured by unconditional logistic regression model. Results: Three hundred and sixty two patients were treated with total mesorectal excision surgery followed by a total radiation dose of 50 Gy applied in 25 fractions over a period of 5 weeks concurrently with daily administration of capecitabine (1 600 mg/m(2) per day, continuously for 2 weeks and taking a week off every 21-day cycle). One hundred and six patients (29.3%) had grade≥2 myelosuppression. Three SNPs associated with the risk of grade ≥2 myelosuppression included FAS rs1468063 (OR=1.51, 95% CI: 1.07-2.15, P=0.020), APAF1 rs11296996 (OR=0.69, 95% CI: 0.49-0.98, P=0.039) and BAX rs4645904 (OR=0.69, 95% CI: 0.50-0.97, P=0.030). One hundred and sixty one patients (44.5%) developed grade≥2 diarrhea. Five SNPs that significantly associated with risk of grade≥2 diarrhea included APAF1 rs11296996 (OR=1.42, 95% CI: 1.02-2.00, P=0.040), rs74619561 (OR=2.16, 95% CI: 1.27-3.68, P=0.005), CASP7 rs12263370 (OR=1.67, 95% CI: 1.05-2.66, P=0.029), rs12247479 (OR=1.85, 95% CI: 1.12-3.08, P=0.017) and TRAIL rs112822654 (OR=0.68, 95% CI: 0.48-0.96, P=0.027). The remaining SNPs were not related to the adverse events of chemoradiotherapy (all P>0.05). Grade≥2 myelosuppression occurred less frequently in male than in female (P=0.046); Surgical treatment and tumor location had great impact on the occurrence of grade≥2 diarrhea (all P<0.001) and dermatitis (all P<0.05). Conclusions: The genetic variations of FAS, APAF1, BAX, TRAIL and CASP7 are related to the adverse events of concurrent chemoradiotherapy in patients with rectal cancer, which may be potential genetic biomarkers for individualized treatment of rectal cancer.

[Genetic variations in MLH3 and MSH2 genes are associated with the sensitivity and prognosis in locally advanced rectal cancer patients receiving preoperative chemoradiotherapy].

Objective: To investigate the associations between genetic variations in DNA mismatch repair genes and sensitivity as well as prognosis to preoperative chemoradiotherapy in patients with locally advanced rectal cancer. Methods: Fourteen haplotype-tagging single nucleotide polymorphisms (htSNPs) of MLH1, MLH3 and MSH2 genes were genotyped by Sequenom MassARRAY method in 146 patients with locally advanced rectal cancer who received preoperative chemoradiotherapy. The associations between genotypes and response to capecitabine-based neoadjuvant chemoradiotherapy (nCRT) were measured by odds ratios (ORs) and 95% confidence intervals (CIs), adjusted for sex, age, clinical stages and karnofsky performance score (KPS) by unconditional logistic regression model. The survival analyses were performed by the hazard ratios (HRs) and 95% CIs by Cox proportional regression model. Results: Among 146 cases, 64 patients were nCRT responders with a response rate of 43.8%. MLH3 rs175057 C>T and MSH2 rs13019654 G>T loci were associated with the sensitivity to preoperative chemoradiotherapy. Compared with the rs175057 CC genotype, the adjusted OR for patients with CT and TT genotypes was 0.42 (95% CI: 0.19-0.91; P=0.029). Moreover, for rs13019654, the adjusted OR for patients with the GT or TT genotypes was 0.49 (95% CI: 0.24-0.98; P=0.047) than those with GG genotype. The remaining 12 SNPs, including rs1540354, rs4026175, rs1981929, rs2042649, rs2303428, rs3771273, rs4608577, rs4952887, rs6544991, rs6544997, rs10188090 and rs10191478, were not significantly associated with therapeutic response to preoperative chemoradiotherapy. Meanwhile, MLH3 rs175057 C>T locus was also associated with longer overall survival time in locally advanced rectal cancer (HR=0.44, 95% CI: 0.20-0.96, P=0.038), whereas MSH2 rs3771273 T>A, rs10188090 A>G and rs10191478 T>G loci were associated with shorter overall survival time (HR=1.74, 95% CI: 1.06-2.84, P=0.028; HR=1.64, 95% CI: 1.01-2.66, P=0.046; HR=1.71, 95% CI: 1.01-2.91, P=0.047, respectively). The remaining 10 SNPs, including rs1540354, rs4026175, rs1981929, rs2042649, rs2303428, rs4608577, rs4952887, rs6544991, rs6544997 and rs13019654, were not significantly associated with prognosis. Conclusions: Genetic polymorphisms of MLH3 rs175057 and MSH2 rs13019654 loci can predict the nCRT response, while MLH3 rs175057 as well as MSH2 rs3771273, rs10188090 and rs10191478 may predict prognosis in patients with locally advanced rectal cancer who received preoperative chemoradiotherapy. Therefore, these SNPs could be used as potential genetic markers in the personalized therapy of rectal cancer.

[Individualized treatment of bilateral carotid body tumor].

Objective: To investigate individualized therapeutic strategy for bilateral carotid body tumors. Methods: Clinical data of 16 patients with bilateral carotid body tumor treated from January 2003 to August 2016 were retrospectively studied. Of the 16 patients, 9 were males and 7 were females; 5 were sporadic and 11 were familial; 8 cases were observed, 1 cases was malignant and treated with chemotherapy, and 7 cases were treated with surgery. The treatment course, perioperative complications and clinical efficacy were assessed. Comprehensive evaluation of bilateral carotid body tumors was performed based on the size of bilateral tumor, clinical manifestations, genetic tests and other indicators. Individual treatment strategies included observation, surgery and observation, bilateral surgery, radiotherapy or chemotherapy. Surgical resection of carotid body tumor was unilateral in 3 cases and bilateral in 3 cases; removal of bilateral carotid body tumors plus unilateral jugular bulb in 1 case; and the internal carotid artery was reconstructed with autologous greater saphenous vein in 1 case. Results: All patients were followed up for 3 months to 12 years. There was no patient death during perioperative period. Superior laryngeal nerve injury occurred in 2 case. Baroreceptor failure syndrome occurred in one patient, but it gradually recoverd with medical treatments. Conlusion: It is important to identify whether bilateral carotid body tumors are hereditary and to make an individualized therapeutic strategy for each patient with bilateral carotid body tumors, focusing on the improvement in the quality of life of patient.

Expression of the key genes involved in ABA biosynthesis in rice implanted by ion beam.

The plant hormone abscisic acid (ABA) plays a central role in adaptive stress responses to abiotic environments, but little information exists about its responses to implantation with low-energy ion beams. The genes related to ABA synthesis including zeaxanthin epoxidase(ZEP), 9-cis-epoxycarotenoid dioxygenase (NCED), abscisic aldehyde oxidase (AAO), short-chain dehydrogenase/reductase-like(SDR), and cytochrome P450 in rice seedlings germinating from seeds implanted by ion beam for 72, 96, and 120 h after imbibitions (HAI) were determined by real-time PCR. Moreover, we also explored the changes of endogenous ABA content in rice seedlings after 48, 72, 96, 120, and 144 h after imbibitions using enzyme-linked immunosorbent assay (ELISA). The results showed that ion beam implantation could enhance the genes' transcription activity which was involved in ABA biosynthesis. However, the response of each gene is not consistent with the underlying differences in ion flux. The obviously up-regulated expression of ZEP, AAO2, SDR, and P450-2 were observed underlying the behaviour at an ion flux of 1 × 10(17) N(+)/cm(2). However, the expression of NCED, AAO1, and SDR2 can be enhanced by 5 × 10(17) N(+)/cm(2). The expression of AAO3, SDR1, and P450-1 can be elevated underlying the both ion flux of 1 × 10(17) N(+)/cm(2) and 5 × 10(17) N(+)/cm(2). The expression of SDR3 can be enhanced in every ion flux. The results of ELISA showed that endogenous ABA level in rice seedlings increased at treatment with vacuum, 1 × 10(17) and 5 × 10(17) N(+)/cm(2). Collectively, ion beam irritation can enhance the expression of genes involved in ABA biosynthesis, resulting in increasing content of endogenous ABA in rice. Our findings suggest that ABA pathway was involved in the adaption to irradiation with ion beam in plants.

First Report of Leaf Blotch Caused by Pestalotiopsis clavispora on Rosa chinensis in China.

Rosa chinensis Jacq, a traditional Chinese ornamental flower, is an important landscaping plant in northern China. Since July 2013, leaf blotch symptoms were observed in the Tianjin flower nursery (117°09' E 39°17' N). The garden exhibited 40% disease incidence with observable symptoms on basal leaves that were yellowed from the edge to the inside area on infected leaves, in the shape of a V. Yellow lesions covered one third to one half of the leaf. Yellow halos were observed at the junction of the healthy and diseased tissues. Small tissue pieces from the edges of lesions were disinfected in 70% ethyl alcohol for 30 s and 1% hypochlorite for 1 min, rinsed thrice in sterile water, plated on potato dextrose agar (PDA), and incubated at 25°C in lighted incubator for 4 days. Fungal colonies that developed on PDA were white and cottony with concentric rings. Black and globular acervuli appeared after 10 days at 25°C. Conidia (n = 20), which were fusiform, were 9.20 to 31.31 (avg. 26.5) × 4.83 to 9.11 (avg. 6.9) µm. Conidia of all isolates were five celled. Apical and basal cells were colorless, while the three median cells were dark brown. The single basal appendage of conidia was 2.85 to 16.05 µm in length and the two to three apical appendages were 5.93 to 36.23 µm in length. According to colony and conidia morphology (number of cells, number of appendages), the isolates were initially identified as Pestalotiopsis spp (2). A 525-bp band was produced in a conventional PCR assay. Primers ITS1 (5'TCCGTAGGTGAACCTGCGC3') and ITS4 (5'TCCTCCGCTTATTGATATGC3') were used to amplify and sequence the internal transcribed spacer region of rDNA. A BLAST search of the NCBI databases showed that isolate YJYK-1 had 99% homology with Pestalotiopsis clavispora isolate hz-067 (Accession No. FJ517545.1). Pathogenicity tests of the novel isolate YJYK-1 were conducted by placing agar plugs (5 mm in diameter) from an actively growing colony on PDA on surface-disinfected (70% ethyl alcohol, 30 s) leaves (1). Control leaves were inoculated with sterile PDA plugs. Plants with inoculated leaves (five per treatment) were placed in lighted growth chambers at 25°C for 10 days and watered as needed. Symptoms on inoculated leaves were similar to those previously described in the nursery. Black acervuli were easily found on the necrotic tissues. Control plants did not show any symptoms. Cultures isolated from the lesions were similar to those isolated previously from leaves in the nursery. Koch's postulates were confirmed after re-isolation. Although the diversity of endophytic Pestalotiopsis species and its distribution was investigated and the host plants were also listed in China (3), to our knowledge, this is the first report of P. clavispora causing leaf blotch on rose R. chinensis in China. References: (1) M. I. Ahmed et al. Eur. J. Plant Pathol. 135:619, 2013. (2) J. Y. Lu. Diagnosis of plant diseases. Page 194 in: Pestalotiopsis. J. Y. Lu et al., eds. China Agriculture Press, Beijing, 1995. (3) J. G. Wei et al. Mycosystema 24:481, 2005.

Inefficient formation of a complex among CXCR4, CD4 and gp120 in U937 clones resistant to X4 gp120-gp41-mediated fusion.

Certain subclones (designated as minus clones) of the promonocytic U937 cell line do not support efficient infection and fusion mediated by T cell line adapted (TCLA) X4 HIV-1 gp120-gp41 (Env) although the CXCR4 and CD4 concentrations at their surfaces are similar to those at the surfaces of clones susceptible to HIV-1 entry (plus clones) (H. Moriuchi et al., J. Virol. 71, 9664-9671, 1997). To test the hypothesis that inefficient formation of gp120-CD4-CXCR4 complexes could contribute to the mechanism of resistance to Env-mediated fusion in the minus clones, we incubated plus and minus cells with HIV-1 LAI gp120 and coimmunoprecipitated CD4 by using anti-CXCR4 antibodies. The gp120 induced inefficient coimmunoprecipitation of CD4 in the minus clones but not in the plus ones. Overexpression of CD4 resulted in significant restoration of the minus clones' susceptibility to fusion in parallel with an increase in the amount of the gp120-CD4-CXCR4 complexes. These results not only suggest that the resistance to TCLA X4 HIV-1 entry in the U937 minus clones is due to the inability of these cells to efficiently form complexes among CD4, gp120, and CXCR4, but also provide a direct evidence for the correlation between fusion and the cell surface concentration of the complexes among CXCR4, CD4, and gp120. These data and similar recent observations in macrophages suggest that inefficient complex formation among CXCR4, CD4, and gp120 could be a general mechanism of cell resistance to gp120-gp41-mediated fusion and a major determinant of HIV-1 evolution in vivo.

Constitutive cell surface association between CD4 and CCR5.

HIV-1 entry into cells involves formation of a complex between gp120 of the viral envelope glycoprotein (Env), a receptor (CD4), and a coreceptor. For most strains of HIV, this coreceptor is CCR5. Here, we provide evidence that CD4 is specifically associated with CCR5 in the absence of gp120 or any other receptor-specific ligand. The amount of CD4 coimmunoprecipitated with CCR5 was significantly higher than that with the other major HIV coreceptor, CXCR4, and in contrast to CXCR4 the CD4-CCR5 coimmunoprecipitation was not significantly increased by gp120. The CD4-CCR5 interaction probably takes place via the second extracellular loop of CCR5 and the first two domains of CD4. It can be inhibited by CCR5- and CD4-specific antibodies that interfere with HIV-1 infection, indicating a possible role in virus entry. These findings suggest a possible pathway of HIV-1 evolution and development of immunopathogenicity, a potential new target for antiretroviral drugs and a tool for development of vaccines based on Env-CD4-CCR5 complexes. The constitutive association of a seven-transmembrane-domain G protein-coupled receptor with another receptor also indicates new possibilities for cross-talk between cell surface receptors.

Telomere dynamics in monkeys: increased cell turnover in macaques infected with chimeric simian-human immunodeficiency viruses.

To address the question of how cell turnover is affected by retroviral infections, we used the telomeric terminal restriction fragments (TRFs) as markers of cell replicative history and measured their length in macaques infected with chimeric simian-human immunodeficiency viruses (SHIVs). The TRF lengths of mononuclear cells in 104 samples, including longitudinal samples from nine cynomolgus and ten pig-tailed macaques infected with SHIV, and in samples from 26 uninfected macaques, were quantitated by an improved method, based on two-dimensional calibration of DNA sizes, pulsed field electrophoresis, and high-resolution Southern blot images. The average TRF lengths of peripheral blood mononuclear cells (PBMCs) from uninfected pig-tailed (14.9+/-1.6 kbp) and cynomolgus (14.1+/-1.8 kbp) macaques were about 3 and 5 kbp longer than those of human infants and 30-year-old adults, respectively. The rate of TRF length shortening in infected pig-tailed macaques was significantly (P = 0.035) higher (2.2-fold) than in uninfected monkeys. The TRFs in SHIV-infected cynomolgus monkeys, which, in general, had lower viral loads than pig-tailed macaques, shortened on average more rapidly (1.6-fold) than in uninfected animals, but the difference was not statistically significant. The TRFs of mononuclear cells from the lymph nodes of two rapidly progressing SHIV-infected macaques that developed AIDS and died also shortened in parallel but somewhat more rapidly than in the PBMCs. These results suggest that the rate of PBMC turnover in macaques could be increased several-fold during infections by immunodeficiency viruses, likely due to immune activation by SHIV antigens.

Long-term telomere dynamics: modest increase of cell turnover in HIV-infected individuals followed for up to 14 years.

To quantify the long-term dynamics of telomere lengths and the effect of HIV infection on lymphocyte turnover rates, we measured in a blinded study longitudinal samples from 6 individuals using a highly accurate method based on two-dimensional calibration of DNA sizes. For two uninfected controls followed 8 and 10 years the average telomeric terminal restriction fragment (TRF) shortening rate in peripheral blood mononuclear cells (PBMCs) was 50 and 60 bp/year, respectively, in agreement with previous measurements of cross-sectional samples. The TRF lengths of PBMCs from two slow progressors followed for 14 years declined by a rate of 120 +/-10 bp/year, i.e. 2-fold higher than the rate of TRF shortening for uninfected individuals. The rate of TRF shortening was higher in CD8 (140 +/-10 bp/year) than in CD4 (100 +/-10 bp/year) cells. The CD8 cell TRFs of the two fast progressors shortened faster (240 +/-10 bp/year) and the rate of CD4 cell TRF shortening in one of the fast progressors was 160 bp/year. These data suggest that HIV infection causes only a modest increase in the lymphocyte turnover which we speculate could be due to chronic activation of the immune system, and may not result in the exhaustion of its regenerative capacity and immunopathogenesis.

Telomere dynamics in HIV-1 infected and uninfected chimpanzees measured by an improved method based on high-resolution two-dimensional calibration of DNA sizes.

We developed an improved method for accurately measuring telomere lengths based on two-dimensional calibration of DNA sizes combined with pulsed field electrophoresis and quantitative analysis of high-resolution gel images. This method was used to quantify the length of telomeres in longitudinal samples of peripheral blood mononuclear cells (PBMCs) from five chimpanzees infected with human immunodeficiency virus type 1 (HIV-1) and three uninfected animals, 14 to 27 years of age. The average length of the telomere restriction fragments (TRF) of infected and uninfected chimpanzees were 11.7 +/- 0.25 kbp, and 11.6 +/- 0.61 kbp, respectively, and were about 1 kbp and 3 kbp longer than those of human infants and 30 year old adults, respectively. There was a trend of a slight decrease (30-60 bp per year) in the TRF of two HIV infected chimpanzees over 30-35 months, while the TRF of one naive chimpanzee slightly increased over 20 months. Although the number of chimpanzees in this study is small and no statistically significant linear dependencies on time were observed, it appears that in chimpanzees, rates of shortening of the TRF are comparable or smaller than in adult humans and are not significantly affected by HIV-1 infection, which may be related to the inability of HIV-1 to cause disease in these animals.

[The sterilization effect of formaldehyde fumigating on the catheter place vertically].

UNLABELLED: The aim of this paper is to investigate the effect of formaldehyde fumigating on the sterilization of catheters with different diameters and placed in different positions. The lumen of cleaned catheters with different diameters was filled with a solution of live bacilli coil. The catheters were then dried by a drier and divided into 3 groups for formaldehyde fumigating sterilization. A segment of 5 cm of the middle section of the sterilized catheters was cut and incubated at 36 degrees C for 48 h with bouillon medium. For those segments with positive culture, bacteriologic identification was done. RESULTS: Group A, U = 6.85 and P < 0.01; Group B, chi 2 = 8 and P < 0.01; Group C, chi 2 = 13, P < 0.01. CONCLUSIONS: in the same conditions, fumigating in vertical direction is better than fumigation in horizontal direction and save time; in the same conditions, the positive culture rate is inversely related to the diameter of the catheters; for catheter with a diameter greater than 0.75 cm, fumigating vertically for 2 h is enough to obtain satisfactory sterilization effects.

Inhibitory effect of artemether on proteinase of Schistosoma japonicum.

AIM: To study the effect of artemether (Art) on the thio proteinase ("hemoglobinase", Hem) of Schistosoma japonicum. METHODS: Hem was extracted from S japonicum adults. The inhibitory effect of Art on the activity of Hem to degrade human hemoglobin (Hgb) was examined with UV-photometer at 280 nm, SDS-PAGE and scanning at 600 nm on a chromoscanner. RESULTS: Human Hgb was degraded at pH 4.0 by the Hem. The activities of Hem preincubated at 37 degrees C with Art 0.14, 1.4, and 14 mmol.L-1, were inhibited by 30.2%, 39.8%, and 45.0%, respectively. CONCLUSION: Art possesses an inhibitory effect to Hem of S japonicum.