LexA-binding sequences in Gram-positive and cyanobacteria are closely related.

The lexA gene of the cyanobacterium Anabaena sp. strain PCC7120 has been cloned by PCR amplification with primers designed after TBLASTN analysis of its genome sequence using the Escherichia coli LexA sequence as a probe. After over-expression in E. coli and subsequent purification, footprinting experiments demonstrated that the Anabaena LexA protein binds to the sequence TAGTACTAATGTTCTA, which is found upstream of its own coding gene. Directed mutagenesis and sequence comparison of promoters of other Anabaena genes, as well as those of several cyanobacteria, allowed us to define the motif RGTACNNNDGTWCB as the LexA box in this bacterial phylum. Substitution of a single nucleotide in this motif present in the Anabena lexA promoter is sufficient to enable it to bind the Bacillus subtilis LexA protein. These data indicate that Cyanobacteria and Gram-positive bacteria are phylogenetically closely related.

Escherichia coli DNA glycosylase Mug: a growth-regulated enzyme required for mutation avoidance in stationary-phase cells.

The Escherichia coli DNA glycosylase Mug excises 3,N(4)-ethenocytosines (epsilon C) and uracils from DNA, but its biological function is obscure. This is because epsilon C is not found in E. coli DNA, and uracil-DNA glycosylase (Ung), a distinct enzyme, is much more efficient at removing uracils from DNA than Mug. We find that Mug is overexpressed as cells enter stationary phase, and it is maintained at a fairly high level in resting cells. This is true of cells grown in rich or minimal media, and the principal regulation of mug is at the level of mRNA. Although the expression of mug is strongly dependent on the stationary-phase sigma factor, sigma(S), when cells are grown in minimal media, it shows only a modest dependence on sigma(S) when cells are grown in rich media. When mug cells are maintained in stationary phase for several days, they acquire many more mutations than their mug(+) counterparts. This is true in ung as well as ung(+) cells, and a majority of new mutations may not be C to T. Our results show that the biological role of Mug parallels its expression in cells. It is expressed poorly in exponentially growing cells and has no apparent role in mutation avoidance in these cells. In contrast, Mug is fairly abundant in stationary-phase cells and has an important anti-mutator role at this stage of cell growth. Thus, Mug joins a very small coterie of DNA repair enzymes whose principal function is to avoid mutations in stationary-phase cells.

Expression of the Pasteurella multocida ompH gene is negatively regulated by the Fur protein.

The fur gene of Pasteurella multocida has been cloned by complementation of an Escherichia coli fur mutant. The P. multocida fur gene, which encodes a predicted protein of 147 amino acids, displaying the highest identity (89%) with the same protein of Haemophilus influenzae, is negatively regulated by its own product. By construction of a P. multocida fur mutant, it has been demonstrated that the ompH gene, encoding a major structural protein of the outer membrane, presenting high antigenicity power, is negatively regulated by iron and glucose. Furthermore, wild-type and fur-defective cells of P. multocida show the same level of virulence.

Biochemical characterization of human DNA polymerase iota provides clues to its biological function.

The human RAD30B gene has recently been shown to encode a novel DNA polymerase, DNA polymerase iota (poliota). The role of poliota within the cell is presently unknown, and the only clues to its cellular function come from its biochemical characterization in vitro. The aim of this short review is, therefore, to summarize the known enzymic activities of poliota and to speculate as to how these biochemical properties might relate to its in vivo function.

Virulence of Pasteurella multocida recA mutants.

In order to determine the role of the RecA protein in the virulence of Pasteurella multocida, a recA mutant was constructed and used in studies of virulence and competition in relation to wild-type strain. To achieve this, firstly, the recA gene was isolated and sequenced, showing an Escherichia coli-like SOS box and encoding a protein of 354 amino acids which has the closest identity with the Haemophilus influenzae RecA protein. Further, the recA mutant was constructed, by inactivating this gene by single recombination of a suicide plasmid containing an internal region of the P. multocida recA gene, and shown to be more sensitive to UV radiation than the parental strain. The P. multocida mutant was slightly attenuated in virulence, as indicated by the LD(50), the time of death of infected animals, and a failure to compete with the wild-type strain in mixed infections. Compared to the parent strain, the mutant had a similar growth rate but a longer lag phase. These data suggest that the diminished virulence of the recA mutant as well as its failure in competition were more a consequence of the long lag phase rather than a direct effect of the inactivation of the recA gene on genes involved in virulence.

Identification of mucAB-like homologs on two IncT plasmids, R394 and Rts-1.

Recent phylogenetic analysis of the superfamily of lesion-replicating DNA polymerases suggest that they can be broadly divided into four sub-groups comprised of UmuC-like, DinB-like, Rev1-like and Rad30-like proteins. The UmuC-like sub-family is best characterized at the genetic level and sequence analysis of eleven umu orthologs, residing on bacterial chromosomes or on self-transmissible R-plasmids allows further subdivision into five sub-groups (UmuDC, MucAB, ImpAB, RumAB and RulAB) based on amino acid sequence conservation. Some of these orthologs are apparently inactive in situ, but may promote increased mutagenesis and survival when subcloned and expressed from high-copy number plasmids. We were, therefore, interested in devising an assay that would identify umuC-like genes in situ in the absence of a functional assay. To this end, degenerate primers directed towards conserved amino acid regions within the UmuC-like sub-family of DNA polymerases were designed and used to identify mucAB-like operons on the IncT plasmids, R394 and Rts-1.Interestingly, DNA sequence analysis of an approximately 7kb region of R394 identified two LexA-regulated genes immediately downstream of mucAB((R394)) that are similar to the chromosomally-encoded Escherichia coli tus gene and the IncI plasmid-encoded impC gene, respectively. Analysis of the R394 and Rts-1 mucB genes revealed that both contain insertions which result in the expression of a truncated inactive MucB protein. While R394 was unable to restore mutagenesis functions to a DeltaumuDC E. coli strain, Rts-1 surprisingly promoted significant levels of MMS-induced SOS mutagenesis, raising the possibility that Rts-1 encodes another, yet unidentified, umu-like homolog.

Identification of additional genes belonging to the LexA regulon in Escherichia coli.

Exposure of Escherichia coli to a variety of DNA-damaging agents results in the induction of the global 'SOS response'. Expression of many of the genes in the SOS regulon are controlled by the LexA protein. LexA acts as a transcriptional repressor of these unlinked genes by binding to specific sequences (LexA boxes) located within the promoter region of each LexA-regulated gene. Alignment of 20 LexA binding sites found in the E. coli chromosome reveals a consensus of 5'-TACTG(TA)5CAGTA-3'. DNA sequences that exhibit a close match to the consensus are said to have a low heterology index and bind LexA tightly, whereas those that are more diverged have a high heterology index and are not expected to bind LexA. By using this heterology index, together with other search criteria, such as the location of the putative LexA box relative to a gene or to promoter elements, we have performed computational searches of the entire E. coli genome to identify novel LexA-regulated genes. These searches identified a total of 69 potential LexA-regulated genes/operons with a heterology index of <15 and included all previously characterized LexA-regulated genes. Probes were made to the remaining genes, and these were screened by Northern analysis for damage-inducible gene expression in a wild-type lexA+ cell, constitutive expression in a lexA(Def) cell and basal expression in a non-inducible lexA(Ind-) cell. These experiments have allowed us to identify seven new LexA-regulated genes, thus bringing the present number of genes in the E. coli LexA regulon to 31. The potential function of each newly identified LexA-regulated gene is discussed.

A consensus sequence for the Rhodospirillaceae SOS operators.

The sequences controlling the expression of the Rhodobacter capsulatus recA and uvrA genes belonging to the SOS DNA repair system have been identified by PCR mutagenesis. Data obtained demonstrated that the GTTCN7GTAC and GAACN7GAAC motifs present upstream of the recA gene and the GTTCN7GTTC motif found upstream of the uvrA gene are required for their respective DNA damage-mediated induction. Alignment of recA promoters of R. capsulatus, Rhodobacter sphaeroides and Rhodopseudomonas viridis with the uvrA promoters of R. capsulatus and R. sphaeroides has identified the consensus sequence GTTCVYVYTWTGTTC as the SOS operator site of the Rhodospirillaceae family.

Identification of the Rhodobacter sphaeroides SOS box.

Gel-mobility shift assays with crude cell extracts of Rhodobacter sphaeroides, which belongs to the alpha group of the proteobacteria, have shown that a protein binds to the promoter of its recA gene, resulting in two retardation bands. Analysis of the minimal region of the R. sphaeroides recA gene required for the formation of the DNA-protein complexes, revealed the presence of the motifs GTTCN7GATC and GAACN7GAAC, which are centred at positions -21 and +8 from the transcriptional starting point respectively. Using PCR mutagenesis, we have demonstrated that these two motifs are required for the formation of both DNA-protein complexes in vitro as well as for the DNA damage-mediated inducibility of the recA gene in vivo. Furthermore, the level of the recA gene expression in the constitutive mutants is the same as that achieved by the wild-type cells after DNA damage, indicating that the binding protein must be a repressor. The motif GTTCN7GTTC is also present upstream of the R. sphaeroides uvrA promoter, which in vitro specifically binds to a protein and whose expression is DNA damage inducible. Mutagenesis of this motif abolishes both the binding of this protein to the uvrA promoter and the DNA damage-mediated expression of this gene. The fact that the recA and uvrA wild-type promoters compete with each other for the retardation band formation, but not with their mutant derivatives in any of these motifs, indicates that the same repressor binds to the operator of both genes. All these results lead us to propose the sequence GTTCN7GTTC as the SOS box of R. sphaeroides. This is the first SOS box known whose sequence is a direct repeat and not a palindrome.

Importance of the galE gene on the virulence of Pasteurella multocida.

The galE gene of Pasteurella multocida has been isolated by complementing galE-defective mutants of Salmonella typhimurium with a plasmid library of this organism. The complete nucleotide sequence of the P. multocida galE gene consists of 1017 nucleotides, encoding a predicted polypeptide of 339 amino acids. The deduced amino acid sequence displayed the highest identity (85%) to the GalE protein of Haemophilus influenzae. However, the gene organization surrounding the galE locus was different from that of H. influenzae. A galE-defective mutant of P. multocida was obtained by replacement of the active galE gene by a copy inactivated in vitro. The resulting galE mutant was highly attenuated as seen in a biological test carried out in a mouse model.

Functional analysis of the recA promoter of Rhodobacter capsulatus.

Expression of the Rhodobacter capsulatus recA gene is inducible by DNA damage. By using primer extension and serial deletion, we have identified the promoter of the R. capsulatus recA gene. Electrophoretic mobility-shift assays experiments have shown that a protein binds to a region of the R. capsulatus recA promoter containing the imperfect palindromic TTGTACTCATACCATGAGAACAA, which is centered on position-8 with respect to the transcriptional starting site. PCR mutagenesis of both halves of this palindrome indicates that the TTGT and ACAA motifs are necessary both for normal DNA-protein complex formation in vitro and for full DNA damage-mediated induction of recA. Nevertheless, the basal level of recA expression is not increased when both halves of the TTGTN15ACAA sequence are mutagenized. These data suggest that the R. capsulatus recA gene may be regulated by a positive transcription factor which binds to this palindrome.

Characterization of the promoter of the Rhizobium etli recA gene.

The promoter of the Rhizobium etli recA gene has been identified by primer extension and by making deletions affecting several regions located upstream of its coding region. A gel mobility shift assay carried out with crude extracts of cells of R. etli has been used to show that a DNA-protein complex is formed in the R. etli recA promoter region in vitro. Analysis of the minimal region of the recA promoter giving rise to this DNA-protein complex revealed the presence of an imperfect palindrome corresponding to the sequence TTGN11CAA. Site-directed mutation of both halves of this palindrome indicated that both motifs, TTG and CAA, are necessary for both normal DNA-protein complex formation in vitro and full DNA damage-mediated inducibility of the recA gene in vivo. However, the TTG motif seems to be more dispensable than the CAA one. The presence of this same palindrome upstream of the recA genes of Rhizobium meliloti and Agrobacterium tumefaciens, whose expression is also regulated in R. etli cells, suggests that this TTGN11CAA sequence may be the SOS box of at least these three members of the Rhizobiaceae.

Cloning and characterization of the recA of Paracoccus denitrificans and construction of a recA-deficient mutant.

The recA gene of Paracoccus denitrificans has been isolated from a genomic library by hybridization with the Rhodobacter sphaeroides recA gene. Its complete nucleotide sequence consists of 1071 bp encoding a polypeptide of 356 amino acids. Nucleotide sequence analysis of the P. denitrificans recA gene revealed the closest identities with the R. sphaeroides and the Rhodobacter capsulatus recA genes. Nevertheless, and surprisingly, recA genes of these two phototrophic bacteria are not DNA damage-inducible when introduced into P. denitrificans cells, whereas recA genes of both P. denitrificans and Rhizobium etli are. These results suggest that the promoters of P. denitrificans and R. etli recA genes have a similar regulatory sequence. A recA-defective mutant of P. denitrificans has also been constructed by replacement of the active recA gene by an in vitro inactivated gene copy.

Non-reciprocal regulation of Rhodobacter capsulatus and Rhodobacter sphaeroides recA genes expression.

The Rhodobacter capsulatus recA gene has been isolated and sequenced. Its deduced amino acid sequence showed the closest identity with the Rhodobacter sphaeroides RecA protein (91% identity). However, the promoter regions of both R. capsulatus and R. sphaeroides recA genes are only 64% similar. An Escherichia coli-like LexA binding site was not present in the upstream region of the R. capsulatus recA gene. Nevertheless, the R. capsulatus recA gene is inducible by DNA damage in both hetero- and phototrophically growing conditions. The R. capsulatus recA gene is poorly induced when inserted into the chromosome of R. sphaeroides, indicating that the recA gene of both bacteria possess different control sequences despite their phylogenetically close relationship.

Interspecies regulation of the recA gene of gram-negative bacteria lacking an E. coli-like SOS operator.

The recA genes of Agrobacterium tumefaciens, Rhizobium meliloti, Rhizobium phaseoli and Rhodobacter sphaeroides, species belonging to the alpha-group bacteria of the Proteobacteria class, have been fused in vitro to the lacZ gene of Escherichia coli. By using a mini-Tn5 transposon derivative, each of these recA-lacZ fusions was introduced into the chromosome of each of the four species, and into that of E. coli. The recA genes of three of the alpha bacteria are induced by DNA damage when inserted in A. tumefaciens, R. phaseoli or R. meliloti chromosomes. The expression of the recA gene of R. sphaeroides is DNA damage-mediated only when present in its own chromosome; none of the genes is induced in E. coli. Likewise, the recA gene of E. coli is not induced in any of the four alpha species. These data indicate that A. tumefaciens, R. meliloti and R. phaseoli possess a LexA-like repressor, which is able to block the expression of their recA genes, as well as that of R. sphaeroides, but not the recA gene of E. coli. The LexA repressor of R. sphaeroides does not repress the recA gene of A. tumefaciens, R. meliloti, R. phaseoli or E. coli.

Autoregulation and kinetics of induction of the Rhizobium phaseoli recA gene.

A fusion between the recA gene of Rhizobium phaseoli and the lacZ gene was constructed in vitro and cloned in a mini-Tn5 transposon derivative to obtain chromosomal insertions which make it possible to quantitatively examine their transcriptional regulation in both R. phaseoli and E. coli. Likewise, and by insertion of a spectinomycin-resistance gene cassette into the recA gene of R. phaseoli and subsequent marker exchange, a RecA- derivative of this bacterial species has been obtained. Analysis of this recA-lacZ fusion showed that it was inducible by DNA damage in the RecA+ strain of R. phaseoli but not in the RecA- mutant. On the other hand, the recA-lacZ fusion of R. phaseoli was not induced in DNA-damaged RecA+ cells of E. coli. Furthermore, the range of UV doses which give rise to dose dependence in the induction of its respective recA genes is different in R. phaseoli from that in E. coli.

Molecular cloning, sequence and regulation of expression of the recA gene of the phototrophic bacterium Rhodobacter sphaeroides.

The recA gene of Rhodobacter sphaeroides 2.4.1 has been isolated by complementation of a UV-sensitive RecA- mutant of Pseudomonas aeruginosa. Its complete nucleotide sequence consists of 1032 bp, encoding a polypeptide of 343 amino acids. The deduced amino acid sequence displayed highest identity to the RecA proteins from Rhizobium meliloti, Rhizobium phaseoli, and Agrobacterium tumefaciens. An Escherichia coli-like SOS consensus region, which functions as a binding site for the LexA repressor molecule was not present in the 215 bp upstream region of the R. sphaeroides recA gene. Nevertheless, by using a recA-lacZ fusion, we have shown that expression of the recA gene of R. sphaeroides is inducible by DNA damage. A recA-defective strain of R. sphaeroides was obtained by replacement of the active recA gene by a gene copy inactivated in vitro. The resulting recA mutant exhibited increased sensitivity to UV irradiation, and was impaired in its ability to perform homologous recombination as well as to trigger DNA damage-mediated expression. This is the first recA gene from a Gram-negative bacterium that lacks an E. coli-like SOS box but whose expression has been shown to be DNA damage-inducible and auto-regulated.

Induction of the alkA gene of Escherichia coli in gram-negative bacteria.

A broad-host-range plasmid containing a fusion of the alkA and lacZ genes of Escherichia coli was introduced into various aerobic and facultative gram-negative bacteria--33 species belonging to 19 genera--to study the induction of expression of the alkA gene by alkylating agents. The bacteria included species of the families Enterobacteriaceae, Pseudomonadaceae, Rhizobiaceae, Vibrionaceae, Neisseriaceae, Rhodospirillaceae, and Azotobacteraceae. Results obtained show that all bacteria tested, except Aeromonas hydrophila, Agrobacterium tumefaciens, Hafnia alvei, Rhizobium meliloti, Salmonella enteritidis, Xanthomonas campestris, and those of the genus Rhodobacter, are able to induce the alkA gene of E. coli in the presence of N-methyl-N'-nitro-N-nitrosoguanidine. All these data indicate that the adaptive response to alkylating agents is present in bacterial species of several families and that the Ada box sequence must be widely conserved.

Expression of the recA gene of Escherichia coli in several species of gram-negative bacteria.

A broad host range plasmid containing an operon fusion between the recA and lacZ genes of Escherichia coli was introduced into various aerobic and facultative gram-negative bacteria-30 species belonging to 20 different genera - to study the expression of the recA gene after DNA damage. These included species of the families Enterobacteriaceae, Pseudomonadaceae. Rhizobiaceae, Vibrionaceae, Neisseriaceae, Rhodospirillaceae and Azotobacteraceae. Results obtained show that all bacteria tested, except Xanthomonas campestris and those of the genus Rhodobacter, are able to repress and induce the recA gene of E. coli in the absence and in the presence of DNA damage, respectively. All these data indicate that the SOS system is present in bacterial species of several families and that the LexA-binding site must be very conserved in them.

Chromogenic method for rapid isolation of recA-like mutants of gram-negative bacteria.

We have devised a rapid and widely applicable color test for detecting recA-like mutants of gram-negative bacteria. The technique depends on decreased expression of an Escherichia coli recA-lacZ fusion in recA mutants and uses a broad-host-range plasmid to transfer the fusion gene into new species. We describe the isolation of a recA-like mutant of Pseudomonas syringae by this technique.