RESUMO
The early inflammatory response to Matrix-M was evaluated in pigs. Adverse reactions measured as body temperature, appetite, activity level and reaction at the site of injection were not observed after s.c. injection with three doses of the adjuvant (75, 100 or 150µg) into one week old piglets. Analyses of the immediate cytokine response of PBMC after in vitro exposure to Matrix-M (AbISCO-100(®)) revealed only a low expression of mRNA for tumour necrosis factor-α (p<0.05) after 6h incubation. Histological examination revealed an infiltration of leukocytes, haemorrhage and necrosis in muscle 24h after i.m. injection of 150µg Matrix-M in pigs aged eleven weeks. At this time, different grades of reactive lymphoid hyperplasia were recorded in the draining lymph node that was enlarged in three of these six pigs injected with Matrix-M. The global transcriptional response at the site of injection and in the draining lymph node was analyzed using Affymetrix GeneChip Porcine Genome Array. A significant enrichment of gene signatures for the cell types described as "myeloid cells" and "plasmacytoid dendritic cells" was observed at the site of injection in Matrix-M injected pigs compared with pigs injected with saline. A number of genes encoding cytokines/chemokines or their receptors were upregulated at the injection site as well as in the draining lymph node. In the draining lymph node, a majority of the upregulated genes were interferon-regulated genes (IRGs). The expression of IFN-ß, but not IFN-α, was increased in the draining lymph nodes of a majority of the pigs exposed to Matrix-M. These IFN-ß expressing pigs also expressed increased levels of osteopontin (OPN) or stimulator of interferon genes (STING), two factors known to facilitate the expression of type I IFNs in response to viral infection. Thus, Matrix-M does not appear to induce any harmful inflammatory response in piglets whilst contributing to the innate immunity by activating the type I IFN system, possibly through several alternative signalling pathways.
Assuntos
Adjuvantes Imunológicos/farmacologia , Colesterol/farmacologia , Citocinas/imunologia , Regulação da Expressão Gênica/imunologia , Inflamação/veterinária , Fosfolipídeos/farmacologia , Saponinas/farmacologia , Doenças dos Suínos/imunologia , Adjuvantes Imunológicos/administração & dosagem , Animais , Animais Recém-Nascidos , Colesterol/administração & dosagem , Citocinas/genética , Combinação de Medicamentos , Imunidade Inata/imunologia , Inflamação/imunologia , Leucócitos Mononucleares , Linfonodos/imunologia , Análise de Sequência com Séries de Oligonucleotídeos/veterinária , Fosfolipídeos/administração & dosagem , RNA Mensageiro/química , RNA Mensageiro/genética , Reação em Cadeia da Polimerase Via Transcriptase Reversa/veterinária , Saponinas/administração & dosagem , Organismos Livres de Patógenos Específicos , Estatísticas não Paramétricas , SuínosRESUMO
A porcine circovirus type 2 SPOT (PCV2-SPOT) assay was established to enumerate virus-secreting lymphocytes obtained from naturally infected pigs. The assay is based on the same principle as general ELISPOT assays but instead of detecting cytokine or immunoglobulin secretion, PCV2 particles are immobilized and detected as filter spots. The method was used to evaluate the influence of various cell activators on the PCV2 secretion in vitro and was also applied to study the PCV2 secretion by lymphocytes obtained from pigs in healthy herds and in a herd afflicted by postweaning multisystemic wasting disease (PMWS). Peripheral blood mononuclear cells (PBMCs) obtained from a pig with severe PMWS produced PCV2-SPOTs spontaneously whereas PBMCs obtained from pigs infected subclinically only generated PCV2-SPOTs upon in vitro stimulation. The PCV2 secretion potential was related to the PCV2 DNA content in the PBMCs as determined by two PCV2 real-time PCR assays, developed to differentiate between Swedish PCV2 genogroups 1 (PCV2a) and 3 (PCV2b). Besides the current application these qPCRs could simplify future epidemiological studies and allow genogroup detection/quantitation in dual infection experiments and similar studies. The developed PCV2-SPOT assay offers a semi-quantitative approach to evaluate the potential of PCV2-infected porcine cells to release PCV2 viral particles as well as a system to evaluate the ability of different cell types or compounds to affect PCV2 replication and secretion.
Assuntos
Infecções por Circoviridae/veterinária , Circovirus/isolamento & purificação , Medicina Veterinária/métodos , Virologia/métodos , Animais , Infecções por Circoviridae/diagnóstico , Infecções por Circoviridae/virologia , Leucócitos Mononucleares/virologia , SuínosRESUMO
There is accumulating evidence for the involvement of pro-inflammatory cytokines associated with a T helper 17 response in intestinal disorders such as inflammatory bowel disease (IBD) in humans. The involvement of interleukin (IL)-17 or IL-23 in equine IBD has not been studied and most gene expression studies in the equine intestine have been limited to the use of a single non-validated reference gene. In this study, expression of the reference gene candidates ß2 microglobulin (ß2M), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), histone H2A type 1, hypoxanthine-guanine phosphoribosyltransferase (HPRT), 60S ribosomal protein L32 (RPL32), succinate dehydrogenase complex subunit A (SDHA) and transferrin receptor 1 protein coding (TFRC)in the equine intestine was evaluated by quantitative PCR. Three to four reference genes were adequate for normalisation of gene expression in the healthy duodenum, mid-jejunum, colon and rectum, although each segment required a unique combination of reference genes. No combination of the evaluated genes was optimal for the caecum and ileum. Another combination of reference genes (GAPDH, HPRT, RPL32 and SDHA) was optimal for normalisation of rectal samples from healthy and IBD-affected horses, indicating that reference genes should be re-evaluated if material from diseased specimens is analysed. Basal expression of IL-12p40, IL-17A and IL-23p19 was detected in each segment, which will enable gene expression studies of these cytokines by relative quantification.
Assuntos
Citocinas/metabolismo , Regulação da Expressão Gênica/fisiologia , Doenças dos Cavalos/metabolismo , Mucosa Intestinal/metabolismo , Síndrome do Intestino Irritável/veterinária , Linfócitos T Auxiliares-Indutores/metabolismo , Animais , Citocinas/genética , Feminino , Cavalos , Síndrome do Intestino Irritável/metabolismo , Leucócitos Mononucleares/metabolismo , Masculino , Reação em Cadeia da Polimerase/veterinária , RNA/genética , RNA/metabolismoRESUMO
BACKGROUND: In this study we utilized padlock probes and rolling circle amplification as a mean to detect and study the replication of porcine circovirus type 2 (PCV2) in cultured cells and in infected tissue. Porcine circovirus type 2 is a single-stranded circular DNA virus associated with several severe diseases, porcine circovirus diseases (PCVD) in pigs, such as postweaning multisystemic wasting syndrome. The exact reason and mechanisms behind the trigger of PCV2 replication that is associated with these diseases is not well-known. The virus replicates with rolling circle replication and thus also exists as a double-stranded replicative form. RESULTS: By applying padlock probes and rolling circle amplification we could not only visualise the viral genome but also discriminate between the genomic and the replicative strand in situ. The genomic strand existed in higher numbers than the replicative strand. The virus accumulated in certain nuclei but also spread into the cytoplasm of cells in the surrounding tissue. In cultured cells the average number of signals increased with time after infection. CONCLUSIONS: We have developed a method for detection of both strands of PCV2 in situ that can be useful for studies of replication and in situ detection of PCV2 as well as of DNA viruses in general.
Assuntos
Circovirus/isolamento & purificação , Circovirus/fisiologia , DNA Viral/genética , Técnicas de Amplificação de Ácido Nucleico/métodos , Sondas de Oligonucleotídeos/genética , Virologia/métodos , Replicação Viral , Animais , Linhagem Celular , Núcleo Celular/virologia , Infecções por Circoviridae/veterinária , Infecções por Circoviridae/virologia , Circovirus/genética , Citoplasma/virologia , Linfonodos/virologia , Suínos , Doenças dos Suínos/virologiaRESUMO
In a previous study, using random amplification and large-scale sequencing technology, we identified a novel porcine parvovirus belonging to the genus Bocavirus in the background of porcine circovirus type 2 (PCV-2) in Swedish pigs with postweaning multisystemic wasting syndrome (PMWS). In addition to bocavirus we demonstrated the presence of torque teno virus (TTV) genogroups 1 and 2 in these cases of PMWS, indicating the simultaneous presence of several viruses in this disease complex. In the present study, 34 PMWS-affected animals and 24 pigs without PMWS were screened by PCR for the presence of PCV-2, TTV-1, TTV-2 and porcine boca-like virus (Pbo-likeV). The studies revealed the following infection rates in the PMWS-affected pigs: PCV-2 100%, TTV-1 77%, TTV-2 94% and Pbo-likeV 88%. In comparison, the pigs without PMWS had the following rates: PCV-2 80%, TTV-1 79%, TTV-2 83% and Pbo-likeV 46%. The sequence identity between the different Swedish Pbo-likeV sequences ranged between 98% and 100%. By checking co-infection, it was found that 71% of the PMWS-affected pigs harbor simultaneously all these viruses. As a contrast, in the group without PMWS only 33% of the animals were positive simultaneously for these viruses. These observations indicate a multiple viral infection in PMWS-affected pigs. It has to be studied further if the clinical manifestation of PMWS might be due to synergistic effects of different viruses acting together.
Assuntos
Infecções por Circoviridae/veterinária , Circovirus/fisiologia , Infecções por Vírus de DNA/veterinária , Síndrome Definhante Multissistêmico de Suínos Desmamados/virologia , Doenças dos Suínos/virologia , Torque teno virus/fisiologia , Sequência de Aminoácidos , Animais , Infecções por Circoviridae/virologia , Circovirus/classificação , Circovirus/genética , Circovirus/isolamento & purificação , Infecções por Vírus de DNA/virologia , Dados de Sequência Molecular , Filogenia , Alinhamento de Sequência , Suécia , Suínos , Torque teno virus/classificação , Torque teno virus/genética , Torque teno virus/isolamento & purificação , Proteínas Virais/química , Proteínas Virais/genéticaRESUMO
The porcine circovirus type 2 (PCV2) genome encodes three major open reading frames (ORFs) encoding the replicase proteins (ORF1), the viral capsid protein (ORF2), and a protein with suggested apoptotic activity (ORF3). Previous phylogenetic analyses of complete genome sequences of PCV2 from GenBank have demonstrated 95-100% intra-group nucleotide sequence identity. However, although these isolates were readily grouped into clusters and clades, there was no correlation between the occurrence of specific PCV2 genotypes and the geographic origin or health status of the pig. In the present study, a unique dataset from a field study spanning the years pre and post the recognition of postweaning multisystemic wasting syndrome (PMWS) in Sweden was utilized. Using this dataset it was possible to discriminate three Swedish genogroups (SG1-3) of PCV2, of which SG1 was recovered from a pig on a healthy farm ten years before the first diagnosis of PMWS in Sweden. The SG1 PCV2/ORF2 gene sequence has been demonstrated to exhibit a high genetic stability over time and has subsequently only been demonstrated in samples from pigs on nondiseased farms. In contrast, SG2 was almost exclusively found on farms that had only recently broken down with PMWS whereas the SG3 genogroup predominated in pigs from PMWS-affected farms. These results further support the results obtained from earlier in vitro and in vivo experimental models and suggest the association of specific PCV2 genogroups with diseased and nondiseased pigs in the field.
Assuntos
Infecções por Circoviridae/veterinária , Parvovirus Suíno/classificação , Parvovirus Suíno/genética , Filogenia , Síndrome Definhante Multissistêmico de Suínos Desmamados/virologia , Sequência de Aminoácidos , Animais , Infecções por Circoviridae/patologia , Infecções por Circoviridae/virologia , Europa (Continente) , Feminino , Genótipo , Masculino , Dados de Sequência Molecular , Fases de Leitura Aberta , Parvovirus Suíno/isolamento & purificação , Síndrome Definhante Multissistêmico de Suínos Desmamados/patologia , Alinhamento de Sequência , Análise de Sequência , Suínos , Proteínas Virais/química , Proteínas Virais/genéticaRESUMO
DNA sequences containing CpG motifs are recognized as immunomodulators in several species. Phosphodiester oligodeoxyribonucleotides (ODNs) representing sequences from the genome of porcine circovirus type 2 (PCV2) have been identified as potent inducers (ODN PCV2/5) or inhibitors (ODN PCV2/1) of alpha interferon (IFN-alpha) production by porcine peripheral blood mononuclear cells (poPBMCs) in vitro. In this study, the IFN-alpha-inducing or -inhibitory activities of specific phosphodiester ODNs were demonstrated to be dependent on their ability to form secondary structures. When a poly(G) sequence was added to a stimulatory self-complementary ODN, high levels of IFN-alpha were elicited, and the induction was not dependent on pretreatment with the transfecting agent Lipofectin. In addition, the IFN-alpha-inducing ODN required the presence of an intact CpG dinucleotide, whereas the inhibitory activity of ODN PCV2/1 was not affected by methylation or removal of the central CpG dinucleotide. Of particular significance, the IFN-alpha inhibition elicited by ODN PCV2/1 was only effective against induction stimulated by DNA control inducers and not RNA control inducers, indicating activity directed to TLR9 signaling. The PCV2 genome as a whole was demonstrated to induce IFN-alpha in cultures of poPBMCs, and the presence of immune modulatory sequences within the genome of PCV2 may, therefore, have implications with regard to the immune evasion mechanisms utilized by PCV2.
Assuntos
Circovirus/imunologia , DNA Viral/imunologia , Interferon-alfa/antagonistas & inibidores , Interferon-alfa/biossíntese , Leucócitos Mononucleares/imunologia , Oligodesoxirribonucleotídeos/imunologia , Animais , Sequência de Bases , Circovirus/genética , DNA Viral/genética , Fosfatos de Dinucleosídeos/química , Conformação de Ácido Nucleico , Oligodesoxirribonucleotídeos/química , Oligodesoxirribonucleotídeos/genética , Suínos , Receptor Toll-Like 9/fisiologiaRESUMO
The immunostimulatory effects of oligodeoxyribonucleotides (ODN) containing unmethylated CpG dinucleotides (CpG-ODN) in certain base contexts have been extensively studied in man and mice. One major action is their ability to trigger production of massive amounts of interferon-alpha (IFN-alpha) by plasmacytoid dendritic cells (PDC), also referred to as natural IFN-alpha/beta producing cells (NIPC). The present study using porcine PBMC activated by CpG-ODN or plasmid DNA revealed a considerable variation in the IFN-alpha production in response to various CpG-ODN constructs. Several phosphodiester ODNs, such as 5' TTTTCAATTCGAAGATGAAT 3' (ODN H), and the plasmid pcDNA3 all required pre-incubation with lipofectin in order to induce IFN-alpha. Intact unmethylated CpGs were also important, because methylation or substitution of the cytosines and CpG-inversion strongly reduced the IFN-alpha induction by single- or double-stranded forms of ODN H. Certain CpG-ODNs that contained flanking phosphorothioate or phosphodiester poly-G sequences were potent inducers of IFN-alpha without pre-incubation with lipofectin, for instance the ODN 2216 (5' GGGGGACGATCGTCGGGGGG 3'). While poly-G sequences have been suggested to increase uptake of ODNs by cells, they did not obviate the need for lipofectin when added to the ODN H. However, they resulted in up to five-fold increases of the IFN-alpha levels caused by ODN H upon lipofection, indicating other enhancing effects of poly-G sequences on the induction of IFN-alpha. The identity of the IFN-alpha producing cells (IPC) stimulated by CpG-ODN or plasmid DNA was studied by means of flow cytometry using combined staining for intracellular IFN-alpha and surface markers. Approximately 1-3 IPC/10(3) PBMC were detected, compared to only 3 IPC/10(4) PBMC stimulated by Aujeszky's disease virus. The IPC frequencies were confirmed by detection of IFN-alpha mRNA positive cells by in situ hybridisation. The IPC induced by CpG-ODN or plasmid DNA had a similar phenotype, expressing CD2 and CD4 and intermediate levels of MHC class II and the myeloid marker SWC3, but not the markers of T and B cells or monocytes (CD3, CD21 and CD14). Consequently, porcine IPC that respond to CpG-DNA seem to correspond to the PDC/NIPC.
Assuntos
Interferon-alfa/biossíntese , Leucócitos Mononucleares/metabolismo , Oligodesoxirribonucleotídeos/farmacologia , Suínos/imunologia , Adjuvantes Imunológicos/farmacologia , Animais , Ilhas de CpG/genética , Ilhas de CpG/imunologia , Metilação de DNA , Citometria de Fluxo , Fluorimunoensaio/veterinária , Imunofenotipagem , Hibridização In Situ/veterinária , Interferon-alfa/genética , Interferon-alfa/imunologia , Leucócitos Mononucleares/efeitos dos fármacos , Leucócitos Mononucleares/imunologia , Ativação Linfocitária , Oligodesoxirribonucleotídeos/imunologia , Fosfatidiletanolaminas/imunologia , Fosfatidiletanolaminas/farmacologia , RNA Mensageiro/química , RNA Mensageiro/genética , Suínos/sangueRESUMO
The production of interferon (IFN), interleukin-6 (IL-6), and tumor necrosis factor (TNF) was monitored in horses during the course of influenza A2 virus infections. The effects of two virus strains, Newmarket/2/93 and Sussex/89, were compared, of which the latter is considered the more pathogenic in terms of clinical signs. Ten naive ponies were infected with influenza A/equine/Sussex/89 and 10 with influenza A/equine/Newmarket/2/93, respectively. As expected ponies infected with Sussex/89 showed the most pronounced clinical signs but there was no notable difference in viral excretion compared with Newmarket/2/93. IFN was detected in nasal secretions of all ponies infected with Sussex/89 but only in 2 ponies infected with Newmarktet/2/93. IFN was not detected in serum of any animal. IL-6 activity was detected in nasal secretions of all experimental animals from day 2 and onwards, but showed markedly higher IL-6 responses were observed in ponies infected with Sussex/89. No TNF activity was detected in any of the samples collected. In summary, equine influenza A 2 infections elicited local, and in some cases systemic, IFN and IL-6 responses in the ponies. Interestingly, there was some evidence that the duration and levels of cytokine responses may be related to the pathogenicity of the influenza strains.