RESUMO
Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.
RESUMO
The roles of guttation fluid, irrigation water, contact between plants and transplantation into contaminated soil in the transmission of Rice yellow mottle virus (RYMV) were assessed. RYMV presence and infectivity were tested by Enzyme-Linked Immunosorbent Assay (ELISA) and by inoculation to susceptible rice cultivar BG90-2. The virus was readily detected in guttation fluid collected from infected rice plants. Transmission tests from this fluid led to high disease incidence (86.6%). Irrigation water collected at the base of infected plants growing in pots was less infectious, as inoculations led to disease incidences below 40%. No virus was detected and could be transmitted from field-irrigation water. Up to 44% healthy rice plants whose leaves were in contact with those of infected plants became infected but, no transmission occurred through intertwined roots. Transplantation of rice seedling into virus-contaminated soil also led to plant infection. However, virus survival in the soil decrease rapidly and infectivity was completely lost 14 days after soil contamination. Altogether, these results indicated that high planting densities of rice are likely to favour secondary spread of rice yellow mottle disease. Transplantation of rice seedlings not earlier than 2 weeks after soil preparation should prevent soil transmission of the virus. Although guttation fluid is highly infectious its contribution to virus infectivity in irrigation water is negligible as field-irrigation water was not found to be an infectious source for RYMV.
