Discrimination between mild and severe Citrus tristeza virus isolates with a rapid and highly specific real-time reverse transcription-polymerase chain reaction method using TaqMan LNA probes.

Severe isolates of Citrus tristeza virus (CTV) inducing seedling yellows (SY) and/or stem pitting (SP) in grapefruit or sweet orange are a major threat for the citrus industry worldwide. Identification of these CTV variants was achieved by quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) using a general primer set and three TaqMan locked nucleic acids (LNA) probes targeting sequences characteristic of severe, mild (non-SY, non-SP), and T36-like isolates. Successful amplification was achieved from fresh or silica-desiccated CTV-infected samples and all isolates but one reacted with one or more probes. Standard curves using RNA transcripts homologous to the three probes allowed a reproducible quantitative assay, with a wide dynamic range of detection starting with 10(2) copies. RT-PCR assays with homologous and heterologous transcript RNA mixes demonstrated that each probe reacted only with its cognate sequence which was detected even at ratios below 2.5%. Analysis of 56 pathogenically distinct CTV isolates from 20 countries showed that mild isolates reacted only with the mild probe, whereas severe SP and SY isolates reacted with the severe-SP or the T36-like probes, respectively, and often with a second probe. This procedure can be useful to identify and control potentially dangerous CTV isolates in areas affected only by mild isolates.

New molecular methods for identification of broad bean wilt virus 1.

Broad bean wilt virus 1 (BBWV-1) causes damages in economically important plant crops such as pepper, bean, spinach, etc. Fast, cheap and reliable diagnostic tools are crucial to limit or control the disease. In this work, tissue blot immunoassay (TBIA), dot-blot (DB) and tissue-print (TP)-hybridization were developed for BBWV-1 diagnosis and evaluated for sensitivity, specificity and reliability in plants of several host species grown in the greenhouse or in the field, in comparison with ELISA and RT-PCR. RT-PCR followed by DB-hybridization provided the most sensitive and efficient diagnostic, but the virus was also detected in most samples by ELISA. Detection by TBIA or by TP-hybridization avoided sample processing, but they were less consistent and greatly depended on host species and tissue. DB-hybridization with probes corresponding to different genomic regions allowed universal detection of BBWV-1 and discrimination between genetically distant isolates.

Detection and identification of species of the genus Fabavirus by RT-PCR with a single pair of primers.

The genus Fabavirus includes three species: Broad bean wilt virus 1 (BBWV-1), BBWV-2 and Lamium mild mosaic virus (LMMV), but a new candidate species, Gentian mosaic virus (GeMV), has been proposed. Analysis of the complete nucleotide sequences of fabaviruses was used to design a pair of conserved primers for specific detection of members of this genus. These primers encompassed the 5'-terminal non-translatable region (NTR) , whose size for BBWV-1, BBWV-2 and GeMV was different. RT-PCR, with this pair of primers, is a rapid and sensitive procedure for diagnosis of fabavirus infections, that also allows identification of distinct species involved in single or mixed infections, based on the size of the amplification products. Moreover, it might allow future discovery of potential new species of this genus.

Class prediction of closely related plant varieties using gene expression profiling.

In recent years, class prediction experiments have been largely developed in cancer research with the aim of classifying unknown samples by examining their expression signature. In natural populations, a significant component of gene expression variability is also heritable. Citrus species are an ideal model to accomplish the study of these questions in plants, due to the existence of varieties derived from somatic mutations that are likely to differ from each other by one or a few point mutations but are phenotypically indistinguishable at early vegetative stages. The small genetic variability existing among these varieties makes molecular markers ineffective in distinguishing genotypes within a particular species. Gene expression profiles have been used to predict mandarin clementine varieties (Citrus clementina Hort. ex Tan.) by means of two independent supervised learning algorithms: Support Vector Machines and Prediction Analysis of Microarrays. The results show that transcriptional variation is variety-dependent in citrus, and supervised clustering methods may correctly assign blind samples to varieties when both training and test samples are under the same experimental conditions.

Preferential accumulation of severe variants of Citrus tristeza virus in plants co-inoculated with mild and severe variants.

The viral population in sweet orange plants, either healthy or pre-inoculated with the asymptomatic isolate of Citrus tristeza virus (CTV) T32, and then graft- or aphid-inoculated with the stem-pitting isolate T318, was characterized with respect to symptom expression, reaction with monoclonal antibody MCA13, single-strand conformation polymorphism (SSCP) of genes p18 and p20, bi-directional RT-PCR, and dot-blot hybridisation. All plants inoculated with T318, with or without pre-inoculation, showed stem pitting, reacted with MCA13, had the SSCP profile characteristic of this isolate, and in bi-directional RT-PCR yielded a 450-bp DNA product associated with severe isolates, indicating that T32 afforded no protection against T318. The latter isolate had two main sequence variants, the minor one of which was indistinguishable from the main T32 sequence, and both were detected in most plants that were graft-inoculated with T318. However, the T32 variant was not detected in plants that were aphid-inoculated only with T318 and also showed stem pitting. This suggested an association of symptoms with the major T318 sequence and preferential transmission of this variant by aphids. The T318-specific variant accumulated more than the T32 variant in plants in which both were replicating, suggesting a higher fitness of the former. Our results clearly emphasize the potential threat of severe CTV variants in areas where mild isolates are presently predominant.

The complete nucleotide sequence of a severe stem pitting isolate of Citrus tristeza virus from Spain: comparison with isolates from different origins.

The genomic RNA of the severe stem pitting Citrus tristeza virus (CTV) isolate T318A from Spain (19252 nt) was completely sequenced. It showed strong sequence similarities with the severe isolates SY568 from California and NUagA from Japan, and distant relationships with mild non-stem pitting isolates T385 from Spain and T30 from Florida. Contrasting with other severe CTV isolates, T318A had a predominant sequence variant even in the highly variable 5'-terminal untranslated region, in which a unique sequence variant (type II) previously associated with severe stem pitting isolates was detected. The high homogeneity of the T318A population suggests that the sequence obtained is probably responsible for the symptoms induced and makes it a useful tool to delimit pathogenicity determinants.

Evolutionary analysis of genetic variation observed in citrus tristeza virus (CTV) after host passage.

We have studied the genetic variability in two genes (p18 and p20) from two groups of Citrus tristeza virus (CTV) isolates. One group (isolates T385, T317, T318, and T305) was derived from a Spanish source by successive host passages while the other (isolates T388 and T390) was obtained after aphid transmission from a Japanese source. A total of 274 sequences were obtained for gene p18 and 451 for p20. In the corresponding phylogenetic trees, sequences derived from the severe isolates (T318, T305, and T388) clustered together and separately from those derived from mild or moderate isolates (T385, T317, and T390), regardless of their geographic origin. Hierarchical analyses of molecular variance showed that up to 53% of the total genetic variability in p18 and up to 87% of the variation in p20 could be explained by differences in the pathogenicity features of the isolates. Neutrality tests revealed that different selection forces had been acting between isolates and between genes, with purifying selection being suggested for p18 from isolates T385 and T390 and for p20 from isolates T385, T317, and T388, and balancing selection for p18 from isolates T318, T305, and T388 and for p20 from isolates T318 and T390. Furthermore, several models of codon selection were observed, with purifying selection being the most notable one, compatible with low effective population size of the virus populations resulting from transmission bottlenecks. We found no evidence of recombination playing a significant role during p18 and p20 evolution in these isolates. These results suggest that hosts can be an important evolutionary factor for CTV isolates.

The complete sequence of a Spanish isolate of Broad bean wilt virus 1 (BBWV-1) reveals a high variability and conserved motifs in the genus Fabavirus.

The genome of a Spanish isolate of Broad bean wilt virus-1 (BBWV-1) was completely sequenced and compared with available sequences of other isolates of the genus Fabavirus (BBWV-1 and BBWV-2). This consisted of two RNAs of 5814 and 3431 nucleotides, respectively, and their organization was similar to that of other members of the family Comoviridae. Its mean nucleotide identity with a BBWV-1 American isolate was 81.5%, and between 59.8 and 63.5% with seven BBWV-2 isolates. Our analysis showed sequence stretches in the 5' non-coding regions which are conserved in both genomic RNAs and in BBWV-1 and BBWV-2 isolates.

Development of a citrus genome-wide EST collection and cDNA microarray as resources for genomic studies.

A functional genomics project has been initiated to approach the molecular characterization of the main biological and agronomical traits of citrus. As a key part of this project, a citrus EST collection has been generated from 25 cDNA libraries covering different tissues, developmental stages and stress conditions. The collection includes a total of 22,635 high-quality ESTs, grouped in 11,836 putative unigenes, which represent at least one third of the estimated number of genes in the citrus genome. Functional annotation of unigenes which have Arabidopsis orthologues (68% of all unigenes) revealed gene representation in every major functional category, suggesting that a genome-wide EST collection was obtained. A Citrus clementina Hort. ex Tan. cv. Clemenules genomic library, that will contribute to further characterization of relevant genes, has also been constructed. To initiate the analysis of citrus transcriptome, we have developed a cDNA microarray containing 12,672 probes corresponding to 6875 putative unigenes of the collection. Technical characterization of the microarray showed high intra- and inter-array reproducibility, as well as a good range of sensitivity. We have also validated gene expression data achieved with this microarray through an independent technique such as RNA gel blot analysis.

The complete nucleotide sequence of a Spanish isolate of Citrus psorosis virus: comparative analysis with other ophioviruses.

The complete genomic sequence (11278 nt) of Citrus psorosis virus (CPsV), isolate P-121 from Spain, was determined and compared with those from isolate CPV-4 and from other ophioviruses. The three RNAs of P-121 had similar size and identical organization as those of CPV-4. The 24K and the RdRp proteins were potentially encoded in the viral complementary (vc) strand of RNA 1, the 54K protein potentially encoded in vcRNA 2 and the coat protein encoded in vcRNA 3. These four proteins from P-121 and CPV-4 had 87, 92, 93 and 94% amino acid identity, respectively, but only 22, 38, 25 and 33% identity with their homologous proteins from Mirafiori lettuce big vein virus (MLBVV), the only other ophiovirus completely sequenced. Biological and genetic differences between CPsV and MLBVV (and the other ophioviruses), would support their future allocation in different genera within a tentative family Ophioviridae.

Seed Transmission of Citrus leaf botch virus: Implications in Quarantine and Certification Programs.

Citrus leaf blotch virus (CLBV) was purified and characterized from a Nagami kumquat (Fortunella margarita (Lour.) Swingle), showing bud union crease when propagated on Troyer citrange (Citrus sinensis (L.) Osbeck × Poncirus trifoliata (L.) Raf.) (2). The complete nucleotide sequence of its genomic RNA was determined (4), and biological and molecular diagnosis methods were developed (1,3). CLBV, detected in several citrus cultivars from Australia, the United States (Florida and California), Japan, and Spain is usually associated with bud union crease on citrange or citumelo (C. paradisi (Macfad.) × P. trifoliata). The economic importance of CLBV for the citrus industry is presently unknown since its incidence in different citrus areas has not been evaluated, and its actual involvement in causing bud union crease on trifoliate rootstocks has not yet been proved. To assess seed transmissibility of this virus, 120 to 210 seeds from CLBV-infected Troyer citrange, Nagami kumquat, or sour orange (Citrus aurantium L.) plants were grown in a greenhouse. Individual 4-month-old seedlings were analyzed for CLBV by reverse transcriptase polymerase chain reaction, and infection was confirmed by biological indexing on Dweet tangor (C. tangerina Hort. ex Tanaka × C. sinensis (L.) Osbeck) when seedlings were approximately 18 months old. Seed transmission was found in 2.50, 2.52, and 2.46% of the citrange, kumquat, and sour orange seedlings, respectively. This finding indicates that control of CLBV spread during citrus propagation will require, not only virus-free buds, but also rootstock seedlings that originate from CLBV-free seed source trees. Because CLBV is seed transmissible, regulations of citrus certification programs may need to be changed to include increased control of seed source trees. Also, international regulations for citrus seed movement likely will have to be augmented to include a phytosanitary certification indicating that seeds have been collected from CLBV-free trees. References: (1) L. Galipienso et al. Plant Pathol. 49:308, 2000. (2) L. Galipienso et al. Arch. Virol. 146:357, 2001. (3) L. Galipienso et al. Eur. J. Plant Pathol. 110:175,2004. (4) M. C. Vives et al. Virology 287:225, 2001.

QTL analysis of citrus tristeza virus-citradia interaction.

Citrus tristeza virus (CTV) has caused the death of millions of trees grafted on sour orange ( Citrus aurantium). However, this rootstock is very well adapted to the Mediterranean, semi-arid conditions. The aim of the present research is to genetically analyze the accumulation of CTV in a progeny derived from the cross between C. aurantium and Poncirus trifoliata, both resistant to CTV isolate T-346. Graft propagation of 104 hybrids was done on healthy sweet orange as a rootstock. Three months later, each rootstock was graft inoculated with two patches of infected tissue (isolate T-346). One, 2, and sometimes, 3 and 4 years after inoculation, hybrids and infected patches were tested for CTV by tissue-blot immuno-assay. Additionally, CTV multiplication was evaluated every year as the optical density of double-antibody sandwich enzyme-linked immuno-sorbent assay reactions. Linkage maps for P. trifoliata based on 63 markers, and for C. aurantium based on 157 markers, were used. Most molecular markers were microsatellites and IRAP (inter-retrotransposon amplified polymorphisms). Some analogues of resistance and expressed sequences were also included for candidate gene analysis. Resistance against CTV was analyzed as a quantitative trait (CTV accumulation) by QTL (quantitative trait loci) analysis to avoid the assumption of monogenic control. Three major resistance QTLs were detected where the P. trifoliata resistance gene, Ctv-R, had been previously located in other progenies. Up to five minor QTLs were detected ( Ctv-A(1) to Ctv-A(5)). A significant epistatic interaction involving Ctv-R(1) and Ctv-A(1) was also found. An analogue of a resistance gene is a candidate for Ctv-A(3), and two expressed sequences are candidates for Ctv-A(1) and Ctv-A(5). Single-strand conformational polymorphism analysis of CTV genes QTL P20 and P25 (coat protein) in susceptible hybrids, was carried out to test whether or not any QTL accumulation was a defeated resistance gene. Since the same haplotype of the virus was visualized independently on the CTV titer, differences in the amount of virions are not explained through the selection of CTV genotypes by the host, but through differences among citradias in CTV replication and/or movement.

Polymorphism of a specific region in gene p23 of Citrus tristeza virus allows discrimination between mild and severe isolates.

The pathogenicity determinants of Citrus tristeza virus (CTV) are presently unknown, although transgenic Mexican limes over-expressing CTV p23, an RNA-binding protein involved in regulating the asymmetrical accumulation of viral RNA strands, display typical CTV symptoms. Here we compared the predominant sequence variants of gene p23 from 18 CTV isolates of different geographic origin and pathogenicity characteristics. Phylogenetic analysis of these sequences revealed three groups of isolates: i) mild, inducing only symptoms in lime and/or decline of citrus species grafted on sour orange rootstock, ii) severe, causing additionally stem pitting on sweet orange and/or grapefruit, and iii) an atypical group of isolates inciting variable symptoms. The sequences of the isolates located at the periphery of each group were recombinants. Pairwise comparisons of the predicted amino acid sequences showed that residues at positions 78-80 were characteristic of each group of isolates. Group-specific primers based on these differences allowed RT-PCR detection of each sequence type in dsRNA-rich preparations from infected tissues. While mild isolates contained only the sequence characteristic of this group, most severe isolates contained the sequences characteristic of their group, and additionally, sequences characteristic of the mild and/or the atypical groups, suggesting that the severe phenotype is associated with the presence of the severe and/or the atypical sequence types. This association can be exploited for quick detection of potentially damaging sequence variants and for monitoring cross protection.

Rapid detection of cucumber vein yellowing virus by tissue-print hybridisation with digoxigenin-labelled cDNA probes.

Hybridisation of tissue prints with nonradioactive cDNA probes was developed to detect cucumber vein yellowing virus (CVYV) in cucurbit plants. Results showed irregular distribution of the virus within cucumber, zucchini or melon plants without defined tropism for a specific tissue. Therefore, reliable diagnosis of CVYV requires analysis of tissue prints from at least five different plant sites. This detection procedure allows rapid analysis of large numbers of plants and it can be useful for epidemiological studies of CVYV and to control virus spread via eradication of early foci.

Variability of the coat protein gene of Citrus psorosis virus in Campania, southern Italy.

Variability of the Coat protein (CP) gene of Citrus psorosis virus (CPsV) was assessed serologically, and by sequence analyses of two genomic regions located in the 3' (region C) and 5' (region V) halves of the gene. Analysis of 53 psorosis field sources from Campania, Italy, with 23 monoclonal antibodies revealed nine serogroups and at least ten different epitopes. Sequence analysis of 19 of these sources showed limited nucleotide diversity of the CP gene in the population. Diversity was slightly higher in region V than in region C. Phylogenetic analysis of the V and C regions of the CP showed that the Campania sources of CPsV were clearly separated from the CPsV-4 isolate from Florida. For C region, most of the CPsV sources clustered together, whereas two clusters were observed for region V. The ratio between nonsynonymous and synonymous substitutions for regions C (0.083) and V (0.345) indicated negative selective pressure for amino acid changes, more intense in the C region. No correlation was found between serogroups and specific aminoacid sequences, field location or citrus cultivar.

Variation of haplotype distributions of two genomic regions of Citrus tristeza virus populations from eastern Spain.

Genetic variation in natural populations of Citrus tristeza virus (CTV) was studied using haplotypes detected by single-strand conformation polymorphism (SSCP) analysis of two genomic regions (p20 gene and segment A, located in ORF1a). Analysis of 254 samples from 125 trees, collected at 12 different sites, yielded 8 different haplotypes for p20 and 5 for segment A. The most frequent haplotype of p20 was predominant at all sites, but several sites differed in the predominance of segment A haplotypes. At most sites, the homozygosity observed for the p20 gene tended to be higher than expected in a neutral evolution, whereas the opposite was true for segment A. Comparison of the populations at different sites showed that 44 of the 66 possible population pairs were genetically distinct for segment A, but only six pairs differed for the p20 gene. Analysis of molecular variance grouping trees by site, scion variety, rootstock or age, showed that variation in segment A was significantly affected by site, tree age and rootstock, and that variation between trees in each group and within trees was even more important. In contrast, variation in p20 was affected only by site and rootstock, each factor contributing to < 2% of the variation. The data suggest that sequence variations in segment A must be functionally less important and that it has less evolutionary constraints than p20. Detection of different haplotypes in neighbour trees or in samples from the same tree may help explain part of the variability observed in CTV symptom expression.

First Report of Broad bean wilt virus 1 in Spain.

In late summer 2001, field-grown pepper (Capsicum annuum) plants showing chlorotic blotching in leaves and fruits were observed in Benicarló, Castellón, Spain. Enzyme-linked immunosorbent assays of extracts of these plants with a collection of plant virus antisera showed a positive reaction only with Broad bean wilt virus serotype 1 (BBWV-1) antiserum. To confirm BBWV-1 infection, primers B1 (GCTCTTCCCCATATAACTTTC) and B2 (GTCTCTATCTTCTCTTCTTCC) were designed based on the nucleotide sequence of BBWV-1 isolate PV132 (GenBank Accession No. AB018702), and were used for reverse-transcription polymerase chain reaction analysis. RNAs extracted from symptomatic plants yielded a cDNA product of ~500 bp that was not obtained using RNA extracts from healthy plants. The sequence of this cDNA fragment was determined, and it showed ~80% nucleotide identity with a BBWV-1 genomic region, encompassing part of the two coat proteins genes. Amino acid identities were ~94% with BBWV-1 isolates and ~60% with BBWV-2 isolates. BBWV-1 and BBWV-2 are considered different species of the genus Fabavirus. BBWV-1 and BBWV-2 are distributed worldwide and infect a wide range of plants. In the Mediterranean Basin, BBWV-1 has been serologically identified in Jordan, Lebanon, Syria, Egypt, Tunisia, Morocco (2), and Italy (1), but no nucleotide sequence data is available. To our knowledge, this is the first report of BBWV-1 in Spain. References: (1) M. G. Bellardi et al. Plant Dis. 81:959, 1997. (2) K. M. Makkouk et al. Neth. J. Plant Pathol. 96:291, 1990.

The nucleotide sequence and genomic organization of Citrus leaf blotch virus: candidate type species for a new virus genus.

The complete nucleotide sequence of Citrus leaf blotch virus (CLBV) was determined. CLBV genomic RNA (gRNA) has 8747 nt, excluding the 3'-terminal poly(A) tail, and contains three open reading frames (ORFs) and untranslated regions (UTR) of 73 and 541 nucleotides at the 5' and 3' termini, respectively. ORF1 potentially encodes a 227.4-kDa polypeptide, which has methyltransferase, papain-like protease, helicase, and RNA-dependent RNA polymerase motifs. ORF2 encodes a 40.2-kDa polypeptide containing a motif characteristic of cell-to-cell movement proteins. The 40.7-kDa polypeptide encoded by ORF3 was identified as the coat protein. The genome organization of CLBV resembles that of viruses in the genus Trichovirus, but they differ in various aspects: (i) in trichoviruses ORF2 overlaps ORFs 1 and 3, whereas in CLBV, ORFs 2 and 3 are separated and ORFs 1 and 2 overlap in one nucleotide; (ii) CLBV gRNA and CP are larger than those of trichoviruses; and (iii) the CLBV 3' UTR is larger than that of trichoviruses. Phylogenetic comparisons based on CP amino acid signatures clearly separates CLBV from trichoviruses. Also contrasting with trichoviruses, CLBV could not be transmitted to Chenopodium quinoa Willd. Considering these singularities, we propose that CLBV should be included in a new virus genus.

Genetic variation of Citrus tristeza virus isolates from California and Spain: evidence for mixed infections and recombination.

We examined the population structure and genetic variation of four genomic regions within and between 30 Citrus tristeza virus (CTV) isolates from Spain and California. Our analyses showed that most isolates contained a population of sequence variants, with one being predominant. Four isolates showed two major sequence variants in some genomic regions. The two major variants of three of these isolates showed very low nucleotide identity to each other but were very similar to those of other isolates, suggesting the possibility of mixed infections with two divergent isolates. Incongruencies of phylogenetic relationships in the different genomic regions and statistical analyses suggested that the genomes of some CTV sequence variants originated by recombination events between diverged sequence variants. No correlation was observed between geographic origin and nucleotide distance, and thus from a genetic view, the Spanish and Californian isolates analyzed here could be considered members of the same population.

Partial characterisation of citrus leaf blotch virus, a new virus from Nagami kumquat.

Citrus leaf blotch virus (CLBV) was purified from leaves of Nagami kumquat SRA-153 that showed bud union crease when propagated on Troyer citrange. Virions were filamentous particles (960 x 14 nm) containing a 42 kDa protein and a single-stranded RNA (ssRNA) of about 9,000 nt (Mr 3 x 10(6)). Infected tissue contained three species of double-stranded RNA (dsRNA) of Mr 6, 4.5 and 3.4 x 10(6). The nucleotide sequence of several complementary DNA (cDNA) clones showed significant similarities with replication-related proteins from plant filamentous viruses in several genera. A digoxigenin-labelled probe from one of these cDNA clones hybridised in Northern blots with ssRNA from virions and with the three dsRNA species, suggesting that the ssRNA is the genomic RNA of the virus, the largest dsRNA is its replicative form, and the two smaller dsRNAs probably replicative forms of 5' co-terminal subgenomic RNAs. CLBV was also detected in several citrus cultivars from Spain and Japan including Navelina sweet orange field trees propagated on Troyer citrange showing bud union crease; however, no virus could be detected in other citrus trees with similar symptoms. This indicates that CLBV is not restricted to kumquat SRA-153, but its involvement in causing the bud union disorder remains unclear.