Face Value: Remote facial expression analysis adds predictive power to perceived effectiveness for selecting anti-tobacco PSAs.

Perceived effectiveness (PE) is a validated tool for predicting the potential impact of anti-tobacco public service announcements (PSAs). We set out to evaluate the added predictive value of facial expression analysis when combined with PE in a remote (online) survey. Each of 302 tobacco users watched 3 PSAs and allowed transmission of webcam videos from which metrics for "attention" (head position) and "facial action units" (FAU) were computed. The participants completed scales for their subjective emotions, willingness to share on social media, and intention to quit smoking using the Tobacco Free Florida website. Based on PE, both ready to quit (RTQ) and not ready (NR) respondents favored the same PSAs but RTQs assigned higher PE scores. Negative PSAs ("sad" or "frightening") were more compelling overall but RTQs also favored surprising ads and were more willing to share them on social media. Logistic regression showed that the combination of Attention + FAU+ PE (AUC = .816, p < .0001) outperformed single factors or factor combinations in distinguishing RTQ from NR. This study demonstrates that on-line assessment of facial expressions enhances the predictive value of PE and can be deployed on large remote samples.

Advances in plant virus evolution: translating evolutionary insights into better disease management.

Recent studies in plant virus evolution are revealing that genetic structure and behavior of virus and viroid populations can explain important pathogenic properties of these agents, such as host resistance breakdown, disease severity, and host shifting, among others. Genetic variation is essential for the survival of organisms. The exploration of how these subcellular parasites generate and maintain a certain frequency of mutations at the intra- and inter-host levels is revealing novel molecular virus-plant interactions. They emphasize the role of host environment in the dynamic genetic composition of virus populations. Functional genomics has identified host factors that are transcriptionally altered after virus infections. The analyses of these data by means of systems biology approaches are uncovering critical plant genes specifically targeted by viruses during host adaptation. Also, a next-generation resequencing approach of a whole virus genome is opening new avenues to study virus recombination and the relationships between intra-host virus composition and pathogenesis. Altogether, the analyzed data indicate that systematic disruption of some specific parameters of evolving virus populations could lead to more efficient ways of disease prevention, eradication, or tolerable virus-plant coexistence.

Newly Discovered Natural Hosts of Tomato chlorosis virus in Costa Rica.

Tomato chlorosis virus (ToCV) is an emerging whitefly-transmitted crinivirus (2). In Costa Rica in 2007, ToCV was detected in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants causing symptoms of severe yellowing and foliar chlorosis (1). To identify alternative hosts that may serve as virus reservoirs, 78 samples were collected from multiple species of common weeds growing adjacent to tomato nurseries in the Cartago Province, where ToCV was previously identified, during the autumn of 2008 and summer of 2009. The weeds were collected on the basis of the presence of whiteflies and/or symptoms of interveinal chlorosis, but not all samples were symptomatic for infection by ToCV. Total RNA was extracted from leaf tissue with TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed with the Qtaq One-Step qRT-PCR SYBR Kit (Clontech Laboratories, Mountain View, CA) and primers specific for the ToCV HSP70h gene (3). A 123-bp DNA fragment was amplified in five weeds, which were identified taxonomically as Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolacaceae), Plantago major (Plantaginaceae), a Brassica sp. (Brassicaceae) (two samples), and a single plant of Cucurbita moschata (Cucurbitaceae) growing next to those weeds. The amplified DNA fragments were sequenced and BLAST analysis showed 100% nucleotide sequence identity with the HSP70h gene of the Florida ToCV isolate (GenBank Accession No. AY903448). To confirm the presence of ToCV in these six weed samples, conventional RT-PCR reactions were performed using primers specific for the ToCV CPm and p22 genes as described previously (1). Nucleotide sequence analysis of the amplified DNA fragments verified their identity as ToCV, with 100% sequence identity to the CPm of the ToCV isolate of Florida (Accession No. AY903448) and the p22 gene of the Cartago, Costa Rican isolate (Accession No. FJ809714). Although the number of samples analyzed is not sufficient to allow a determination of the role of weed reservoirs in ToCV epidemics in Costa Rican tomato crops, this report on the wider natural host range of ToCV in Costa Rica may lead to a better understanding of the epidemiology of this virus and be useful in the development of disease management strategies. To our knowledge this is the first report of these weeds as natural hosts of ToCV. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) M. I. Font et al. Plant Dis. 88:82, 2004. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008.

Plant production of veterinary vaccines and therapeutics.

Plant-derived biologicals for use in animal health are becoming an increasingly important target for research into alternative, improved methods for disease control. Although there are no commercial products on the market yet, the development and testing of oral, plant-based vaccines is now beyond the proof-of-principle stage. Vaccines, such as those developed for porcine transmissible gastroenteritis virus, have the potential to stimulate both mucosal and systemic, as well as, lactogenic immunity as has already been seen in target animal trials. Plants are a promising production system, but they must compete with existing vaccines and protein production platforms. In addition, regulatory hurdles will need to be overcome, and industry and public acceptance of the technology are important in establishing successful products.

First Report of Tomato chlorosis virus in Tomato in Costa Rica.

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5'-ATGGATCTCACTGGTTGCTTGC-3') and ToCV-p22-R (5'-TTATATATCACTCCCAAAGAAA-3') specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5'-TCTGGCAGTACCCGTTCGTGA-3') and ToCVCPmR (5'-TACCGGCAGTCGTCCCATACC-3') designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5'-GGCGGTACTTTCGACACTTCTT-3') and ToCVHSP70R (5'-ATTAACGCGCAAAACCATCTG-3') designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Epitope presentation system based on cucumber mosaic virus coat protein expressed from a potato virus X-based vector.

The Cucumber mosaic virus Ixora isolate (CMV) coat protein gene (CP) was placed under the transcriptional control of the duplicated subgenomic CP promoter of a Potato virus X (PVX)-based vector. In vitro RNA transcripts were inoculated onto Nicotiana benthamiana plants and recombinant CMV capsid proteins were identified on Western blots probed with CMV antibodies 5-7 days post-inoculation. PVX-produced CMV CP subunits were capable of assembling into virus-like particles (VLPs), which were visualized by electron microscopy. We further used the PVX/CMVCP system for transient expression of recombinant CMV CP constructs containing different neutralizing epitopes of Newcastle disease virus (NDV) engineered into the internal betaH-betaI (motif 5) loop. Both crude plant extracts and purified VLPs were immunoreactive with CMV antibodies as well as with epitope-specific antibodies to NDV, thus confirming the surface display of the engineered NDV epitope. Our study demonstrates the potential of PVX/CMVCP as an expression tool and as a presentation system for promising epitopes.

First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica.

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5' GAGCGCCGCACAAGTCATC 3' and CYHSPR 5' TACCGCCACCAAAGTCATACATTA 3') of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5' GGCTGGCAACATGGAAACTGA 3' and MYVR 5' CTGAAAAGGCGATGAACTA TTGTG 3') were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

The complete nucleotide sequence, genome organization, and specific detection of Beet mosaic virus.

Beet mosaic virus (BtMV) was identified almost five decades ago but has not been fully characterized at the molecular level. In this study, we have determined for the first time the complete nucleotide sequence of BtMV genomic RNA and have developed a specific molecular means for its diagnosis. The viral genome of BtMV comprises 9591 nucleotides, excluding the 3' terminal poly (A) sequence, and contains a single open reading frame (ORF) that begins at nt 166 and terminates at nt 9423, encoding a single polyprotein of 3086 amino acid residues. A 3' untranslated region of 168 nucleotides follows the ORF. The deduced genome organization is typical for a member of the family Potyviridae and includes 10 proteins: P1, HC-Pro, P3, 6K1, CI, 6K2, NIa-VPg, NIa-Pro, NIb and coat protein (CP). Nine putative protease cleavage sites were predicted computationally and by analogy with genome arrangements of other potyviruses. Conserved sequence motifs of homologous proteins of other potyviruses were found in corresponding positions of BtMV. BtMV is a distinct species of the genus Potyvirus with the most closely related species being Peanut mottle virus ( approximately 55% amino acid identity). Based on the nucleotide sequence obtained, we have developed a virus-specific RT-PCR assay for accurate diagnosis and differentiation of BtMV.

Predicted ATP-binding cassette systems in the phytopathogenic mollicute Spiroplasma kunkelii.

Spiroplasma kunkelii is a cell wall-free, helical, and motile mycoplasma-like organism that causes corn stunt disease in maize. The bacterium has a compact genome with a gene set approaching the minimal complement necessary for cellular life and pathogenesis. A set of 21 ATP-binding cassette (ABC) domains was identified during the annotation of a draft S. kunkelii genome sequence. These 21 ABC domains are present in 18 predicted proteins, and are components of 16 functional systems, which account for 5% of the protein coding capacity of the S. kunkelii genome. Of the 16 systems, 11 are membrane-bound transporters, and two are cytosolic systems involved in DNA repair and the oxidative stress response; the genes for the remaining three hypothetical systems harbor nonsense and/or frameshift mutations, so their functional status is doubtful. Assembly of the 11 multicomponent transporters, and comparisons with other known systems permitted functional predictions for the S. kunkelii ABC transporter systems. These transporters convey a wide variety of substrates, and are critical for nutrient uptake, multidrug resistance, and perhaps virulence. Our findings provide a framework for functional characterization of the ABC systems in S. kunkelii.

The complete nucleotide sequence of isolate BYMV-GDD of Bean yellow mosaic virus, and comparison to other potyviruses.

The complete nucleotide sequence of Bean yellow mosaic virus (BYMV) gladiolus isolate GDD was determined and compared to broad bean isolates BYMV-MB4 and BYMV-S. The BYMV-GDD genome (9528 nt) was more similar to BYMV-MB4 (9532 nt) than to BYMV-S (9547 nt), which has "atypical" symptom expression and host range. The greatest variability occurred in the 5' untranslated region, P1 protein, and NIa-VPg protein, the N-terminal two thirds of HC-Pro, and the C-terminal one third of P3. Each of these regions has been correlated with symptom or host differences between isolates of other potyviruses, and may contribute to the "atypical" nature of BYMV-S.

Genetic variability of genomic RNA 2 of four tobacco rattle tobravirus isolates from potato fields in the Northwestern United States.

Sequence analysis of RNA 2 of four Tobacco rattle virus (TRV) isolates collected from potato fields in Oregon (OR2, Umt1), Washington (BM), and Colorado (Cot2) revealed significant homologies to the ORY isolate from North America. Phylogenetic analysis based on a comparison of nucleotide (nt) and amino acid (aa) sequences with other members of the genus Tobravirus indicates that the North American isolates cluster as a distinct group. All of the RNAs are predicted to contain open reading frames (ORFs) potentially encoding the coat protein (CP, ORF 2a) and 37.6 kDa (ORF 2b) ORFs. In addition, they all contain a region of similarity to the 3' terminus of RNA 1 of ORY, including a truncated portion of the 16 kDa cistron from the 3' end of RNA 1. Three of the isolates, which are nematode transmissible, OR2, BM, and Cot2, also contain a third putative ORF (ORF 2c) which encodes a protein of 33.6 kDa. The fourth isolate, Umt1, which is not nematode transmissible, is the most divergent of the isolates as it encodes a truncated version of ORF 2c. The ORF 2c deletion in Umt1 may contribute to its inability to be transmitted by the vector. The results reported in this article indicate again that the TRV genome is flexible. Interestingly, although both isolates Umt1 and Cot2 were mechanically transmitted to tobacco from potato, only Umt1 exhibits the deletion in RNA 2. TRV Isolate Umt1, therefore, appears to be another example of rapid adaptation of the TRV genome to non-field conditions.

Gene content and organization of an 85-kb DNA segment from the genome of the phytopathogenic mollicute Spiroplasma kunkelii.

Spiroplasma kunkelii, the causative agent of corn stunt disease in maize (Zea maysL.), is a helical, cell wall-less prokaryote assigned to the class Mollicutes. As part of a project to sequence the entire S. kunkelii genome, we analyzed an 85-kb DNA segment from the pathogenic strain CR2-3x. This genome segment contains 101 ORFs and two tRNA genes. The majority of the ORFs code for predicted proteins that can be assigned to respective clusters of orthologous groups (COGs). These COGs cover diverse functional categories including genetic information storage and processing, cellular processes, and metabolism. The most notable gene cluster in this genome segment is a super-operon capable of encoding 24 ribosomal proteins. The organization of genes in this operon reflects the unique evolutionary position of the spiroplasma. Gene duplications, domain rearrangements, and frameshift mutations in the segment are interpreted as indicators of phase variation in the spiroplasma. To our knowledge, this is the first analysis of a large genome segment from a plant pathogenic spiroplasma.

Phylogeny of isolates of Prunus necrotic ringspot virus from the Ilarvirus Ringtest and identification of group-specific features.

Isolates of Prunus necrotic ringspot virus (PNRSV) were examined to establish the level of naturally occurring sequence variation in the coat protein (CP) gene and to identify group-specific genome features that may prove valuable for the generation of diagnostic reagents. Phylogenetic analysis of a 452 bp sequence of 68 virus isolates, 20 obtained from the European Union Ilarvirus Ringtest held in October 1998, confirmed the clustering of the isolates into three distinct groups. Although no correlation was found between the sequence and host or geographic origin, there was a general trend for severe isolates to cluster into one group. Group-specific features have been identified for discrimination between virus strains.

Molecular characterization of the genome of Maize rayado fino virus, the type member of the genus Marafivirus.

The complete nucleotide sequence of the single-stranded RNA genome of Maize rayado fino virus (MRFV), the type member of the genus Marafivirus, is 6305 nucleotides (nts) in length and contains two putative open reading frames (ORFs). The largest ORF (nt 97-6180) encodes a polyprotein of 224 kDa with sequence similarities at its N-terminus to the replication-associated proteins of other viruses with positive-strand RNA genomes and to the papainlike protease domain found in tymoviruses. The C-terminus of the 224-kDa ORF also encodes the MRFV capsid protein. A smaller, overlapping ORF (nt 302-1561) encodes a putative protein of 43 kDa with unknown function but with limited sequence similarities to putative movement proteins of tymoviruses. The nucleotide sequence and proposed genome expression strategy of MRFV is most closely related to that of oat blue dwarf virus (OBDV). Unlike OBDV, MRFV RNA does not appear to contain a poly(A) tail, and it encodes a putative second overlapping open reading frame.

Role of Maize rayado fino virus in the Etiology of "Red Stunt" Disease in Brazil.

Corn production in several areas of Brazil recently has been seriously afflicted by a disease commonly referred to as "red stunt," characterized by stunting and leaf reddening. Early observations that a phytoplasma was associated with the disease were confirmed through molecular analysis, which revealed the presence of maize bushy stunt phytoplasma (MBS) (1). Another disease of corn, corn stunt, is considered to be caused by one or more of a complex of MBS, corn stunt spiroplasma (CSS), and Maize rayado fino virus (MRFV), which can all be transmitted simultaneously by their leafhopper vector Dalbulus maidis (Delong & Wolcott). The contributions of CSS and MRFV to the recently described "red stunt" disease in Brazil are unknown. A virus serologically related to MRFV, Brazilian corn streak virus, was first identified in Sao Paulo State, Brazil, in the early 1970s; serological studies indicated that isolates of Brazilian corn streak virus were related to, but distinguishable from, MRFV isolates from other Latin American countries (4). Therefore, there was a high probability that MRFV would be found in maize tissues collected from plants exhibiting symptoms of "red stunt" disease. Maize leaf samples exhibiting symptoms of "red stunt" disease were collected and preserved by drying from four Brazilian States during 1995 and 1996 (1). Total nucleic acid extracts were prepared from dried leaf tissue and aliquots of the extracts were spotted onto a nylon membrane, which subsequently was hybridized to an MRFV-specific cRNA probe (3). Of the 37 samples tested for the presence of MRFV by nucleic acid hybridization, 16 were positive for MRFV. It was present in some, but not all, samples that were positive for MBS (1). MBS was detected in six, and CSS was detected by polymerase chain reaction (PCR) (2) in 12 samples. In 8 of the 37 samples, both CSS and MRFV were present, 4 of 37 were positive for MBS and MRFV, and in 3 of 37 samples, all three pathogens were detected. Therefore, there is not a clear correlation between the presence of MRFV and the symptoms of "red stunt." The coat protein gene and adjacent 3' nontranslated region of MRFV were amplified from infected tissues by reverse transcription-polymerase chain reaction (RT-PCR) using MRFV-specific primers (3). Three cloned PCR products were sequenced (deposited at GenBank under accession nos. AF186177 to AF186179), which revealed that the nucleotide sequences of the Brazilian isolates were 98% sequence identical and shared 90 to 97% identity with other MRFV isolates (3). Phylogenetic analysis of the sequences revealed close relationships to MRFV isolates from Peru and Bolivia, which neighbor Brazil (3). The contribution of MRFV to the stunting and leaf reddening symptoms exhibited by maize plants with "red stunt" disease is unknown. Of the 37 samples examined in this study, MRFV was detected in 16. A more complete epidemiological study of the association of MBS, CSS, MRFV, and their insect vector with "red stunt" disease will provide information on the significance of these pathogens in the current disease outbreak. References: (1) I. P. Bedendo et al. Plant Dis. 81:957, 1997. (2) R. E. Davis and E. L. Dally (Abstr.), Phytopathology 88:S20, 1998. (3) R. W. Hammond et al. J. Gen. Virol. 78:3153, 1997. (4) E. W. Kitajima et al. Proc. Am. Phytopathol. Soc. 2:76, 1975.

Characterization of a tomato protein kinase gene induced by infection by Potato spindle tuber viroid.

Viroids--covalently closed, circular RNA molecules in the size range of 250 to 450 nucleotides-are the smallest known infectious agents and cause a number of diseases of crop plants. Viroids do not encode proteins and replicate within the nucleus without a helper virus. In many cases, viroid infection results in symptoms of stunting, epinasty, and vein clearing. In our study of the molecular basis of the response of tomato cv. Rutgers to infection by Potato spindle tuber viroid (PSTVd), we have identified a specific protein kinase gene, pkv, that is transcriptionally activated in plants infected with either the intermediate or severe strain of PSTVd, at a lower level in plants inoculated with a mild strain, and not detectable in mock-inoculated plants. A full-length copy of the gene encoding the 55-kDa PKV (protein kinase viroid)-induced protein has been isolated and sequence analysis revealed significant homologies to cyclic nucleotide-dependent protein kinases. Although the sequence motifs in the catalytic domain suggest that it is a serine/threonine protein kinase, the recombinant PKV protein autophosphorylates in vitro on serine and tyrosine residues, suggesting that it is a putative member of the class of dual-specificity protein kinases.

Both point mutation and RNA recombination contribute to the sequence diversity of citrus viroid III.

Field-grown citrus trees often harbor complex mixtures of 4-5 different viroid species, and the presence of citrus viroid III (CVd-III) has been shown to reduce the rate of tree growth without inducing disease. To more fully define the structure of its quasi-species, we have examined nine citrus viroid complexes for the presence of previously undescribed sequence variants of CVd-III. Analysis of 86 full-length cDNAs generated from these nine viroid complexes by RT-PCR revealed the presence of 20 new CVd-III variants. Chain lengths ranged from 293-297 nucleotides, and sequence changes were confined largely to the lower portions of the central conserved region and variable domain. The previously described variants CVd-IIIa (297 nt) and CVd-IIIb (294 nt) were clearly predominant, but phylogenetic analysis indicated that certain isolates may contain representatives of two additional fitness peaks. At least one group of CVd-III variants appears to have arisen as a result of RNA recombination. Populations recovered from diseased/declining trees were the most diverse, but even dwarfing isolates originating from old line Shamouti trees showed considerable variability.

Differential transport of DNA by a rectified Brownian motion device.

An interdigitated electrode array (IDEA) device has been designed and used to transport DNA based on a Brownian ratchet mechanism. This migration is produced by the periodic formation of an asymmetric sawtooth electric field in the device. Oligonucleotides of 25, 50, and 100 bases in length were tested using two different array geometries. DNA transport as a function of DNA size, electric field frequency, and array geometry is shown to be in qualitative agreement with theory. Such a device could provide for DNA separations over a broad size range, and can be readily scaled as a component in a microfabricated DNA analysis system.