Insect intestinal mucins and serine proteases associated with the peritrophic matrix from feeding, starved and moulting Mamestra configurata larvae.

Insect intestinal mucins (McIIM2-4) expressed in the midgut of feeding, starved and moulting Mamestra configurata larvae were identified. McIIM2 and McIIM4 were associated with the peritrophic matrix (PM). PMs from feeding and starved larvae were translucent and contained organized chitin bundles perpendicular to their long axis, whereas PM from moulting larvae consisted of an inner opaque mass surrounded by an outer translucent sleeve. Serine protease genes (McSP1, McSP2, McSP25 and McSP29) were also expressed in these larvae and several serine proteases were associated with the PM. Serine protease activity was also detected in the midgut of feeding, starved and moulting larvae.

Responses of the crucifer flea beetle to Brassica volatiles in an olfactometer.

A suite of commercially available volatile compounds was tested in an olfactometer bioassay for responses by the crucifer flea beetle (Phyllotreta cruciferae). Flea beetles were inhibited by exposure to hexane, pentane, and ethanol. Allyl-isothiocyanate, a crucifer-specific volatile, was moderately attractive to spring and early fall flea beetles, but inhibitory to late fall flea beetles. Spring flea beetles were most attracted to (+)-sabinene and E-beta-ocimene, and 1-hexanol, 1-pentanol, and Z-3-hexen-1-ol were stronger attractants than allyl-isothiocyanate. Spring beetles were strongly inhibited by (-)-E-caryophyllene, beta-ionone, indole, (+/-)-linalool, (+)-limonene, E-geraniol, and (-)-beta-pinene and moderately inhibited by (-)-verbenene and hexenal. Our study showed that older leaves and flowers of Brassica napus variety AC Excel contained small amounts of beta-ionone, but seedlings did not. beta-Ionone has not been documented previously in B. napus.

Comparative EST analysis of a Zoophthora radicans isolate derived from Pieris brassicae and an isogenic strain adapted to Plutella xylostella.

Zoophthora radicans is an entomopathogenic fungus with the potential to be used as an insect biological control agent. To better understand the mechanisms used by Z. radicans to infect different hosts, we generated expressed sequence tag (EST) datasets from a Z. radicans strain originally isolated from Pieris brassicae, and an isogenic strain passaged through Plutella xylostella. In total, 1839 ESTs were generated which clustered into 466 contigs and 433 singletons to provide a set of 899 unique sequences. Approximately 85 % of the ESTs were significantly similar (E< or =e(-03)) to other fungal genes, of which 69.6 % encoded proteins with a reported function. Proteins involved in protein synthesis and metabolism were encoded by 38.3 % of the ESTs, while 26.3 % encoded proteins involved in cell-cycle regulation, DNA synthesis, protein fate, transport, cell defence, transcription and RNA synthesis, and 4.9 % encoded proteins associated with cellular transport, signal transduction, control of cellular organization and cell-wall degradation. Several proteinases, including aspartic proteinases, trypsins, trypsin-like serine proteases and metalloproteases, with the potential to degrade insect cuticle were expressed by the two isolates.

A chitin deacetylase and putative insect intestinal lipases are components of the Mamestra configurata (Lepidoptera: Noctuidae) peritrophic matrix.

One- and two-dimensional gel electrophoresis coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to identify cDNA encoding a chitin deacetylase (McCDA1) and three insect intestinal lipases (McIIL1, McIIL2 and McIIL3) associated with the Mamestra configurata (bertha armyworm) peritrophic matrix. Recombinant McCDA1 was active and chitin deacetylase activities were detected in the midgut. McCDA1 and the McIIL genes were expressed exclusively in the midgut; however, McCDA1 and McIIL2 were expressed in all larval stages, whereas McIIL1 was expressed mainly in feeding larvae and McIIL3 primarily during the moult.

Serine proteases and metalloproteases associated with pathogenesis but not host specificity in the Entomophthoralean fungus Zoophthora radicans.

The protease activity of a Zoophthora radicans strain that was highly infective toward Pieris brassicae (cabbage butterfly) larvae was compared with that of isogenic strains that were adapted to Plutella xylostella (diamondback moth) larvae through serial passage. All strains produced three distinct serine proteases ranging in size from 25 to 37 kDa; however, the original strain from P. brassicae also produced large amounts of an approximately 46 kDa metalloprotease. Subsequently, a cDNA encoding a 43 kDa (mature enzyme) zinc-dependent metalloprotease, ZrMEP1, was isolated from the original fungal strain and most likely corresponds to the 46 kDa protease observed with in-gel assays. ZrMEP1 possessed characteristics of both the fungalysin and thermolysin metalloprotease families found in some pulmonary and dermal pathogens. This is the first report of this type of metalloprotease from an entomo pathogenic fungus. A cDNA encoding a trypsin-like serine protease, ZrSP1, was also identified and was most similar to a serine protease from the plant pathogen Verticillium dahliae. In artificial media, ZrMEP1 and ZrSP1 were found to be differentially responsive to gelatin and catabolite repression in the fungal strains adapted to P. brassicae and P. xylostella, but their expression patterns within infected larvae were the same. It appears that while these proteases likely play a role in the infection process, they may not be major host specificity determinants.

Mamestra configurata serpin-1 homologues: cloning, localization and developmental regulation.

A screen of a Mamestra configurata (bertha armyworm) midgut cDNA library identified three types of cDNA clones that resemble the Manduca sexta serpin-1 gene family. Two serpins, 1b and 1c, possess a common conserved serpin amino terminal scaffold domain but bear no similarity to any members of the M. sexta gene family within the reactive centre loop. These serpins differ from one another by only two amino acids in the reactive centre loop (S(363)-->P) and serpin signature (M(369)-->T) regions. The other member, denoted serpin-1a, is closely related to the M. sexta serpin-1Z. M. configurata serpins as a group were expressed in all insect developmental stages including eggs, larvae and adult moths. Within larvae, serpin gene expression was restricted to the early to middle instar developmental phase and mainly in the fat body and hemocytes. Stress imposed by starvation strongly induced expression in fat body and to a lesser degree in alimentary organs, nervous system and Malphigian tubules. Conversely, starvation decreased expression in hemocytes. Wounding or inoculation with bacteria did not induce serpin gene transcription but did lead to the formation of higher and lower molecular weight forms, presumably serpin-protease complexes and resultant truncated serpin, respectively. Two dimensional PAGE and western blotting analysis revealed at least 12 distinct serpins consisting primarily of neutral, but also highly acidic and basic isoforms, as well as additional high and low molecular weight immuno-reactive species. Serpins-1b/1c are the more prominent serpin isoforms and are expressed predominantly in the fat body and subsequently exported to the hemolymph as revealed by western blotting and immunolocalization. The serpin-1b/1c isoform was found only as the fully glycosylated species within the hemolymph. Hemolymph protease activity was comprised mostly of serine proteases whose overall activity increased dramatically at the onset of the molt concomitant with a sharp decline in serpin gene expression.

Differences in the expression and localization of human melanotransferrin in lepidopteran and dipteran insect cell lines.

The ability of several lepidopteran and dipteran insect cell lines to express human melanotransferrin (p97), a glycosyl phosphatidylinositol (GPI)-anchored, iron-binding sialoglycoprotein, was assessed. Spodoptera frugiperda-derived (Sf9) cell lines, transformed with the p97 gene under control of a baculovirus immediate-early promoter, were able to constitutively express the protein and correctly attach it to the outer cell membrane via a GPI anchor as demonstrated by PI-PLC treatment. In contrast, stable constitutive expression could not be demonstrated with cell lines derived from either Drosophila melanogaster (Kc1 or SL2) or Lymantria dispar (Ld652Y) despite the observation that p97 could be detected in transient expression assays. This may indicate that the long-term expression and accumulation of p97 is inhibitory to Drosophila cells, possibly due to improper localization of the protein and resultant competition for cellular iron. In stably transformed Sf9 cells, p97 was expressed on the cell at a maximal level of 0.18 microg/10(6) cells and was secreted at a maximal rate of 9.03 ng/10(6) cells/h. This level was comparable to the amount expressed with the baculovirus system (0.37 microg/10(6) cells and 31.2 ng/10(6) cells/h) and transformed CHO cells (0.88 microg/10(6) cells and 7.8 ng/10(6) cells/h). Deletion of the GPI cleavage/attachment site resulted in an eightfold increase in the secretion rate of p97, when compared to the intact construct suggesting that the rate-limiting step involves processing of the GPI anchor.

Characterization and structure of the mitochondrial small rRNA gene of the entomopathogenic fungus Beauveria bassiana.

The entire mitochondrial (mt) small ribosomal RNA (srRNA) gene from the entomopathogenic fungus Beauveria bassiana was sequenced. Alignment of the sequence to those of other filamentous fungi revealed gross length differences in their respective products. Construction of a secondary structural model showed that these differences were restricted to known variable srRNA subdomains. Several features were identified that were common only to the hyphomycetous fungi examined. Phylogenetic analysis indicated that the anamorph B. bassiana was more closely related to the pyrenomycete than to the plectomycete ascomycetous fungi. Based on our previous comparison of mt gene arrangement in filamentous fungi, this was unexpected. The possibility that the smaller mt genomes reflect the ancestral arrangement of genes is discussed.

A series of broad host range shuttle vectors for constitutive and inducible expression of heterologous proteins in insect cell lines.

A series of shuttle vectors have been constructed that allow expression of heterologous proteins in either dipteran or lepidopteran insect cell lines. Constitutive expression in a broad range of host cells is mediated by the Orgyia pseudotsugata multicapsid nucleopolyhedrosis virus (OpMNPV) immediate-early 2 (ie2) promoter. Alternatively, if inducible expression is required, for example to express cytotoxic proteins, a vector has been constructed that uses the Drosophila metallothionein (Mtn) promoter for metal-inducible protein expression in dipteran cell lines. A chimeric synthetic bacterial-OpMNPV ie promoter-Zeocin resistance gene cassette has been included to facilitate cloning in E. coli as well as the generation of stably transformed insect cell lines. The utility of the system is demonstrated by the constitutive and inducible expression of the highly processed glycosylphosphatidylinositol-anchored glycoprotein, human melanotransferrin, in transformed insect cell lines.

Baculovirus immediate-early promoter-mediated expression of the Zeocin resistance gene for use as a dominant selectable marker in dipteran and lepidopteran insect cell lines.

The antibiotic Zeocin, a derivative of phleomycin, was evaluated for use as a selection system in both dipteran and lepidopteran insect cell lines. Growth of Drosophila cell lines, Kc1 and SL2, was inhibited at Zeocin concentrations of 50 and 75 microg/ml, respectively, while the Spodoptera cell line, Sf9, was inhibited at a concentration of 250 microg/ml Zeocin. The mammalian cytomegalovirus (CMV) and Simian virus 40 (SV40) early promoters did not function in these insect cell lines. Several baculovirus-derived immediate-early (IE) promoters from the Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV) and Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV) were used to drive expression of the Zeocin resistance gene (ble) in these cell lines. The resulting plasmid vectors enabled selection of Zeocin-resistant cell lines within 3-4 weeks. Gene amplification events in the presence of increasing Zeocin concentrations were not detected using Southern blot analysis. Furthermore, the function of the baculovirus IE promoters, as demonstrated by beta-galactosidase expression, was not detectable in a variety of mammalian cell lines tested. A cloning/shuttle vector, containing ten unique restriction sites, was constructed which allows for selection of Zeocin resistance in insect cell lines and in Escherichia coli.

Identification and differentiation of the entomopathogenic fungus Beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis.

A series of genomic DNA probes which exhibit specificity for Beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal DNA (Hegedus and Khachatourians, 1993a). To improve the sensitivity of a DNA-based monitoring system for detection of this entomopathogenic fungus we have developed a PCR-based method. Using sequence information from a region of the B. bassiana-specific probe pBb22, primers P1 (5'AAGCTTCGACATGGTCTG) AND P3 (5GGAGGTGGTGAGGTTCTGTT) were generated. This primer set amplified similar-sized products from several B. Bassiana isolates, Beauveria brongniartii, Beauveria caledonica, and B. densa, but not Tolypocladium nivea, Tolypocladium cylindrospora, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus or migratory grasshoppers and locusts. Hybridization with the probe indicated the presence of DNA homology between the products. Restriction enzyme analysis of the PCR products, however, showed that sequence heterogeneity existed which was confirmed by partial sequencing of the products. Another primer, P5 (5AGGAGAGAGCTCGACGGTCA), was developed to exploit the sequence variations. When the P1-P5 primer set was used, a product was amplified from most B. bassiana isolates, including two which failed to amplify with the P1-P3 set. This amplification was not observed with the other Beauveria species tested. The nature of the sequence variations within the P1-P3 PCR-amplified region suggests the placement of B. densa and B. caledonica outside the species B. bassiana, confirming previous evidence with mitochondrial DNA and DNA probes. PCR with the P1-P3 and P1-P5 primer sets was used to discriminate isolates of B. bassiana found to be infecting a population of the migratory grasshopper, Melanoplus sanguinipes, collected in Saskatchewan. The PCR products derived from the P1-P3 primer set with the various Beauveria spp. could be differentiated by single-strand conformation polymorphisms (SSCP). Thus, analysis of PCR products using restriction enzymes, sequencing, or SSCPs allows positive differentiation of a particular B. bassiana isolate from others. The great sensitivity of these techniques should help the release and monitoring of entomopathogenic fungi in the environment.

The impact of biotechnology on hyphomycetous fungal insect biocontrol agents.

The potential for the control of insect pests by entomopathogenic fungi has been touted for decades, if not centuries. Only recently have advances in biotechnology provided the tools for indepth analysis of the mechanisms involved in pathogenesis and host death at the molecular level. This review outlines the current state of knowledge regarding the mode of infection and targets several key components that are amenable to improvement via biotechnology. Realization of the considerable economic potential of fungal bioinsecticides can occur only through a combined and coordinated effort involving fundamental science, formulation technology and field applications.

Identification of Molecular Variants in Mitochondrial DNAs of Members of the Genera Beauveria, Verticillium, Paecilomyces, Tolypocladium, and Metarhizium.

A set of five mitochondrial (mt) probes derived from a strain of Beauveria bassiana was used to evaluate the similarity of mtDNAs from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. The probes and genes encoded for (shown in parentheses) were pBbmtE2 (NADI, ATP6), pBbmtE3 (ATP6, small rRNA [srRNA]), pBbmtE4 (srRNA, CO3, NAD6), pBbSE1 (NAD6, tRNA, large rRNA [lrRNA]), and pBbXS1 (lrRNA). The probes produced identical hybridization patterns in EcoRI-digested DNA from nearly all isolates of B. bassiana and Beauveria caledonica. Similar patterns were also observed with Beauveria densa. The isolates of B. caledonica and B. densa DNAs could be differentiated from each other and from B. bassiana on the basis of a HindIII digestion and probing with pBbmtE3. Probe pBbmtE2 produced either a 5.0-kb or a 4.1-kb band in all of the B. bassiana isolates. This observation was used to categorize the mtDNA of B. bassiana into two types, designated A and B. Hybridization of the five probes produced distinct banding patterns in Beauveria brongniartii, Tolypocladium cylindrosporum, Tolypocladium nivea, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus. Hybridizations carried out with multiple probes simultaneously present produced unique patterns which characterized the B. bassiana group from all other fungi tested. These results are discussed in terms of how mtDNA polymorphisms in B. bassiana may relate to natural population structures, mt transmission in deuteromycetes, and the use of mtDNA polymorphisms in structural analysis of mtDNA.

The mitochondrial genome of the entomopathogenic fungus Beauveria bassiana: analysis of the ribosomal RNA region.

The 28.5-kbp mitochondrial (mt) genome from the entomopathogenic fungus Beauveria bassiana was studied using restriction enzyme analysis, gene probe hybridization, and DNA sequence comparisons. A detailed restriction enzyme map allowed cloning of the entire genome into a number of segments. Hybridization of heterologous gene probes to the mtDNA resulted in the identification of the large ribosomal RNA (lrRNA) and small ribosomal RNA (srRNA) genes. Gene probes derived from several yeasts and fungi failed to identify any additional genes. However, partial DNA sequence analysis revealed the lrRNA and srRNA genes as well as four protein-encoding genes: the NADH dehydrogenase subunit 1 (NAD1), NADH dehydrogenase subunit 6 (NAD6), cytochrome oxidase subunit 3 (CO3), and ATPase subunit 6 (ATP6) genes. The ATPase subunit 9 (ATP9) gene was not identified by hybridization to mtDNA, but could be detected by hybridization to total cellular DNA. The portions of the genes sequenced were homologous to the equivalent genes from yeast and other filamentous fungi, most notably Aspergillus nidulans. No introns were identified in these regions. The organization of the sequenced region of the B. bassiana mt genome more closely resembled that of A. nidulans than that of Podospora anserina or Neurospora crassa.

Cloning and analysis of five mitochondrial tRNA-encoding genes from the fungus Beauveria bassiana.

Five mitochondrial (mt) tRNA genes from the filamentous fungus, Beauveria bassiana, were cloned and sequenced. The genes encoding the Val-, Ile-, Ser-, Trp- and Pro-accepting tRNAs were found clustered in the region 5' to the lrRNA-encoding gene. The genes were 64-77% homologous with the equivalent genes from other filamentous fungi, 49-58% to yeasts with the exception of the Val-accepting tRNA-encoding gene which was 76%, and only slightly homologous with Escherichia coli. The B. bassiana mt genetic code was found to be similar to that of other fungal mitochondria in that the UGA codon is used as a signal for Trp rather than as a stop codon. Transcript analysis has revealed that the genes present in tRNA cluster are transcribed and processed into tRNA-size products. Secondary structure models proposed for the gene products show that conservation of tRNA secondary structure also exists. The presence of a GGC sequence rather than a GGU sequence in the D-loop of the tRNA(Trp)-encoding gene is a feature unique to the B. bassiana mt tRNA. An unconventional G-A base pair present in the D-stem of the tRNA(Ser)-encoding gene is a feature conserved in the mt tRNA of other filamentous fungi. Comparison of the B. bassiana tRNA-encoding genes with those of two other filamentous fungi and two yeasts revealed that the differences between closely related species favoured transition-type mutations.