Assuntos
Clonagem Molecular , Genes , Receptores Colinérgicos/genética , Animais , Sequência de Bases , DNA/metabolismo , Enzimas de Restrição do DNA , Órgão Elétrico/metabolismo , Substâncias Macromoleculares , Peso Molecular , Hibridização de Ácido Nucleico , Poli A/genética , RNA/genética , RNA Mensageiro , TorpedoRESUMO
The entire set of six closely related Drosophila actin genes was isolated using recombinant DNA methodology, and the structures of the respective coding regions were characterized by gene mapping techniques and by nucleotide sequencing of selected portions. Structural comparisons of these genes have resulted in several unexpected findings. Most striking is the nonconservation of the positions of intervening sequences within the protein-encoding regions of these genes. One of the Drosophila actin genes, DmA4, is split within a glycine codon at position 13; none of the remaining five genes is interrupted in the analogous position. Another gene, DmA6, is split within a glycine codon at position 307; at least two of the Drosophila actin genes are not split in the analogous position. Additionally, none of the Drosophila actin genes is split within codon four, where the yeast actin gene is interrupted. The six Drosophila actin genes encode several different proteins, but the amino acid sequence of each is similar to that of vertebrate cytoplasmic actins. None of the genes encodes a protein comparable in primary sequence to vertebrate skeletal muscle actin. Surprisingly, in each of these derived actin amino acid sequences in the initiator methionine is directly followed by a cysteine residue, which in turn precedes the string of three acidic amino acids characteristic of the amino termini of mature vertebrate cytoplasmic actins. We discuss these findings in the context of actin gene evolution and function.
Assuntos
Actinas/genética , Clonagem Molecular , Drosophila/genética , Genes , Sequência de Aminoácidos , Animais , Sequência de Bases , Enzimas de Restrição do DNA , DNA Recombinante/metabolismo , Código Genético , Microscopia Eletrônica , Conformação de Ácido Nucleico , Ácidos Nucleicos Heteroduplexes , Hibridização de Ácido Nucleico , Fragmentos de Peptídeos/análise , Especificidade da Espécie , Tripsina , VertebradosRESUMO
One Drosophila melanogaster tRNAGly gene occurs on each 1.1-2.0 kb unit of a direct duplication at chromosomal region 56F. The nucleotide sequence of the gene and the 5' flanking region has been determined. The non-transcribed strand sequence of the tRNA gene is: 5' GCATCGGTGGTTCAGTGGTAGAATGCTCGCCTGCCACGCGGGCGGCCCGGGTTCGATTCCCGGCCGATGCA 3'. This nucleotide sequence is identical to that of the major glycine tRNA in Bombyx mori posterior silk gland. Within the 22 kb region mapped, additional tRNA genes are found, an observation consistent with reports that genes for other isoacceptors are present at this locus.
Assuntos
Drosophila melanogaster/genética , Genes , RNA de Transferência/genética , Animais , Sequência de Bases , Mapeamento Cromossômico , Enzimas de Restrição do DNA , DNA Recombinante , GlicinaRESUMO
A method is described for indirect electron microscopic visualization and mapping of tRNA and other short transcripts hybridized to DNA. This method depends upon the attachment of the electron-dense protein ferritin to the RNA, the binding being mediated by the remarkably strong association of the egg white protein avidin with biotin. Biotin is covalently attached to the 3' end of tRNA using an NH2(CH2)5NH2 bridge. The tRNA-biotin adduct is hybridized to complementary DNA sequences present in a single stranded non-homology loop of a DNA:DNA heteroduplex. Avidin, covalently crosslinked to ferritin, is mixed with the heteroduplex and becomes bound to the hybridized tRNA-biotin. Observation of the DNA:RNA-biotin:avidin-ferritin complex by electron microscopy specifically and accurately reveals the position of the tRNA gene, with a frequency of labeling of approximately 50%.
Assuntos
DNA Bacteriano/genética , Genes , RNA Bacteriano/genética , RNA de Transferência/genética , Avidina , Biotina , Fenômenos Químicos , Química , Mapeamento Cromossômico , Colífagos , Escherichia coli/genética , Ferritinas , Microscopia Eletrônica/métodosAssuntos
DNA , Herança Extracromossômica , Genes , Plasmídeos , RNA Ribossômico/biossíntese , Adenina/análise , Sequência de Bases , Cloranfenicol/farmacologia , Mapeamento Cromossômico , Cromossomos , DNA/análise , Enzimas de Restrição do DNA , DNA Recombinante , Drosophila melanogaster , Escherichia coli , Herança Extracromossômica/efeitos dos fármacos , Desnaturação de Ácido Nucleico , Hibridização de Ácido Nucleico , Plasmídeos/efeitos dos fármacos , Timina/análiseRESUMO
A new method for gene mapping at the chromosome level using in situ hybridization and scanning electron microscopy is described and has been applied to mapping the rRNA genes of Drosophila melanogaster. Biotin is covalently attached to Drosophila rRNA via a cytochrome c bridge at a ratio of one cytochrome-biotin per 130 nucleotides by a chemical procedure. Polymethacrylate spheres with a diameter of ca. 60 nm are prepared by emulsion polymerization and are covalently attached to the protein avidin at a ratio of 5-20 avidins per sphere. The biotin-labeled rRNA is hybridized to denatured DNA in a chromosome squash. Upon incubation with a sphere solution, some of the biotin sites become labeled with spheres because of the strong non-covalent interaction between biotin and avidin. The chromosome squash is examined in the scanning electron microscope (SEM). Polymer spheres, which are visible in the SEM, are observed to label the nucleolus, where the rRNA genes are located.
