Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 7 de 7
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Plant Dis ; 2024 May 29.
Artigo em Inglês | MEDLINE | ID: mdl-38812370

RESUMO

Since the emergence of Ug99 wheat stem rust in Uganda in 1998 (Pretorius et al. 2000), the threat of movement into South Asia has been a concern due to long-distance dispersal capacity of airborne spores (Brown and Hovmøller 2002; Singh et al. 2008; Meyer et al. 2017). Increased preparedness by comprehensive rust surveillance efforts and development and deployment of resistant cultivars in advance of an incursion into South Asia has been one of the success stories of the Borlaug Global Rust Initiative (Sharma et al. 2013). In November 2023, an off-season rust survey was conducted in Marpha, Gandaki and Bagmati provinces in Nepal. Rust was only observed at two sites, Dangdunge of Dolakha district and Mude of Sindhupalchok district, where spring wheat was grown as fodder crop outside the main cropping season. Rust infected wheat leaves (10-15 leaves per site) were air dried and sealed in envelopes that were shipped under permit to the Global Rust Reference Center, Denmark. Bulk samples of stem rust, Puccinia graminis f.sp. tritici (Pgt), were recovered from both envelopes, and single pustule isolates were raised and multiplied on Morocco and McNair. Meanwhile, specimens of dry leaves were subjected to SSR genotyping according to standard procedures (Patpour et al. 2022). One distinct multi-locus Pgt genotype was observed, identical to and representing 99% of Ug99 isolates within Clade I collected in East Africa between 2012-2022. A Pgt single pustule isolate from each of the sampling sites were inoculated onto 20 internationally agreed stem rust differential lines using standard procedures, and 14 supplementary lines providing additional resolution of pathogen virulence (Patpour et al. 2022). The pathotyping was repeated in two independent experiments, which resulted in the infection type pattern of Pgt race TTKTT (Supplementary Table 1). Additional independent SSR genotype assays of recovered isolates confirmed the prevalent genotype of Clade I (Patpour et al. 2022; Szabo et al. 2022). This first detection of Ug99 race TTKTT in South Asia emphasizes the need for continued coordinated international surveillance efforts and utilization of diverse sources of resistance to control stem rust in wheat. New surveillance efforts in Nepal during February-March 2024 did not reveal additional cases of wheat stem rust. However, more detailed and sustained rust surveillance efforts, assessment of the vulnerability of current wheat crops to Ug99 and other races of stem-, stripe/yellow- and leaf rust, as well as intensified breeding for rust resistance throughout the region is strongly recommended to meet current and future plant health risks.

2.
Plant Dis ; 2024 Mar 27.
Artigo em Inglês | MEDLINE | ID: mdl-38537139

RESUMO

Wheat yellow (stripe) rust, caused by Puccinia striiformis f. sp. tritici (Pst), is one of the most devastating diseases of wheat worldwide. Pst populations are composed of multiple genetic groups, each carrying one or more races characterized by different avirulence/virulence combinations. Since the severe epidemics in 2017, yellow rust has become the most economically important wheat foliar disease in Uruguay. A set of 124 Pst isolates collected from wheat fields in Uruguay between 2017 and 2021 were characterized phenotypically and 27 of those isolates were subsequently investigated in-depth by additional molecular genotyping and race phenotyping analyses. Three genetic groups were identified, i.e., PstS7, PstS10 and PstS13, the latter being the most prevalent. Two races previously reported in Europe, Warrior (PstS7) and Benchmark (PstS10), were detected in four and two isolates, respectively. A third race known as Triticale2015 (PstS13), first detected in Europe in 2015 and in Argentina in 2017, was detected at several locations. Additional virulence to Yr3, Yr17, Yr25, Yr27 or Yr32 was detected in three new race variants within PstS13. The identification of these new races, which have not been reported outside South America, provides strong evidence of the local evolution of virulence in Pst during the recent epidemic years.

3.
Front Plant Sci ; 15: 1306591, 2024.
Artigo em Inglês | MEDLINE | ID: mdl-38304738

RESUMO

Rye (Secale cereale L.) is an important cereal crop used for food, beverages, and feed, especially in North-Eastern Europe. While rye is generally more tolerant to biotic and abiotic stresses than other cereals, it still can be infected by several diseases, including scald caused by Rhynchosporium secalis. The aims of this study were to investigate the genetic architecture of scald resistance, to identify genetic markers associated with scald resistance, which could be used in breeding of hybrid rye and to develop a model for genomic prediction for scald resistance. Four datasets with records of scald resistance on a population of 251 hybrid winter rye lines grown in 2 years and at 3 locations were used for this study. Four genomic models were used to obtain variance components and heritabilities of scald resistance. All genomic models included additive genetic effects of the parental components of the hybrids and three of the models included additive-by-additive epistasis and/or dominance effects. All models showed moderate to high broad sense heritabilities in the range of 0.31 (SE 0.05) to 0.76 (0.02). The model without non-additive genetic effects and the model with dominance effects had moderate narrow sense heritabilities ranging from 0.24 (0.06) to 0.55 (0.08). None of the models detected significant non-additive genomic variances, likely due to a limited data size. A genome wide association study was conducted to identify markers associated with scald resistance in hybrid winter rye. In three datasets, the study identified a total of twelve markers as being significantly associated with scald resistance. Only one marker was associated with a major quantitative trait locus (QTL) influencing scald resistance. This marker explained 11-12% of the phenotypic variance in two locations. Evidence of genotype-by-environment interactions was found for scald resistance between one location and the other two locations, which suggested that scald resistance was influenced by different QTLs in different environments. Based on the results of the genomic prediction models and GWAS, scald resistance seems to be a quantitative trait controlled by many minor QTL and one major QTL, and to be influenced by genotype-by-environment interactions.

4.
Plant Dis ; 2022 Apr 25.
Artigo em Inglês | MEDLINE | ID: mdl-35467944

RESUMO

Wheat yellow (stripe) rust caused by Puccinia striiformis Westend. f. sp. tritici Eriks. (Pst) is an important disease worldwide (Chen 2005; Afzal et al., 2007; Hovmøller et al. 2011). In Latin America, the disease has been reported in Argentina, Bolivia, Chile, Colombia, Ecuador, Peru, Brazil, and Uruguay (van Beuningen and Kohli, 1986; German et al., 2007). The disease was observed for the first time in Paraguay at Capitán Miranda (Itapúa) (27°12'07.5888''S, 55°47'20.3640''W) in an environment with average minimum temperature below 10°C in July 2021 (coldest month). Symptoms were yellow rust pustules distributed linearly on the leaves of adult host plants (Fig. 1). Oval-shaped uredinia contained unicellular, yellow to orange, spherical urediniospores (28, 82 × 26, 83 µm), within the range reported by Rioux et al. (2015). Black telia produced yellow to orange teliospores (64, 12 × 15, 46 µm), which were within the range reported by Chen et al. (2014). All susceptible wheat cultivars had up to 100% disease severity. Ten- day-old seedlings of the susceptible cultivars were inoculated in a greenhouse using urediniospores collected from the field. Two weeks after inoculation, extensive sporulation was observed on the seedlings. For pathogen identification, DNA was extracted from wheat leaf segments containing urediniospores using the PureLink® Plant Total DNA Purification Kit (Invitrogen). PCR and sequencing were carried out by Macrogen (Korea), using the following species-specific primers: PSF (5`-GGATGTTGAGTGCTGCTGTAA-3`) / PSR (5`-TTGAGGTCTTAAGGTTAAAATTG-3`), which amplifies an internal transcribed spacer (ITS) region (Zhao et al. 2007); LidPs9 (TCGGTAAAACTGCACCAATACCT) / LidPs10 (TCCCAACAGTCCCCTTCTGT), which amplifies a fragment of the RNA polymerase II gene encoding the second largest subunit (rpb2); and LidPs11 (TTACGACATCTGCTTCCGCA) / LisPs12 (TGCGATGTCAACTCTGGGAC) and LidPs13 (TACGACATCTGCTTCCGCAC) / LidPs14 (GATTGCCCGGTATTGTTGGC), both pairs amplifying fragments of the ß-tubulin 1 gene (tub1) (Kuzdralinski et al. 2017). The sequences obtained were OM631935, OM638432, OM718000, and OM718001 and were aligned using the GenBank BLAST tool (https://blast.ncbi.nlm.nih.gov/Blast.cgi), obtaining a 100% match with the following sequences: KC677574.1, KY411522.1, KY411533.1, and KY411542.1, respectively. Yellow-rust-infected leaf samples were collected from a field trial and sent to the Global Rust Reference Center (GRRC), Denmark. Simple sequence repeat (SSR) genotyping of samples from two different cultivars exhibited the genetic lineage PstS13 (www.wheatrust.org), which had previously been detected in South America (Carmona et al., 2019), thereby confirming the first report of wheat yellow rust in Paraguay. Considering that the Paraguayan wheat germplasm is highly susceptible to yellow rust, further studies are required to monitor potential spread and establishment of yellow rust in Paraguay and to explore potential sources of resistance to prevent future epidemics.

5.
Genome Biol Evol ; 12(5): 597-617, 2020 05 01.
Artigo em Inglês | MEDLINE | ID: mdl-32271913

RESUMO

Stripe rust of wheat, caused by the obligate biotrophic fungus Puccinia striiformis f.sp. tritici, is a major threat to wheat production worldwide with an estimated yearly loss of US $1 billion. The recent advances in long-read sequencing technologies and tailored-assembly algorithms enabled us to disentangle the two haploid genomes of Pst. This provides us with haplotype-specific information at a whole-genome level. Exploiting this novel information, we perform whole-genome comparative genomics of two P. striiformis f.sp. tritici isolates with contrasting life histories. We compare one isolate of the old European lineage (PstS0), which has been asexual for over 50 years, and a Warrior isolate (PstS7 lineage) from a novel incursion into Europe in 2011 from a sexual population in the Himalayan region. This comparison provides evidence that long-term asexual evolution leads to genome expansion, accumulation of transposable elements, and increased heterozygosity at the single nucleotide, structural, and allele levels. At the whole-genome level, candidate effectors are not compartmentalized and do not exhibit reduced levels of synteny. Yet we were able to identify two subsets of candidate effector populations. About 70% of candidate effectors are invariant between the two isolates, whereas 30% are hypervariable. The latter might be involved in host adaptation on wheat and explain the different phenotypes of the two isolates. Overall, this detailed comparative analysis of two haplotype-aware assemblies of P. striiformis f.sp. tritici is the first step in understanding the evolution of dikaryotic rust fungi at a whole-genome level.


Assuntos
Evolução Molecular , Genoma Fúngico , Haplótipos , Doenças das Plantas/genética , Puccinia/genética , Puccinia/patogenicidade , Triticum/microbiologia , Proteínas Fúngicas/genética , Fenótipo , Doenças das Plantas/microbiologia
6.
Front Plant Sci ; 11: 570863, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-33552092

RESUMO

Wheat (Triticum aestivum L.) is one of the world's staple food crops and one of the most devastating foliar diseases attacking wheat is powdery mildew (PM). In Denmark only a few specific fungicides are available for controlling PM and the use of resistant cultivars is often recommended. In this study, two Chinese wheat landraces and two synthetic hexaploid wheat lines were used as donors for creating four multi-parental populations with a total of 717 individual lines to identify new PM resistance genetic variants. These lines and the nine parental lines (including the elite cultivars used to create the populations) were genotyped using a 20 K Illumina SNP chip, which resulted in 8,902 segregating single nucleotide polymorphisms for assessment of the population structure and whole genome association study. The largest genetic difference among the lines was between the donors and the elite cultivars, the second largest genetic difference was between the different donors; a difference that was also reflected in differences between the four multi-parental populations. The 726 lines were phenotyped for PM resistance in 2017 and 2018. A high PM disease pressure was observed in both seasons, with severities ranging from 0 to >50%. Whole genome association studies for genetic variation in PM resistance in the populations revealed significant markers mapped to either chromosome 2A, B, or D in each of the four populations. However, linkage disequilibrium between these putative quantitative trait loci (QTL) were all above 0.80, probably representing a single QTL. A combined analysis of all the populations confirmed this result and the most associated marker explained 42% of the variation in PM resistance. This study gives both knowledge about the resistance as well as molecular tools and plant material that can be utilised in marker-assisted selection. Additionally, the four populations produced in this study are highly suitable for association studies of other traits than PM resistance.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...