Protective Efficacy of BCG Vaccination in Calves Vaccinated at Different Ages.

Mycobacterium bovis, the causative agent of bovine tuberculosis (bTB), is a globally prevalent pathogen with significant animal welfare, economic and public health impacts. In the UK, the control of bTB relies on detection via tuberculin skin tests with ancillary interferon gamma (IFN-γ) release assays, followed by culling infected animals. Vaccination with Bacille Calmette-Guérin (BCG) could be an important element of bTB control, and a number of studies have demonstrated its protective efficacy, particularly when young calves are vaccinated. Here, we compared immune responses and the protective efficacy of BCG in calves vaccinated within the first day of life and at three weeks of age. Significant protection from M. bovis infection was observed in BCG-vaccinated calves compared to non-vaccinated, age-matched controls. No significant differences were shown between calves vaccinated at one day and at three weeks of age when assessing the protective efficacy of BCG (measured as a reduction in lesions and bacterial burden). Antigen-specific IFN-γ levels were similar between the BCG-vaccinated groups, but significantly different from the non-vaccinated control animals. Antigen-specific IFN-γ expression post-BCG vaccination was correlated significantly with protection from M. bovis infection, whereas IFN-γ levels post-challenge correlated with pathology and bacterial burden. These results indicate that early-life vaccination with BCG could have a significant impact on M. bovis infection and, therefore, bTB incidence, and they demonstrate that age, at least within the first month of life, does not significantly impact the protective effect of vaccination.

CD205 antigen targeting combined with dendritic cell recruitment factors and antigen-linked CD40L activation primes and expands significant antigen-specific antibody and CD4(+) T cell responses following DNA vaccination of outbred animals.

Dendritic cell antigen targeting primes robust immune responses in mouse models. Optimizing this immunization strategy in the actual hosts that require protection will advance development of efficacious contemporary vaccines. In a proof-of-concept study, we tested the immunogenicity of a single, low dose of a novel multi-component DNA construct expressing a CD205-targeted antigen fused to a CD40L minimal functional domain for linked DC activation. The DNA construct was formulated with DNA-encoded Flt3L and GM-CSF for DC recruitment and the formulation was evaluated in MHC class II-matched calves. Immunization of the calves with the CD205 antigen-targeting construct mixed with the cytokine constructs induced significant IFN-γ-secreting CD4(+) T-cells, CD4(+) T-cell proliferation, and antibody responses detectable within one week post-immunization. CD205 antigen-targeting significantly expanded IFN-γ-secreting CD4(+) T-cells, CD4(+) T-cell proliferation, and IgG antibody responses three weeks post-immunization. Nineteen weeks post-priming, the IFN-γ-secreting CD4(+) T-cells, CD4(+) T-cell proliferation, and the IgG titers were waning, but they remained significant. Following boosting at nineteen weeks post-immunization, the immune responses primed by the CD205-targeted antigen underwent rapid recall and the mean response tripled within one week post-boost. Comparative analysis of the immune responses observed one week post-priming versus the responses detected one week post-boost revealed that the average number of the IFN-γ-secreting CD4(+) T-cells observed in the calves immunized with the CD205 antigen targeting construct increased five-fold, the mean CD4(+) T-cell proliferation increased three-fold, whereas the mean IgG antibody titer increased two hundred-fold. These promising outcomes support testing the protective efficacy of CD205-targeted antigens in the calf model.

Natural killer cell number and phenotype in bovine peripheral blood is influenced by age.

Natural killer (NK) cells are critical to the innate defence against intracellular infection. High NK cell frequencies have been detected in human neonates, which may compensate for the relative immaturity of the specific immune response. Additionally, phenotypic subsets of NK cells have been identified in humans with different functional properties. In this study, we examined the age distribution and phenotype of NK populations in bovine peripheral blood, including neonatal animals. We found that the NK cell populations defined by the phenotypes CD3(-)CD2(+) and NKp46(+) largely overlapped, so that the majority of NK cells in bovine peripheral blood were CD3(-)CD2(+)NKp46(+). The remainder of the NK-like cells comprised two minor populations, CD3(-)CD2(+)NKp46(-) and CD3(-)CD2(-)NKp46(+); the relative proportions of these varied with age. The lowest frequency of NK cells was recorded in 1-day-old calves, with the highest frequency in day 0 calves. The phenotypic characteristics of CD3(-)CD2(+) and NKp46(+) NK populations were similar; both populations expressed CD45RO, CD45RB, CD11b, CC84, CD8alphaalpha and CD8alphabeta and did not express CD21, WC1, CD14 or gammadelta TCR. Age-related phenotypic differences were apparent. The phenotypic characteristics of three NK subpopulations were described; a significantly greater proportion of the CD3(-)CD2(-)NKp46(+) population expressed CD8alpha compared to CD3(-)CD2(+)NKp46(+) cells. Furthermore, a significantly greater proportion of the CD3(-)CD2(+)NKp46(-) population expressed CD8 compared to total CD3(-)CD2(+) cells. Adult cattle had a significantly higher proportion of perforin(+) cells compared to calves aged

The calf model of immunity for development of a vaccine against tuberculosis.

Tuberculosis (TB) remains a major threat to public health. The identification of safe TB vaccine candidates beyond Mycobacterium bovis BCG, is an exciting prospect for control of human TB and necessary in the context of the human immunodeficiency virus (HIV) pandemic. Selection of vaccine candidates for human trials which are ultimately targeted for use in children less than 5 years of age or in newborns will require an animal model that closely approximates immune function and disease. We propose that the bovine neonate and adolescent is a robust animal model for preclinical safety and efficacy evaluation of TB candidate vaccines targeting this special human population. Parallel studies conducted in bovine neonates and non-human primates with a leading auxotrophic mutant with demonstrated efficacy/safety in a rodent TB model of TB demonstrated similar findings with respect to gross pathology scoring relative to BCG. The findings indicated more numerous and severe lesions in the lung in addition to higher levels of IFN-gamma producing cells. BCG vaccinates demonstrated higher levels of FoxP3 transcripts and lower levels of IL-4 mRNA.

Characterisation of bovine inducible nitric oxide synthase.

Inducible nitric oxide (iNOS) is an enzyme that catalyzes the production of the reactive nitrogen intermediate nitric oxide (NO). NO is an important signalling molecule, released by numerous cells, that acts in many tissues to regulate a diverse range of physiological and biological processes, including neurotransmission, immune defence and the regulation of cell death (apoptosis). NO plays a major role in the killing of intracellular pathogens as part of the innate immune response. iNOS is known to be induced by a number of stimuli including cytokines as well as pathogens and their components. As yet, a full-length bovine iNOS sequence has only been predicted from the genome, although partial sequences from cDNA are available. Here, we have identified a 3471bp transcript for bovine iNOS, isolated from RNA from bovine alveolar macrophages stimulated with the intracellular pathogen Mycobacterium bovis. When translated this gives a protein of 1156 amino acids. Bovine iNOS shows a high degree of similarity to iNOS from other species, and also shares a common protein domain structure.

DNA vaccine construct incorporating intercellular trafficking and intracellular targeting motifs effectively primes and induces memory B- and T-cell responses in outbred animals.

We developed a vaccine construct in which a BVP22 domain and an invariant-chain major histocompatibility complex class II-targeting motif capable of enhancing dendritic cell antigen uptake and presentation were fused to a sequence encoding a B- and T-cell antigen from the Anaplasma marginale major surface protein 1a and tested whether this construct would prime and expand immune responses in outbred calves. A single inoculation with this construct effectively primed the immune responses, as demonstrated by a significant enhancement of CD4(+) T-cell proliferation compared to that in calves identically inoculated but inoculated with a DNA construct lacking the targeting domains and compared to that in calves inoculated with an empty vector. These proliferative responses were mirrored by priming and expansion of gamma interferon-positive CD4(+) T cells and immunoglobulin G responses against the linked B-cell epitope. Priming by the single immunization induced memory that underwent rapid recall following reexposure to the antigen. These results demonstrate that DNA vaccines targeting key intercellular and intracellular events significantly enhance priming and expansion and support the feasibility of single-dose DNA immunization in outbred populations.

A vitellogenic-like carboxypeptidase expressed by human macrophages is localized in endoplasmic reticulum and membrane ruffles.

Carboxypeptidase, vitellogenic-like (CPVL) is a serine carboxypeptidase of unknown function that was first characterized in human macrophages. Initial studies suggested that CPVL is largely restricted to the monocytic lineage, although it may also be expressed by cells outside the immune system. Here, we use a new monoclonal antibody to characterize the properties and localization of CPVL in human macrophages to elucidate a possible function for the protease. CPVL is up-regulated during the maturation of monocytes (MO) to macrophages, although the protein can be seen in both. In primary macrophages, CPVL is glycosylated with high mannose residues and colocalizes with markers for endoplasmic reticulum, while in MO it is more disperse and less clearly associated with endoplasmic reticulum. CPVL is highly expressed in lamellipodia and membrane ruffles, which also concentrate markers of the secretory pathway (MIP-1alpha and tumour necrosis factor-alpha) and major histocompatibility complex (MHC) class I and II molecules. CPVL can be seen on early latex bead and Candida albicans phagosomes, but it is not retained in the maturing phagosome, unlike MHC class I/II. CPVL has a mixed cytosolic and membrane-associated localization but is not detectable on the outer plasma membrane. We propose that CPVL may be involved in antigen processing, the secretory pathway and/or in actin remodelling and lamellipodium formation.

Isolation and purification of afferent lymph dendritic cells that drain the skin of cattle.

Dendritic cells (DCs) are central to the induction of immune responses and are a pivotal control point that determines the outcome of infectious challenge. Cannulation of afferent lymphatic vessels allows the isolation of large numbers of lymph DCs. First, lymph nodes that are draining the skin are surgically removed (takes approximately 1 h). Over a period of 6-8 weeks, afferent lymphatic vessels re-anastomose with the efferent duct, forming larger 'pseudoafferent' lymphatic vessels that can be surgically cannulated. Surgical cannulation takes 2 h to perform; daily maintenance of the catheter requires 30 min. Isolation of lymph cells requires 1 h and an additional 60-180 min to enrich or purify the DCs. The lymph can be harvested for up to 1 month, with relatively constant cell numbers and subset distribution throughout this period. This technique, although technically demanding, facilitates studies of DCs and other cells that traffic in the lymph in both the steady state and following antigenic exposure.

Rapid and long-term disappearance of CD4+ T lymphocyte responses specific for Anaplasma marginale major surface protein-2 (MSP2) in MSP2 vaccinates following challenge with live A. marginale.

In humans and ruminants infected with Anaplasma, the major surface protein 2 (MSP2) is immunodominant. Numerous CD4(+) T cell epitopes in the hypervariable and conserved regions of MSP2 contribute to this immunodominance. Antigenic variation in MSP2 occurs throughout acute and persistent infection, and sequentially emerging variants are thought to be controlled by variant-specific Ab. This study tested the hypothesis that challenge of cattle with Anaplasma marginale expressing MSP2 variants to which the animals had been immunized, would stimulate variant epitope-specific recall CD4(+) T cell and IgG responses and organism clearance. MSP2-specific T lymphocyte responses, determined by IFN-gamma ELISPOT and proliferation assays, were strong before and for 3 wk postchallenge. Surprisingly, these responses became undetectable by the peak of rickettsemia, composed predominantly of organisms expressing the same MSP2 variants used for immunization. Immune responsiveness remained insignificant during subsequent persistent A. marginale infection up to 1 year. The suppressed response was specific for A. marginale, as responses to Clostridium vaccine Ag were consistently observed. CD4(+)CD25(+) T cells and cytokines IL-10 and TGF-beta1 did not increase after challenge. Furthermore, a suppressive effect of nonresponding cells was not observed. Lymphocyte proliferation and viability were lost in vitro in the presence of physiologically relevant numbers of A. marginale organisms. These results suggest that loss of memory T cell responses following A. marginale infection is due to a mechanism other than induction of T regulatory cells, such as peripheral deletion of MSP2-specific T cells.

Anaplasma marginale major surface protein 2 CD4+-T-cell epitopes are evenly distributed in conserved and hypervariable regions (HVR), whereas linear B-cell epitopes are predominantly located in the HVR.

Organisms in the genus Anaplasma express an immunodominant major surface protein 2 (MSP2), composed of a central hypervariable region (HVR) flanked by highly conserved regions. Throughout Anaplasma marginale infection, recombination results in the sequential appearance of novel MSP2 variants and subsequent control of rickettsemia by the immune response, leading to persistent infection. To determine whether immune evasion and selection for variant organisms is associated with a predominant response against HVR epitopes, T-cell and linear B-cell epitopes were localized by measuring peripheral blood gamma interferon-secreting cells, proliferation, and antibody binding to 27 overlapping peptides spanning MSP2 in 16 cattle. Similar numbers of MSP2-specific CD4(+) T-cell epitopes eliciting responses of similar magnitude were found in conserved and hypervariable regions. T-cell epitope clusters recognized by the majority of animals were identified in the HVR (amino acids [aa] 171 to 229) and conserved regions (aa 101 to 170 and 272 to 361). In contrast, linear B-cell epitopes were concentrated in the HVR, residing within hydrophilic sequences. The pattern of recognition of epitope clusters by T cells and of HVR epitopes by B cells is consistent with the influence of protein structure on epitope recognition.

Differential production of cytokines, reactive oxygen and nitrogen by bovine macrophages and dendritic cells stimulated with Toll-like receptor agonists.

Toll-like receptors (TLR) have been described as partially sharing signalling pathways but showing unique ligand specificity and tissue distribution. Here, the response of bovine macrophages (Mphi) and dendritic cells (DC), both derived from monocytes, was compared by exposing them to the TLR-specific ligands lipopolysaccharide, poly(I:C)-double-stranded RNA, and CpG-DNA, as well as inactivated Gram-negative and Gram-positive bacteria, shown to bind to TLR. The production of NO, superoxide anion, interleukin-10 (IL-10), IL-12 and tumour necrosis factor (TNF) was determined. Compared to monocytes, Mphi expressed more TLR2 and similar levels of TLR4 mRNA transcripts, as analysed by quantitative polymerase chain reaction, whereas DC expressed reduced amounts. Although both DC and Mphi recognized the TLR ligands, dramatic differences were seen in their reaction pattern to them. Both cell types responded with the production of TNF, but DC produced more IL-12, whereas Mphi produced more IL-10, regardless of the TLR agonist used. Co-stimulation with interferon-gamma influenced the amount of cytokine production, but did not alter the cell type-specific response pattern. Compared to Mphi, DC produced > 10 times less NO upon triggering with TLR ligands. In addition, DC produced superoxide anion to opsonized and non-opsonized zymosan, but not to phorbol 12-myristate 13-acetate, a response pattern confirmed for human Mphi and DC, respectively. Different protein kinase C isoforms and extracellular signal-regulated kinase patterns were detected in cell lysates of resting and stimulated Mphi and DC. Collectively, our results point to profound differences in pathogen-derived signal-response coupling occurring commensurate with distinct functions carried out by Mphi or DC.

Maturation of bovine dendritic cells by lipopeptides.

The response of DC, and the subsequent stimulation of T cells, is an essential part of the initiation of immune responses following microbial challenge. The response of human DC to bacterial lipopeptides is mediated by toll-like receptor 2, and is characterised by DC maturation and the enhanced capacity to stimulate of T cells. We report here that bovine DC are also induced to mature following lipopeptide stimulation. Exposure of DC to the model lipopeptide Pam3CSK4 was associated with increased expression of MHC, costimulatory molecules, and enhanced secretion of IL-12 and TNFalpha. Lipopeptide-matured DC were superior in their ability to induce T cell activation and IFNgamma secretion. In contrast, exposure of MPhi to lipopeptides induced down-regulation of MHC expression and much lower increases in IL-12 secretion. A lipopeptide derived from the sequence of a relevant mycobacterial lipoprotein, MPB83, also influenced bovine DC by stimulating increases in IL-12 and TNFalpha secretion. These different changes in bovine DC and MPhi may have important implications for immune responses induced following bacterial infection with uptake of microbes by DC resulting in potentiation of their immunostimulatory capacity and uptake by MPhi having a much less marked effect on immune responses.

Differences in cytokine synthesis by the sub-populations of dendritic cells from afferent lymph.

Two phenotypically distinct subpopulations of dendritic cells (SIRPalpha+ CC81Ag- DC and SIRPalpha- CC81Ag+ DC) have previously been identified in bovine afferent lymph which show functional differences when assayed in vitro. The purpose of this study was to investigate whether differences in cytokine production between the two subpopulations might occur which could influence the bias of the immune response they stimulate. Qualitative and quantitative polymerase chain reactions were used to detect specific mRNA transcripts and flow cytometry and enzyme-linked immunosorbent assays were used to detect protein production. The SIRPalpha- CC81Ag+ DC produced considerably more interleukin-12 (IL-12) mRNA transcripts and protein than the SIRPalpha+ CC81Ag- DC. Conversely, SIRPalpha+ CC81Ag- DC contained more of both transcripts and protein for IL-1 and of transcripts for IL-6. A small percentage of both subpopulations produced interferon-gamma (IFN-gamma) as evidenced by cytoplasmic staining. Stimulation of DC by culture with CD40L+ cells increased the production of IL-1, IL-6 and IL-12 but quantitative differences between the subpopulations remained. Production of IL-10 was also evident following culture with CD40L+ cells or lipopolysaccharide primarily by the SIRPalpha+ CC81Ag- DC. No evidence was found for type 1 IFN production, and hence plasmacytoid DC, by DC in afferent lymph; both subpopulations appear to be myeloid in origin. These different cytokine repertoires of the two subpopulations of ex vivo DC isolated from afferent lymph imply functional differences that could influence the presentation of antigen to T cells and bias of the immune response following vaccination or infection.

CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum.

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.

Peripheral blood-derived bovine dendritic cells promote IgG1-restricted B cell responses in vitro.

Regulation of humoral responses involves multiple cell types including the requirements for cognate interactions between T and B cells to drive CD40-dependent responses to T-dependent antigens. A third cell type has also been shown to play an essential role, the dendritic cell (DC). We demonstrate that bovine peripheral blood-derived (PB)-DC are similar in function to features described for human interstitial DC including the production of signature type 2 cytokines [interleukin (IL)-13, IL-10]. PB-DC express moderate-to-high costimulatory molecule expression, and major histocompatibility complex class II is negative for CD14 expression and has low or no expression of CD11c. Consistent with the interstitial phenotype is the ability of PB-DC to influence B cell activation and differentiation via direct expression of CD40L and type 2 cytokines. Collectively, these results suggest that direct B cell-DC interactions may promote an immunoglobulin-isotype expression pattern consistent with type 2 responses, independent of direct T cell involvement.

A comparison of the anti-inflammatory and immuno-stimulatory activities of orf virus and ovine interleukin-10.

Orf virus causes pustular skin lesions (orf) in sheep, goats and humans. The virus encodes an interleukin-10 (orfvIL-10) that is identical in amino acid composition to ovine IL-10 (ovIL-10) over the C terminal two-thirds of the polypeptide, but not in the N terminal third. The immuno-suppressive and immuno-stimulatory activities of orfvIL-10 and ovIL-10 were compared. Both orfvIL-10 and ovIL-10 inhibited TNF-alpha and IL-8 cytokine production from stimulated ovine macrophages and keratinocytes and IFN-gamma and GM-CSF production from peripheral blood lymphocytes. OrfvIL-10 and ovIL-10 co-stimulated both ovine and murine mast cell proliferation in conjunction with IL-3 (ovine) or IL-4 (murine). Isoleucine at position 87 (Ile(87)) of the mature human IL-10 (huIL-10) has been reported as essential for the immuno-stimulatory activity of huIL-10. In spite of the differences in amino acids within the N-terminal third of orfvIL-10 compared with ovIL-10 and substitution of Ile(87) with Ala(87) in ovIL-10, these variants of ovIL-10 and orfvIL-10 all co-stimulated mast cell proliferation and inhibited macrophage IL-8 production. As ovIL-10 and orfvIL-10 have a similar structure to huIL-10 and conserved receptor-binding residues, it was concluded that Ile(87) is not essential for IL-10 immuno-stimulatory activity. Finally, ovine keratinocytes do not express ovIL-10. This might explain why orf virus has evolved a viral IL-10.

DNA-encoded fetal liver tyrosine kinase 3 ligand and granulocyte macrophage-colony-stimulating factor increase dendritic cell recruitment to the inoculation site and enhance antigen-specific CD4+ T cell responses induced by DNA vaccination of outbred animals.

DNA-based immunization is a contemporary strategy for developing vaccines to prevent infectious diseases in animals and humans. Translating the efficacy of DNA immunization demonstrated in murine models to the animal species that represent the actual populations to be protected remains a significant challenge. We tested two hypotheses directed at enhancing DNA vaccine efficacy in outbred animals. The first hypothesis, that DNA-encoding fetal liver tyrosine kinase 3 ligand (Flt3L) and GM-CSF increases dendritic cell (DC) recruitment to the immunization site, was tested by intradermal inoculation of calves with plasmid DNA encoding Flt3L and GM-CSF followed by quantitation of CD1(+) DC. Peak DC recruitment was detected at 10-15 days postinoculation and was significantly greater (p < 0.05) in calves in the treatment group as compared with control calves inoculated identically, but without Flt3L and GM-CSF. The second hypothesis, that DNA encoding Flt3L and GM-CSF enhances immunity to a DNA vector-expressed Ag, was tested by analyzing the CD4(+) T lymphocyte response to Anaplasma marginale major surface protein 1a (MSP1a). Calves immunized with DNA-expressing MSP1a developed strong CD4(+) T cell responses against A. marginale, MSP1a, and specific MHC class II DR-restricted MSP1a epitopes. Administration of DNA-encoding Flt3L and GM-CSF before MSP1a DNA vaccination significantly increased the population of Ag-specific effector/memory cells in PBMC and significantly enhanced MSP1a-specific CD4(+) T cell proliferation and IFN-gamma secretion as compared with MHC class II DR-matched calves vaccinated identically but without Flt3L and GM-CSF. These results support use of these growth factors in DNA vaccination and specifically indicate their applicability for vaccine testing in outbred animals.

Cytokine responses of bovine dendritic cells and T cells following exposure to live or inactivated bovine respiratory syncytial virus.

We compared the effects of live or inactivated bovine respiratory syncytial virus (BRSV) on cytokine production by bovine monocyte-derived dendritic cells (MoDC). We also investigated the response of resting memory CD4(+) T cells to MoDC exposed to both viral preparations. Although BRSV did not appear to replicate in MoDC or to affect expression of major histocompatibility complex (MHC) class I, MHC class II, or CD80/86, a higher percentage of cells exposed to live virus appeared to undergo apoptosis/necrosis. To investigate how the interaction of BRSV with MoDC affects the immune response, a multiplex, real-time, polymerase chain reaction was established to analyze transcription of bovine cytokines. Exposure of MoDC to live BRSV induced more interleukin (IL)-10 mRNA and markedly less IL-12p40 and IL-15 mRNA than did heat-inactivated virus. To determine whether these differences might influence the T cell response, CD4(+) memory T cells primed in vivo were restimulated in vitro by MoDC pulsed with heat-inactivated or live BRSV. Stimulation of CD4(+) T cells induced similar levels of IL-2-and IL-4-like activity and interferon-gamma. These observations suggest that while IL-10, produced by MoDC as a result of exposure to live BRSV, may affect IL-12 and IL-15 synthesis by MoDC, it does not appear to affect the cytokine response of BRSV-specific memory CD4(+) T cells. It is possible, however, that differences in the pattern of cytokines produced by MoDC exposed to live or inactivated virus may influence the development of the primary CD4(+) T cell response in vivo.

CD26 is expressed on a restricted subpopulation of dendritic cells in vivo.

Two major sub-populations of dendritic cells (DC) are present in afferent lymph draining the skin of cattle distinguished by expression of signal regulator protein alpha (SIRPalpha). The SIRPalpha(-) population expresses the uncharacterized bovine WC10 antigen (Ag). Initial N-terminal sequencing of the WC10 protein purified by affinity chromatography showed significant homology with human CD26. A cDNA encoding bovine CD26 was cloned and the recombinant molecule expressed in COS-7 cells. Transfectants abrogated the ability of macrophage-derived chemokine (MDC) to cause a calcium flux in bovine PBMC indicating enzymatic activity characteristic of CD26. They also stained with WC10 monoclonal antibody confirming that the Ag is CD26. This is the first description of CD26 expression by DC in vivo or in vitro. It is expressed on a sub-population of ex vivo DC in afferent lymph draining the skin and on sub-populations of DC isolated from prescapular and mesenteric lymph nodes draining the skin or intestine, respectively. CD26 is an exopeptidase with specificity for motifs within the receptor-binding domain of several chemokines including MDC. CD26 mediated truncation of MDC affects the Th cell response effected by the chemokine and may produce a Th1 bias. Transcripts for MDC were present in both CD26(+) and CD26(-) DC, thus CD26 mediated modification of MDC may bias the immune response induced in naive T cells by DC.