Effect of Local Annealing on Magnetic Flux Distribution and Noise in a Micro-Generator with Amorphous Shell.

This study examined micro-alternators with two different housing structures--an uncoated shell and a shell coated with an iron-based amorphous-alloy soft magnetic material. The electromagnetic power and noise characteristics of generators with these shell structures were measured and analyzed. The material used for the shell coating was the SA1 amorphous alloy. The magnetic property of the SA1 material was evaluated, including its hysteresis expansion, hysteresis-loop parameters, α-Fe crystal formation, thermogravimetric transfer, and Curie temperature. The center point of the casing was subjected to flame local-heating annealing to attain ferromagnetism and paramagnetism material characteristics. The experimental shell was between these magnetic-phase-transition properties and was used to observe the magnetic power and noise characteristics of the microgenerator. The measured magnetic flux at the center of the amorphous shell was 1.2-2.4 mT, and the magnetic flux distributed around the shell was 0.6-1.0 mT. The generator with the amorphous-alloy shell had the lowest demagnetization rate in the permanent magnet region, which was close to the bottom of the pole piece, and the magnetic flux leakage of the pole-piece side frame changed the magnetic flux path, thus affecting the demagnetization performance. For the noise experiment, the flame-annealing temperature of the local center point of the amorphous casing reached the Curie temperature, and the noise characteristics of the casing can be reduced by 15 dB compared to those of the generator without the casing. However, the overall performance of generator harmonics and power were not fully improved.

A randomized, double-blind, double-dummy, multicenter trial comparing the efficacy and safety of extended- and immediate-release levetiracetam in people with partial epilepsy.

PURPOSE: The aim of this trial was to compare the efficacy and safety of two formulations of levetiracetam in people with partial epilepsy over a 12-week treatment period. METHODS: We performed a randomized, paralleled, and multicenter trial that consisted of a 4-week single-blind placebo run-in, followed by a 12-week double-blind, double-dummy treatment phase to compare the efficacy and safety of levetiracetam extended-release (LEV-ER) and immediate-release (LEV-IR) tablets as an adjunctive treatment in adult patients with uncontrolled epilepsy. RESULTS: The median partial-onset seizure (POS) frequency per week (min-max) was 0.3 (0.0, 17.4; 95% confidence interval [95% CI] 1.3, 4.8) in the LEV-ER group and 0.3 (0.0, 31.4; 95% CI - 0.1, 4.3) in the LEV-IR group. No serious adverse events occurred during the trial period. Both groups had the same responder rate (58.6%), while a higher rate of seizure freedom over the treatment period was noted in the LEV-ER group compared with the LEV-IR group (27.6% vs. 13.8%, respectively). The European Quality of Life-5 Dimensions scores significantly increased in the LEV-ER-treated group, in contrast to the scores in the LEV-IR group, which decreased (7.2 vs. - 1.5, p = 0.03). CONCLUSION: These results suggest that LEV-ER is equivalent to LEV-IR in reducing the frequency of POS and has a similar tolerability as LEV-IR as an add-on therapy. In addition, LEV-ER treatment improved the health-related quality of life of people with uncontrolled partial epilepsy.

Nivolumab-induced myasthenia gravis in a patient with squamous cell lung carcinoma: Case report.

RATIONALE: Nivolumab (Nivo) is an immune checkpoint inhibitor that has been used to treat advanced melanoma, nonsmall cell lung carcinoma, and renal cell carcinoma since 2015. Nivo is associated with several side effects, including hepatitis, pneumonitis, acute renal failure, endocrine disorder, and other immune-related adverse events. Here, we describe the case of a 65-year-old man with squamous cell lung carcinoma who developed myasthenia gravis (MG) after a third Nivo infusion. PATIENT CONCERNS: A 65-year-old man with advanced squamous cell lung carcinoma developed ptosis, diplopia, drop head, and general weakness 5 days after a third Nivo infusion. DIAGNOSES, INTERVENTIONS, AND OUTCOMES: We diagnosed him with Nivo-related MG and myositis based on clinical symptoms, elevation of muscle enzymes, negativity for autoantibodies and exclusion of other diagnoses. Steroid treatment with methylprednisolone 1 mg/kg/d and pyridostigmine 60 mg twice a day was administered beginning at admission; however, the patient's condition progressively worsened, despite treatment. Respiratory failure developed 2 weeks after admission, and his family declined the use of a mechanical ventilator. The patient died on day 27 after the third Nivo infusion. LESSONS: Nivo-related MG should be highly suspected in patients who develop ptosis, diplopia, and general weakness. The corresponding treatments include discontinuation of Nivo and steroid treatment with plasmapheresis. The disease course may be rapid and fatal. This report stresses the importance of awareness of this rare and lethal adverse effect while using nivolomab immunotherapy.

Systemic embolic events with nonbacterial thrombotic endocarditis as manifestations of recurrent ovarian clear cell carcinoma.

OBJECTIVE: To present a rare case of recurrent ovarian clear cell carcinoma (OCCC) with systemic embolic events. CASE REPORT: A 60-year-old woman with a history of OCCC presented with an acute ischemic stroke. Magnetic resonance imaging showed multifocal, bilateral infarctions over the cerebrum and cerebellum. An echocardiogram revealed vegetation growth in the mitral and tricuspid valves and showed no evidence of atrial fibrillation. The serological studies for stroke were negative for all assessed parameters (normal values of protein C, protein S, antithrombin III, and lupus anticoagulant antibodies). Computed tomography of the abdomen and pelvis revealed bilateral renal and splenic infarctions, as well as enlarged pelvic lymph nodes due to a recurrent ovarian neoplasm. We diagnosed the patient with nonbacterial thrombotic endocarditis (NBTE) based on serial negative blood cultures and sterile vegetation of the surgical specimen. CONCLUSION: NBTE should be considered among the possible causes of multifocal embolic infarctions and as an early manifestation of recurrent OCCC. Anticoagulant therapy is the mainstay of treatment, and dual anticoagulation therapies are necessary to reduce the risk of recurrent thromboembolism.

Reversal of ophthalmic artery flow and stroke outcomes in Asian patients with acute ischemic stroke and unilateral severe cervical carotid stenosis.

BACKGROUND: The aim of this study was to assess the clinical implications of reversed ophthalmic artery flow (ROAF) for stroke risk and outcomes in subjects with unilateral severe cervical carotid stenosis/occlusion. METHODS: We investigated 128 subjects (101 with acute stroke and 27 without), selected from a large hospital patients base (n  =  14,701), identified with unilateral high-grade cervical carotid stenosis/occlusion by using duplex ultrasonography and brain magnetic resonance imaging. All clinical characteristics were compared for stroke risk between acute stroke and nonstroke groups. Patients with acute stroke were divided into 4 subgroups according to ophthalmic artery flow direction and intracranial stenosis severity, and stroke outcomes were evaluated. RESULTS: The acute stroke group had significantly higher percentages of ROAF (52.5%, p  =  0.003), carotid occlusion (33.7%, p  =  0.046), and severe intracranial stenosis (74.3%, p<0.001). However, multivariate analysis demonstrated that intracranial stenosis was the only significant risk factor (odds ratio  =  10.38; 95% confidence interval  =  3.64-29.65; p<0.001). Analysis of functional outcomes among the 4 subgroups of patients with stroke showed significant trends (p  =  0.018 to 0.001) for better stroke outcomes from ROAF and mild or no intracranial stenosis. ROAF improved 10-20% stroke outcomes, as compared to forward ophthalmic artery flow, among the patients with stroke and the same degree of severities of intracranial stenosis. CONCLUSIONS: Patients with acute stroke and severe unilateral cervical carotid stenosis/occlusion significantly have high incidence of intracranial stenosis and ROAF. Intracranial stenosis is a major stroke risk indicator as well as a predictor for worse stroke outcomes, and ROAF may provide partial compensation for improving stroke outcomes.

Homocysteine induces cerebral endothelial cell death by activating the acid sphingomyelinase ceramide pathway.

Homocysteine (Hcy) levels may rise after a stroke, but the mechanism of Hcy-induced cerebral endothelial cell (CEC) dysfunction has not been explored. In this study we examined the role of the acid sphingomyelinase (Asm)-ceramide pathway in the molecular mechanism of Hcy-induced CEC dysfunction. Murine CECs were prepared from fresh mouse brains. CECs were treated with 50-500 µM Hcy and 30-100 µM C2-ceramide for 48 h. Sphingomyelinase assays were performed to determine Asm activity. Quantitative assessments of cell survival and death by the MTT reduction and LDH release were conducted. Treatment of murine CECs with Hcy and ceramide caused cell death in a dose-dependent manner as determined by LDH and MTT assays. 250 µM Hcy and 50 µM C2-ceramide caused 50% cell death. Hcy induced murine CEC death also occurred in a time-dependant manner with substantial cell death noted as early as 24h after Hcy exposure. C2-ceramide-induced murine CEC death occurred earlier than Hcy-induced cell death by about 18h. Hcy treatment increased Asm activity and intracellular ceramide accumulation. This study demonstrated that Hcy and C2-ceramide can cause murine CEC death. Hcy induces CEC death possibly by activating the Asm-ceramide pathway.

PRRT2 mutations in paroxysmal kinesigenic dyskinesia with infantile convulsions in a Taiwanese cohort.

BACKGROUND: Mutations in the PRRT2 gene have recently been identified in patients with familial paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC) and patients with sporadic PKD/IC from several ethnic groups. To extend these recent genetic reports, we investigated the frequency and identities of PRRT2 mutations in a cohort of Taiwanese patients with PKD/IC. METHODOLOGY AND PRINCIPAL FINDINGS: We screened all 3 coding exons of PRRT2 for mutations in 28 Taiwanese patients with PKD/IC. Among them, 13 had familial PKD/IC and 15 were apparently sporadic cases. In total, 7 disparate mutations were identified in 13 patients, including 8 familial cases and 5 apparently sporadic cases. The mutations were not present in 500 healthy controls. Four mutations were novel. One patient had a missense mutation and all other patients carried PRRT2 mutations putatively resulting in a protein truncation. Haplotype analysis revealed that 5 of the 7 patients with the PRRT2 p.R217Pfs*8 mutation shared the same haplotype linked to the mutation. CONCLUSIONS AND SIGNIFICANCE: PRRT2 mutations account for 61.5% (8 out of 13) of familial PKD/IC and 33.3% (5 out of 15) of apparently sporadic PKD/IC in the Taiwanese cohort. Most patients with the PRRT2 p.R217Pfs*8 mutation in Taiwan likely descend from a single common ancestor. This study expands the spectrum of PKD/IC-associated PRRT2 mutations, highlights the pathogenic role of PRRT2 mutations in PKD/IC, and suggests genetic heterogeneity within idiopathic PKD.

Adult-onset of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome presenting as acute meningoencephalitis: a case report.

BACKGROUND: Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) syndrome is a rare mitochondrial disorder with a wide range of multisystemic symptoms. Epileptic seizures are common features of both MELAS and meningoencephalitis and are typically treated with anticonvulsants. OBJECTIVES: To provide the reader with a better understanding of MELAS and the adverse effects of valproic acid. CASE REPORT: A 47-year-old man with a history of diabetes, hearing loss, sinusitis, and otitis media was brought to our emergency department due to acute onset of fever, headache, generalized seizure, and agitation. Because acute meningoencephalitis was suspected, the patient was treated with antibiotics on an empirical basis. The seizure activity was aggravated by valproic acid and abated after its discontinuation. MELAS was suspected and the diagnosis was confirmed by the presence of a nucleotide 3243 A→G mutation in the mitochondrial DNA. CONCLUSION: Detailed history-taking and systematic review help emergency physicians differentiate MELAS from meningoencephalitis in patients with the common presentation of epileptic seizures. Use of valproic acid to treat epilepsy in patients suspected of having mitochondrial disease should be avoided. Underlying mitochondrial disease should be suspected if seizure activity worsens with valproic acid therapy.

Local intra-arterial thrombolysis with urokinase for acute ischemic stroke before and after the approval of intravenous tissue plasminogen activator treatment in Taiwan.

BACKGROUND: Local intra-arterial thrombolysis (LIT) has been previously suggested as an effective therapy for acute ischemic stroke. In this study, we describe our experience of using LIT for the treatment of Taiwanese patients with ischemic stroke at different vascular locations, before and after Alteplase was approved as a first-line treatment in Taiwan. The criteria required for the initiation of LIT have become more stringent after the approval of Alteplase (AA). METHODS: A retrospective analysis of medical records was conducted for 20 ischemic stroke patients treated with LIT; including 10 patients treated before and 10 patients treated after AA (we did not treat any of the patients in this study with AA). Urokinase was used for LIT treatment. Outcome measures included patient demographics, clinical characteristics, and clinical outcomes before and after LIT. Clinical outcomes were evaluated using four different stroke scales. RESULTS: The median National Institutes of Health stroke scale score (NIHSS) before treatment was reported to be 19.2 (range: 8-30). After AA, only one patient who had an occluded internal carotid artery (ICA) was treated with LIT. Among the 20 patients, 11 (55%) (five before AA and six after AA) reported having favorable or good clinical outcomes within 3 months of treatment, whereas five reported having poor outcomes (three before AA and two after AA), and the rest four patients died following treatment (two before AA and two after AA). Arterial recanalization was reported as complete in 10 patients (50%; seven middle cerebral artery [MCA] and three basilar artery; six before AA and four after AA), as incomplete in four patients (20%; one MCA and three basilar artery; one before AA and three after AA), and it failed in the remaining six patients (30%; two MCA and four ICA; three before AA and three after AA). Five patients (one MCA and four ICA) in whom recanalization had failed reported having poor outcomes, including one ICA patient who subsequently succumbed to the illness. Intracranial hemorrhagic and intraventricular hemorrhage transformation occurred in three and two patients, respectively. A case of intraventricular hemorrhage transformation after AA was also reported. CONCLUSION: On the basis of our experience, we found that LIT was of limited value in patients with ICA occlusion before AA approval. After AA, the outcomes in acute stroke patients, who were receiving urokinase therapy and who were carefully selected on the basis of the site of occlusion, were improved.

Micturitional headache in a young girl.

A 16-year-old girl came to our emergency department because of severe headache. For the past 3 years, she had presented at several emergency departments with a similar problem. When she was hospitalized for further investigation, she developed severe arterial hypertension for which an unusual cause was found by imaging of the abdomen.

Inherited protein C deficiency with acute ischemic stroke in a young adult: a case report.

Hereditary protein C deficiency is inherited primarily as an autosomal dominant trait with incomplete penetrance. Arterial thrombosis, especially of the intracranial arteries, due to this deficiency is relatively rare. A 31-year-old man was admitted to our department because of sudden onset of neurological symptoms. Magnetic resonance imaging of the brain disclosed an acute ischemic infarction of the area supplied by the left middle cerebral artery. Protein C antigen was 40.7% (77-129%) and protein C activity was 46.3% (70-140%). No other possible associated causes of stroke were present. A survey of his relatives for protein C deficiency showed this deficiency in his mother, brother, sister and nephews. Protein C concentrations should be determined in cases of ischemic stroke in all young patients with no other major risk factors. Once protein C deficiency is detected, a search for protein C deficiency in the patient's relatives should be performed to prevent the occurrence of ischemic strokes.

Diagnosis and development of screening items for migraine in neurological practice in Taiwan.

BACKGROUND/PURPOSE: The objectives of this study were to: (1) survey migraine diagnoses among neurological outpatients in Taiwan; (2) compare neurologists' migraine diagnoses with the International Classification of Headache Disorders 2nd Edition (ICHD-2) criteria; and (3) evaluate the diagnostic ability of screening items on a patient migraine questionnaire. METHODS: This prospective study surveyed patients who consulted neurologists for the first time with a chief complaint of headache, excluding those experiencing headaches for > or = 15 days/month. Each neurologist interviewed a maximum of 10 patients. Patients were asked to complete a self-administered questionnaire and their physicians completed another questionnaire. The physicians were asked if patients could be diagnosed with migraine. In addition, a diagnosis of ICHD-2 migraine was made by the physician's questionnaire through a computer-generated algorithm. In this study, migraine without aura (code 1.1) or migraine with aura (code 1.2) were designated as "strict migraine", and the combination of strict migraine and ICHD-2 probable migraine (code 1.6) as "any migraine". RESULTS: Among 755 patients who were eligible for analysis, 537 (71%) were diagnosed as having "any migraine", 363 (48%) with "strict migraine", and 451 (60%) with physician-diagnosed migraine. Among the 537 patients diagnosed as having "any migraine", 308 patients (57%) had not been diagnosed by any physician before. A moderate agreement (kappa statistic around 0.5) was found between the physicians' diagnoses and ICHD-2 "strict migraine" or "any migraine". In patients with ICHD-2 probable migraine (n = 174), only 52% were diagnosed with migraine by our physicians. Nausea was the best single item for predicting migraine diagnosis, while any combination of two items among nausea/vomiting, moderate or severe pain and photophobia, provided the optimum screening tool. CONCLUSION: Migraine was the most common headache diagnosis in the neurologists' clinics. Probable migraine was not completely adopted as a migraine spectrum among neurologists. In contrast to ID Migraine(TM), moderate or severe headache intensity replaced headache-related disability as one screening item for migraine in Taiwan.

Molecular bases of hearing loss in multi-systemic mitochondrial cytopathy.

PURPOSE: Hearing loss is a common clinical feature in classic mitochondrial syndromes. The purpose of this study was to evaluate the diverse molecular etiologies and natural history of hearing loss in multi-systemic mitochondrial cytopathies and the possible correlation between degree of hearing loss and neurological phenotype. METHODS: In this retrospective study we evaluated the clinical features and molecular bases of hearing loss associated with multi-systemic mitochondrial cytopathy. Forty-five patients with sensorineural hearing loss and definite diagnosis of mitochondrial cytopathy according to the published diagnostic criteria were studied. RESULTS: The sensorineural hearing loss was progressive and for the most part symmetrical with involvement of the higher frequencies. Both cochlear and retrocochlear involvement were found in this cohort. No correlation was found between the degree of hearing loss and the number and severity of neurological manifestations. Deleterious mtDNA point mutations of undisputed pathogenicity were identified in 18 patients. The A3243G mutation was the most frequently encountered among this group. MtDNA depletion, over-replication, and multiple deletions were found in further 11 cases. CONCLUSION: This study reveals an expanding spectrum of mtDNA abnormalities associated with hearing loss. No correlation was found between the degrees of hearing loss and the severity of neurological manifestations.

Sperm DNA damage correlates with polycyclic aromatic hydrocarbons biomarker in coke-oven workers.

OBJECTIVES: The aim was to determine whether occupational exposure to polycyclic aromatic hydrocarbons (PAHs) in men has adverse effect on semen quality. METHODS: Forty-eight coke-oven workers, including 16 topside-oven (TO) workers and 32 sideoven (SO) workers, were studied. Ambient PAHs exposure, urinary 1-hydroxypyrene (1-OHP) levels, and parameters of semen quality were determined. RESULTS: TO workers had significantly higher ambient PAHs exposure (3,436.1+/-3,411.0 vs. 1,123.1+/-1,829.3 ng/m3, P < 0.01), urinary 1-OHP levels (207.8+/-176.4 vs. 54.0+/-44.8 microg/g, P < 0.001), frequency of oligospermia (18.8 vs. 0%, P < 0.05), and morphological abnormality in sperm (32.3 vs. 14.6%, P < 0.01) than SO workers. Among cigarette smokers, TO workers had significantly higher rates of DNA denaturation in spermatozoa (alphaT) and percentage of sperm with increased DNA denaturation (COMP alphaT) levels than SO workers (246.2+/-49.5 vs. 198.1+/-30.3 for alphaT; 34.8+/-14.4 vs. 19.3+/-13.9% for COMP alphaT, P < 0.05). There was a positive correlation between urinary 1-OHP and alphaT, COMP alphaT, and abnormal sperm morphology and a tenfold increase in urinary 1-OHP associated with a 2.35-fold increase in alphaT, as well as a 1.07-fold increase in percentage of sperm with abnormal morphology. CONCLUSIONS: A potential risk of sperm dysfunction should be considered for workers occupationally exposed to high levels of PAHs. Cigarette smoking may aggravate this risk. Urinary 1-OHP can be used as a biomarker predicting sperm dysfunction.

Hearing loss in mitochondrial disorders.

Hearing loss is a common clinical feature in mitochondria-syndrome disorders. The underlining molecular etiology of hearing loss has not been fully investigated. In this study, 83 patients with mitochondrial syndromic hearing loss were evaluated clinically and their blood and tissue samples were examined molecularly. Using modified Walker's criteria, 31, 31, 14, and 7 patients had been classified as having definite, probable, possible, and unlikely diagnosis of mitochondrial disease, respectively. Deleterious mtDNA point mutations and/or abnormal mtDNA content or multiple deletions were identified in 20 patients with definite diagnosis and 2 patients with probable diagnosis. In addition to known, undisputed pathogenic mutations, several novel mutations believed to be clinically significant were found. Furthermore, abnormal mtDNA content and mtDNA deletions were found in some of the cases. Evaluation of clinical and diagnostic features associated with hearing loss revealed that cardiomyopathy, lactic acidosis, deficient respiratory chain enzyme complex activities, histochemical and ultrastructural abnormalities in mitochondria, and abnormal brain imaging results occurred significantly more frequently in patients with mtDNA alterations than in those without. This study revealed that the majority of the mtDNA defects in patients with mitochondrial syndromic hearing loss affect the overall mitochondrial gene expression.

Quantitative PCR analysis of mitochondrial DNA content in patients with mitochondrial disease.

Molecular diagnosis of mitochondrial DNA disorder is usually focused on point mutations and large deletions. In the absence of detectable mtDNA mutations, abnormal amounts of mtDNA, either depletion or elevation, can be indicative of mitochondrial dysfunction. The amount of mitochondrial DNA (mtDNA), however, varies among individuals of different ages and among different tissues within the same individual. To establish a range of mtDNA levels, we analyzed 300 muscle and 200 blood specimens from patients suspected of having a mitochondrial disorder by real-time quantitative polymerase chain reaction (PCR) method. Copy numbers were calculated from the standard curve and threshold cycle number using TaqMan probes; 6FAM 5'TTACCGGGCTCTGCCATCT3'-TAMRA and VIC-5'AGCAATAACAGGTCTGTGATG3'-TAMRA for mtDNA and 18S rRNA gene (nDNA), respectively. The copy number ratio of mtDNA to nDNA was used as a measure of mtDNA content in each specimen. The mtDNA content in muscle increases steadily from birth to about 5 years of age; thereafter, it stays about the same. On the contrary, the mtDNA content in blood decreases with age. The amount of mtDNA in skeletal muscle is about 5-20 times higher than that in blood. About 7% of patients had mtDNA levels in muscle below 20% of the mean of the age-matched group, and about 10% of patients had muscle mtDNA levels 2- to 16-fold higher than the mean of the age-matched group. Patients with abnormal levels of mtDNA, either depletion or proliferation, had significant clinical manifestations characteristic of mitochondrial disease in addition to abnormal respiratory enzymes and mitochondrial cytopathies. Cardiomyopathy, lactic acidosis, abnormal brain MRI findings, hypotonia, developmental delay, seizures, and failure to thrive are general clinical pictures of patients with mtDNA depletion. The average age of patients with mtDNA depletion is 4.1 years, compared to 23.6 years in patients with mtDNA proliferation. Mutations in nuclear genes involved in mtDNA synthesis and deoxynucleotide pools are probably the cause of mtDNA depletion. Our results demonstrate that real time quantitative PCR is a valuable tool for molecular screening of mitochondrial diseases.