RESUMO
[This corrects the article DOI: 10.3892/ol.2017.6940.].
RESUMO
Radiotherapy resistance is an enduring major setback in lung cancer therapy, and is responsible for a large proportion of treatment failures. In previous years, cyclooxygenase-2 (COX-2) has frequently been reported to promote tumor occurrence and development, suggesting a potential role in radiotherapy resistance. To investigate whether COX-2 inhibitors can be applied in radiosensitization, an MTT assay was performed to examine cell viability after X-ray radiation in the presence or absence of the specific COX-2 inhibitor Celecoxib. Cell apoptosis and cell cycle changes were also detected through laser confocal scanning microcopy and flow cytometry. X-ray treatment only caused mild cell death in lung cancer A549 cells. However, combination treatment using celecoxib and X-ray radiation exhibited improved inhibitory effects and significantly suppressed cell proliferation. Therefore, COX-2 inhibitors combined with radiotherapy can counteract radiation-induced high COX-2 expression, demonstrating that celecoxib can function as a radiosensitizer of lung cancer cells. It is therefore reasonable to predict COX-2 inhibitors to be potential clinical radiotherapy synergists.
RESUMO
Previous studies on PTP4A3 mainly focused on tumor metastasis due to the close relationship between the overexpression of lung cancer and metastasis. However, the role of PTP4A3 in the proliferation of tumor still has remained unclear. To investigate the role of PTP4A3 in cell growth of lung cancer, we constructed PTP4A3-siRNA expressing lentivirus and infected human lung cancer H1299 cells, and then examined the inhibitory effect of PTP4A3 in vitro. The levels of PTP4A3 mRNA and protein in H1299 cells decreased after PTP4A3-siRNA lentivirus infection. The growth and colony formation of the infected cells were also inhibited, indicating that PTP4A3 gene is closely associated with the proliferation of H1299 cells. In addition, after PTP4A3 specific siRNA lentivirus infection, it was notable that whilst H1299 cells in G1 phase apparently reduced, both of H1299 cells in G2/M phase and the cell apoptosis increased significantly. This finding indicated the close relationship between PTP4A3 gene and apoptosis in the H1299 cells. These results come to their conclusion that PTP4A3 plays an important role in the growth of lung cancer cells. PTP4A3 may be considered as a valuable target for anti-tumor therapeutic strategies.
Assuntos
Proliferação de Células , Neoplasias Pulmonares/patologia , Proteínas de Neoplasias/metabolismo , Proteínas Tirosina Fosfatases/metabolismo , RNA Interferente Pequeno/genética , Apoptose , Sequência de Bases , Ciclo Celular , Linhagem Celular Tumoral , Primers do DNA , Citometria de Fluxo , Humanos , Proteínas de Neoplasias/genética , Proteínas Tirosina Fosfatases/genética , RNA Mensageiro/genéticaRESUMO
OBJECTIVE: To investigate the changes in expression profiles of angiomotin (Amot), schlafen5 (Slfn5), metalloproteinase-9 (MMP-9) and vascular endothelial cell growth factor (VEGF), which are genes associated with angiogenesis, tumor growth and invasion, after gene silencing of pleiotrophin (PTN) in human small cell lung cancer H446 cells. METHODS: PTN expression in H446 cells was determined by RT-PCR and Western blot. After constructing a lentiviral vector interfering PTN expression, it was packaged into virus in 293T cells. Then the virus was used to infect human small cell lung cancer H446 cells. The expressions of Amot, Slfn5, MMP-9 and VEGF were detected by RT-PCR in normal non-interference group, negative control group, PTN-interference group and group combining PTN interference and chemotherapy. RESULTS: The results of RT-PCR and Western blot test showed that PTN expression in H446 cells was high. The interference efficiency of constructed ShRNA sequences (GCAGCTGTGGATACTGCTGAA) targeting PTN was as high as 72.1% and 59.2% at the mRNA and protein levels, respectively, in H446 cells. Compared with the negative control group, the expressions of Slfn5 and MMP-9 in H446 cells were increased by 165.1% and 47.3%, while the ones of Amot and VEGF were down-regulated by 33.1% and 26.6%, respectively, after gene silencing of PTN. The changes of gene expression profile became more evident when chemotherapy was superimposed on PTN interference. CONCLUSION: Gene silencing of PTN using siRNA lentiviral expressing vector can influence the expression of proliferation and metastasis-related genes in human small cell lung cancer H446 cells.
Assuntos
Proteínas de Transporte/genética , Citocinas/genética , Neoplasias Pulmonares/metabolismo , Interferência de RNA , Carcinoma de Pequenas Células do Pulmão/metabolismo , Angiomotinas , Proteínas de Transporte/metabolismo , Proteínas de Ciclo Celular/metabolismo , Linhagem Celular Tumoral , Citocinas/metabolismo , Perfilação da Expressão Gênica , Regulação Neoplásica da Expressão Gênica , Vetores Genéticos , Humanos , Peptídeos e Proteínas de Sinalização Intercelular/metabolismo , Lentivirus/genética , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/patologia , Metaloproteinase 9 da Matriz/metabolismo , Proteínas de Membrana/metabolismo , Proteínas dos Microfilamentos , RNA Mensageiro/metabolismo , RNA Interferente Pequeno/genética , Carcinoma de Pequenas Células do Pulmão/genética , Carcinoma de Pequenas Células do Pulmão/patologia , Fator A de Crescimento do Endotélio Vascular/metabolismoRESUMO
OBJECTIVE: To detect the expression of B7-H3 and CD133 in human non-small cell lung cancer (NSCLC) specimens and lung benign lesions, and to evaluate the correlation between the 2 biomarkers and clinicopathologic features. METHODS: This is a case-control study of 102 tissue specimens collected from NSCLC participants undergoing thoracic surgery in the Second Affiliated Hospital of Soochow University, Suzhou, China, between January 2006 and December 2008. From the 102 patients, 25 adjacent non-cancer samples were verified pathologically as normal tissue (positive group), and 24 benign inflammatory lesion tissues were used as control (negative group). Specimens from 126 participants were stained immunohistochemically using Image-Pro Plus software, and the cell number was measured in each section. RESULTS: Of the 102 specimens, 71 expressed B7-H3, and 51 expressed CD133, higher than that in benign lesions (p<0.001) or non-cancer tissues (p<0.001). B7-H3 expression in squamous cell carcinoma (SCC) was significantly higher than those in adenocarcinoma (p=0.048), while CD133 expression in large cell lung carcinoma was higher than that in SCC (p=0.023). The mean number of tumor-infiltrating lymphocytes (TILs) in the B7-H3-positive group was lower than that in the B7-H3-negative group (p=0.026). The mean TILs in the CD133-positive group was significantly lower than that in CD133-negative group (p=0.029). We found that CD133 was related to tumor cell differentiation degree and CD133 expression was negatively correlated with B7-H3 expression. The CD133 positive or B7-H3 negative was associated with poor prognosis of NSCLC patients by Cox regression analysis. CONCLUSION: Both CD133 and B7-H3 might induce apoptosis of TILs in NSCLC and tumor evading host immune surveillance. Either CD133 or B7-H3 might be an independent risk factor of NSCLC participants.
Assuntos
Antígenos CD/biossíntese , Carcinoma Pulmonar de Células não Pequenas/genética , Glicoproteínas/biossíntese , Neoplasias Pulmonares/genética , Receptores Imunológicos/biossíntese , Antígeno AC133 , Adenocarcinoma/diagnóstico , Adenocarcinoma/genética , Adenocarcinoma/patologia , Adulto , Idoso , Antígenos CD/genética , Antígenos B7 , Biomarcadores/metabolismo , Carcinoma Pulmonar de Células não Pequenas/diagnóstico , Carcinoma Pulmonar de Células não Pequenas/patologia , Estudos de Casos e Controles , Feminino , Glicoproteínas/genética , Humanos , Pulmão/metabolismo , Pulmão/patologia , Neoplasias Pulmonares/diagnóstico , Neoplasias Pulmonares/patologia , Linfócitos do Interstício Tumoral/patologia , Masculino , Pessoa de Meia-Idade , Neoplasias de Células Escamosas/diagnóstico , Neoplasias de Células Escamosas/genética , Neoplasias de Células Escamosas/patologia , Peptídeos/genética , Prognóstico , Receptores Imunológicos/genéticaRESUMO
OBJECTIVE: To construct a siRNA lentiviral expressing vector targeting PTN (pleiotrophin) gene in human small cell lung cancer H446 cells and to study the RNAi effect on tumor growth and apoptosis. METHODS: Four pairs of small hairpin RNA specific for PTN were designed, synthesized and cloned into the Plvthm vector. The resulting lentiviral vector containing shPTN was confirmed by DNA sequencing named LV-shPTN. 293T cells were co-transfected with LV-shPTN, pRsv-REV, pMDlg-pRRE and pMD2G, then packed and purified slightly to produce lentivirus. After infecting H446 cells with recombinant lentivirus, PTN expression was determined by real-time RT-PCR and Western blot. Finally the selected lentiviral vector was packed and purified with best interference efficiency in large scale and the titer of virus was determined. The packed virus was used to infect H446 cells, and then the experiment was divided to a normal cell group, a negative control group, a PTN interference group, a chemotherapy group and a combined group with RNAi and chemotherapy. The effect on cell growth and apoptosis of H446 cells infected with high titer virus was analyzed using MTT and FCM. RESULTS: DNA sequencing analysis confirmed that shPTN lentiviral vector was successfully established as expected with interference efficiency as high as 72% and 59% at the mRNA and protein level. The titer of concentrated virus was 1 x 10(8) TU/ml. Compared to normal cells and control group, the cell viability of PTN interference group was decreased. Compared to RNAi group and chemotherapy group alone, the combined group with RNAi and chemotherapy showed less cell viability and a higher apoptotic rate in a concentration independent manner of the virus. CONCLUSION: PTN RNAi vector construction and H446 cell transfection effectively reduced the PTN transcription and expression, inhibited the growth and promoted the apoptosis of tumor cells. This method may become a useful therapeutic strategy for small cell lung cancer overexpressing PTN.
Assuntos
Apoptose/genética , Proteínas de Transporte/genética , Citocinas/genética , RNA Interferente Pequeno/genética , Linhagem Celular Tumoral , Marcação de Genes , Vetores Genéticos , Humanos , Lentivirus/genética , Neoplasias Pulmonares/genética , Interferência de RNA , RNA Mensageiro/genética , Carcinoma de Pequenas Células do Pulmão/genética , TransfecçãoRESUMO
OBJECTIVE: To investigate the diagnostic value of volumetric capnography in the assessment of asthmatic exacerbation. METHODS: Sixty-four patients with asthma exacerbation and 20 normal controls performed spirometry and volumetric capnography recording. The patients with asthma were divided into three sub-groups according to FEV1% pred (A: > 80%, B:40% - 80%, C: < 40%). RESULTS: FEV1% pred, FEV1/FVC, PEF% pred and MMEF% pred were (98 +/- 9)%, (80 +/- 6)%, (91 +/-15)% and (73 +/- 7)% respectively in the control group, but were (52 +/- 20)%, (50 +/- 10)%, (49 +/-16)% and (28 +/- 16)% respectively in the asthma group, the difference being significant (t = 6.93 - 13.29, all P < 0.01). Compared with the control group, dC2/DV [(19 +/- 6)%/L vs (31 +/- 8)%/L, t = 5. 09, P < 0.01] showed a decrease in the asthma group, dC3/DV [(2.9 +/- 1.2)%/L vs (1.0 +/- 0.4)%/L, t = -6. 14, P < 0.01] and SR23 [(16.8 +/- 10.6)% vs (3.3 +/-1.5)%, t = -6.54, P < 0.01] showed an increase in the asthma group compared to the control group, the difference being significant. Compared with that of the control group, dC2/DV [B:(17 +/-5)%/L, C: (13 +/-4)%/L] showed a decrease (t = -11.82, -16.75, all P < 0.01) and dC3/DV [B:(3.2 +/- 0.8)%/L, C:(4.1 +/-1.2)%/L] and SR23 [B:(17.2 +/- 3.5)%, C:(28.3 +/- 6.9)%] showed an increase (t = 2. 16-26.08, all P < 0.01) in asthma sub-groups B and C. For dC3/DV and SR23, the difference was significant between asthma sub-groups (t = 0.91 -22.18, all P < 0.05). In Pearson correlation analysis, dC2/DV (r = 0.69, 0.54, 0.59, 0.54, all P < 0.01) and dC3/DV (r = -0.62, -0.45, -0.69, -0.58, all P < 0.01) and SR23 (r = -0.75, -0.52, -0.74, -0.62, all P < 0.01) correlated with FEV1% pred, FEV1/FVC, PEF% pred and MMEF% pred. CONCLUSION: Volumetric capnography is a quantitative method for evaluating the severity of airflow obstruction and it can be performed easily during tidal breathing.
Assuntos
Asma/fisiopatologia , Capnografia , Adulto , Asma/diagnóstico , Estudos de Casos e Controles , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Testes de Função RespiratóriaRESUMO
BACKGROUND & OBJECTIVE: Up-regulation of a disintegrin and metalloprotease 8 (ADAM8) is correlated with genesis, progression, invasion, and metastasis of tumors. However, the expression of ADAM8, especially its correlation to epidermal growth factor receptor (EGFR), has seldom been reported in non-small cell lung cancer (NSCLC). This study was to investigate expressions of ADAM8 and EGFR in NSCLC, and to analyze their correlations. METHODS: Expressions of ADAM8 and EGFR in 49 specimens of NSCLC, 28 specimens of adjacent lung tissues and 13 specimens of benign lung tissues were detected using tissue microarray (TMA) and immunohistochemistry (IHC). The interrelationship between the two factors and their correlations to clinicopathologic features of NSCLC were analyzed. RESULTS: ADAM8 and EGFR were mainly expressed in the cytoplasm and on the cell membrane. The positive rates of ADAM8 and EGFR were significantly higher in NSCLC than in adjacent lung tissues and benign lung tissues (73.5% vs. 10.7% and 15.4%, 69.4% vs. 14.2% and 23.1%, P<0.01). The positive rates of ADAM8 and EGFR were slightly lower in squamous cell carcinoma than in adenocarcinoma (73.1% vs. 80.0%, 65.4% vs. 75.0%, P>0.05), while were significantly higher in stage N1-N3 NSCLC than in stage N0 (85.7% vs. 42.8%, 82.8 vs. 35.7%, P<0.01) and significantly higher in stage III-IV NSCLC than in stage I-II (90.0% vs. 62.1%, 90.0% vs. 65.5%, P<0.05). The expression of ADAM8 was positively correlated to EGFR (r=0.589, P<0.01), with a kappa value of 0.522. CONCLUSION: ADAM8 and EGFR are overexpressed in NSCLC, and their expressions are consistent.