Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 10 de 10
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Mol Cell Biochem ; 2024 May 15.
Artigo em Inglês | MEDLINE | ID: mdl-38748384

RESUMO

Axis inhibitor protein 1 (AXIN1) is a protein recognized for inhibiting tumor growth and is commonly involved in cancer development. In this study, we explored the potential molecular mechanisms that connect alternative splicing of AXIN1 to the metastasis of hepatocellular carcinoma (HCC). Transcriptome sequencing, RT‒PCR, qPCR and Western blotting were utilized to determine the expression levels of AXIN1 in human HCC tissues and HCC cells. The effects of the AXIN1 exon 9 alternative splice isoform and SRSF9 on the migration and invasion of HCC cells were assessed through wound healing and Transwell assays, respectively. The interaction between SRSF9 and AXIN1 was investigated using UV crosslink RNA immunoprecipitation, RNA pulldown, and RNA immunoprecipitation assays. Furthermore, the involvement of the AXIN1 isoform and SRSF9 in HCC metastasis was validated in a nude mouse model. AXIN1-L (exon 9 including) expression was downregulated, while AXIN1-S (exon 9 skipping) was upregulated in HCC. SRSF9 promotes the production of AXIN1-S by interacting with the sequence of exons 8 and 10 of AXIN1. AXIN1-S significantly promoted HCC cells migration and invasion by activating the Wnt pathway, while the opposite effects were observed for AXIN1-L. In vivo experiments demonstrated that AXIN1-L inhibited HCC metastasis, whereas SRSF9 promoted HCC metastasis in part by regulating the level of AXIN1-S. AXIN1, a tumor suppressor protein that targets the AXIN1/Wnt/ß-catenin signaling axis, may be a promising prognostic factor and a valuable therapeutic target for HCC.

2.
Acta Pharmacol Sin ; 44(11): 2307-2321, 2023 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-37402999

RESUMO

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.


Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismo
3.
Anal Biochem ; 537: 20-25, 2017 11 15.
Artigo em Inglês | MEDLINE | ID: mdl-28847591

RESUMO

Epithelial brush-border membrane vesicles (BBMVs) were isolated from the intestine of common carp and studied systematically by enzyme activity, transmission electron microscopy and immunoblotting. The uptake time course and the substrate concentration effect were assessed, and then, the ability of phlorizin and cytochalasin B to inhibit uptake was analyzed. The results show that sucrase, alkaline phosphatase and Na+-K+-ATPase activities in these vesicles were enriched 7.94-, 6.74- and 0.42-fold, respectively, indicating a relatively pure preparation of apical membrane with little basolateral contamination. The vesicular structure was in complete closure, as confirmed by electron microscopy. The presence of SGLT1 on the BBMVs was confirmed by Western blot analysis. In the time course experiment, the glucose uptake by BBMVs in Na+ medium displayed an initial accumulation (overshoot) at 5 min followed by a rapid return to equilibrium values at 60 min. Over the 2-NBDG concentration range selected, the external 2-NBDG concentration in NaSCN medium graphed as a curved line. Phlorizin and cytochalasin B had an obvious inhibitory effect on 2-NBDG transport in carp BBMVs, and the detected fluorescence intensity decreased. The inhibition rate in the 1000 µM group was the strongest at 64.18% and 63.61% of phlorizin and cytochalasin B, respectively, indicating the presence of carriers other than SGLT1. This study is the first to demonstrate that 2-NBDG can be used as a convenient and sensitive probe to detect glucose uptake in fish BBMVs. This technology will provide a convenient method to discover new effects and factors in glucose metabolism.


Assuntos
4-Cloro-7-nitrobenzofurazano/análogos & derivados , Desoxiglucose/análogos & derivados , Glucose/metabolismo , Mucosa Intestinal/metabolismo , Vesículas Secretórias/metabolismo , Espectrometria de Fluorescência , 4-Cloro-7-nitrobenzofurazano/química , 4-Cloro-7-nitrobenzofurazano/metabolismo , Animais , Transporte Biológico/efeitos dos fármacos , Carpas , Citocalasina B/farmacologia , Desoxiglucose/química , Desoxiglucose/metabolismo , Glucose/análise , Glucose/química , Microscopia Eletrônica de Transmissão , Florizina/farmacologia , Vesículas Secretórias/química , Vesículas Secretórias/enzimologia , Transportador 1 de Glucose-Sódio/metabolismo , Tiocianatos/química
4.
Zhongguo Zhong Yao Za Zhi ; 41(16): 3049-3054, 2016 Aug.
Artigo em Chinês | MEDLINE | ID: mdl-28920347

RESUMO

The dried stems of Schisandra henryi var. henryi were extracted with 95% ethanol and the extracts were further subjected to partition, affording the ethyl acetate extracts(EtOAc Extrs.).The EtOAc Extrs.were separated and purified with silica gel and octadecyl-silylated silica gel column chromatography, preparative HPLC and preparative TLC. Thirteen known compounds were obtained and identified by spectral methods including MS and NMR, all of which were elucidated as t-cadinol(1), cadinane-4ß,5α,10ß-triol(2), cadinane-5α, 10α-diol-2-ene(3), oxyphyllenodiols A(4), 1ß, 4ß-dihydroxyeudesman-11-ene(5), cyperusol C(6), (7R)-opposit-4(15)-ene-1ß,7-diol(7), dysodensiol E(8), epi-guaidiol A(9), aromadendrane-4ß,10ß-diol(10), tricyclohumuladiol(11), caryolane-1,9ß-diol(12), and guaidiol A(13). Compounds 3, 5-10, and 13 were separated from the genus for the first time, while compounds 1-13 were separated from this species for the first time.


Assuntos
Schisandra/química , Sesquiterpenos/isolamento & purificação , Cromatografia Líquida de Alta Pressão , Estrutura Molecular , Compostos Fitoquímicos/isolamento & purificação , Caules de Planta/química
5.
ScientificWorldJournal ; 2013: 718345, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-23935429

RESUMO

Based on the life cycle cost (LCC) approach, this paper presents an integral mathematical model and particle swarm optimization (PSO) algorithm for the heating system planning (HSP) problem. The proposed mathematical model minimizes the cost of heating system as the objective for a given life cycle time. For the particularity of HSP problem, the general particle swarm optimization algorithm was improved. An actual case study was calculated to check its feasibility in practical use. The results show that the improved particle swarm optimization (IPSO) algorithm can more preferably solve the HSP problem than PSO algorithm. Moreover, the results also present the potential to provide useful information when making decisions in the practical planning process. Therefore, it is believed that if this approach is applied correctly and in combination with other elements, it can become a powerful and effective optimization tool for HSP problem.


Assuntos
Algoritmos , Calefação , Técnicas de Planejamento , Estudos de Viabilidade
6.
Acta Crystallogr Sect E Struct Rep Online ; 69(Pt 5): o635, 2013 May 01.
Artigo em Inglês | MEDLINE | ID: mdl-23723802

RESUMO

In the pregnene fragment of the title compound, C27H38ClN, the three six-membered rings exhibit chair conformations and the five-membered ring has a distorted envelope form with the fused C atom not bearing a methyl group as the flap atom. The amino group is involved in the formation of an intra-molecular N-H⋯Cl hydrogen bond. The crystal packing exhibits no short inter-molecular contacts.

7.
Acta Crystallogr Sect E Struct Rep Online ; 68(Pt 6): o1586, 2012 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-22719397

RESUMO

There are two independent mol-ecules in the asymmetric unit of the title compound, C(30)H(44)O(5). They comprise a triterpenoid skeleton of five six-membered rings and a five-membered lactone ring. The five six-membered rings are all trans-fused. In both independent mol-ecules the D rings adopt a slightly distorted half-chair conformation due the presence of the lactone ring while the other four six-membered rings all adopt chair conformations. The characteristic carbon-carbon double bond of the oleanoic skeleton is absent. Inter-molecular O-H⋯O hydrogen bonds between the hy-droxy and carbonyl groups occur in the crystal structure.

8.
Acta Crystallogr Sect E Struct Rep Online ; 67(Pt 5): o1027, 2011 May 01.
Artigo em Inglês | MEDLINE | ID: mdl-21754358

RESUMO

The mol-ecule of title compound, C(39)H(56)O(5), contains five fused six-membered rings, four of which (rings A, B, D and E) adopt a chair conformation, while the other (ring C) has a half chair conformation. The acet-oxy and carb-oxy-benzyl groups occupy equatorial positions.

9.
J Asian Nat Prod Res ; 11(3): 236-42, 2009.
Artigo em Inglês | MEDLINE | ID: mdl-19408147

RESUMO

Six new triterpenes, 3beta,6beta-dihydroxyurs-12-en-27-oic acid (1), 3beta,6beta,24-trihydroxyurs-12-en-27-oic acid (2), 3beta,6beta,7alpha-trihydroxyurs-12-en-27-oic acid (3), 3beta-acetoxy-6beta-hydroxyurs-12-en-27-oic acid (4), 3beta,6beta,24-trihydroxyolean-12-en-27-oic acid (5), and 3beta,6beta,7alpha-trihydroxyolean-12-en-27-oic acid (6), were isolated from the rhizomes of Astilbe chinensis. Their structures were elucidated on the basis of 1D- and 2D-NMR analyses and HR-MS experiments. The isolated compounds exhibited significant cytotoxic activities against the SK-N-SH and HL-60 cell lines.


Assuntos
Medicamentos de Ervas Chinesas/isolamento & purificação , Medicamentos de Ervas Chinesas/química , Medicamentos de Ervas Chinesas/farmacologia , Células HL-60 , Humanos , Estrutura Molecular , Rizoma/química , Saxifragaceae/química , Triterpenos/química , Triterpenos/farmacologia
10.
J Asian Nat Prod Res ; 9(6-8): 637-42, 2007.
Artigo em Inglês | MEDLINE | ID: mdl-17943558

RESUMO

Two new hemiterpenes, utililactone (1) and epiutililactone (2), along with nine known compounds (3-11), were isolated from the leaves of Prinsepia utilis. Their structures were elucidated on the basis of spectroscopic data. The isolated compounds showed significant immunosuppressive activities.


Assuntos
Imunossupressores/isolamento & purificação , Rosaceae/química , Terpenos/isolamento & purificação , Imunossupressores/farmacologia , Espectroscopia de Ressonância Magnética , Espectrometria de Massas por Ionização por Electrospray , Espectrofotometria Infravermelho , Terpenos/farmacologia
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...