[Pulmonary co-infection with Nocardia otitidiscaviarum and Aspergillus: a case report].

Nocardia is a rarely encountered opportunistic gram-positive bacterium that exhibits marked invasiveness and dissemination. Typically, acquired through trauma or inhalation, this pathogen primarily affects immunocompromised individuals and is a potentially life-threatening risk in severe cases. Nocardia otitidiscaviarum is a particularly rare subtype of Nocardia infection, and the occurrence of concurrent Aspergillus infection is extremely rare. In cases where both infections manifest concomitantly, rapid and accurate diagnosis is essential to facilitate the subsequent selection of appropriate anti-infective interventions. This paper reported the diagnostic and therapeutic experience in managing a case of pulmonary co-infection with Nocardia otitidiscaviarum and Aspergillus. The patient presented with an acute onset, rapid progression, and early manifestation of respiratory failure. The diagnostic process included respiratory pathogen culture and bronchoscopy, which was supplemented with targeted next-generation sequencing (tNGS). These comprehensive diagnostic modalities led to the identification of pulmonary co-infection with Nocardia otitidiscaviarum and Aspergillus. After adjustment of the antibiotic regimen, the patient's condition improved rapidly, culminating in a timely discharge.

Associations and relative risks of pulmonary hypertension and lung diseases in individuals with methamphetamine use disorder.

OBJECTIVE: Methamphetamine causes considerable short- and long-term adverse health effects. Our aim was to assess the effects of methamphetamine use on pulmonary hypertension and lung diseases at the population level. METHODS: This population-based retrospective study used data from the Taiwan National Health Insurance Research Database between 2000 and 2018 that included 18,118 individuals with methamphetamine use disorder (MUD) and 90,590 matched participants of the same age and sex without substance use disorder as the non-exposed group. A conditional logistic regression model was used to estimate associations of methamphetamine use with pulmonary hypertension and lung diseases such as lung abscess, empyema, pneumonia, emphysema, pleurisy, pneumothorax, or pulmonary hemorrhage. Incidence rate ratios (IRRs) of pulmonary hypertension and hospitalization due to lung diseases were determined between the methamphetamine group and non-methamphetamine group using negative binomial regression models. RESULTS: During an 8-year observation period, 32 (0.2%) individuals with MUD and 66 (0.1%) non-methamphetamine participants suffered from pulmonary hypertension, and 2652 (14.6%) individuals with MUD and 6157 (6.8%) non-methamphetamine participants suffered from lung diseases. After adjusting for demographic characteristics and comorbidities, individuals with MUD were 1.78 times (95% confidence interval (CI) = 1.07-2.95) more likely to have pulmonary hypertension and 1.98 times (95% CI = 1.88-2.08) more likely to have a lung disease, especially emphysema, lung abscess, and pneumonia in descending order. Furthermore, compared to the non-methamphetamine group, the methamphetamine group was associated with higher risks of hospitalization caused by pulmonary hypertension and lung diseases. The respective IRRs were 2.79 and 1.67. Individuals with polysubstance use disorder were associated with higher risks of empyema, lung abscess, and pneumonia compared to individuals with MUD alone, with respective adjusted odds ratios of 2.96, 2.21, and 1.67. However, pulmonary hypertension and emphysema did not differ significantly between MUD individuals with or without polysubstance use disorder. CONCLUSIONS: Individuals with MUD were associated with higher risks of pulmonary hypertension and lung diseases. Clinicians need to ensure that a methamphetamine exposure history is obtained as part of the workup for these pulmonary diseases and provide timely management for this contributing factor.

Current Perspectives on Ligand-Binding Assay Practices in the Quantification of Circulating Therapeutic Proteins for Biosimilar Biological Product Development.

Bioanalysis in biosimilar biological product development (BPD) plays a critical role in demonstrating pharmacokinetic (PK) similarity across products. The 2018 FDA Bioanalytical Method Validation guidance for industry provides general principles in the development, validation, and conduct of bioanalytical assays. Given that the PK similarity assessment in BPD programs involves two or more non-identical products, there are additional considerations for bioanalytical methods. Here in, we provide our perspectives on the definition of (1) a single bioanalytical method in the context of BPD in supporting a PK similarity study, (2) bioanalytical method comparability during accuracy and precision experiments to determine the potential bias difference prior to assessing other validation parameters, and (3) bioanalytical method validations that support PK similarity assessments.

Retrospective Analysis of Bioanalytical Method Validation Approaches in Biosimilar Biological Product Development.

Development and validation of a bioanalytical method for biosimilar biological product development (BPD) can be challenging. It requires the development of a bioanalytical method that reliably and accurately measures both proposed biosimilar and reference products in a biological matrix. This survey summarizes the current state of bioanalysis in BPD. Bioanalytical data from 28 biosimilar biologic license applications submitted to U.S. Food and Drug Administration (FDA) up to December 2018 were analyzed. The aim of the analysis was to provide (i) a summary of the bioanalytical landscape for BPD, (ii) a cumulative review of bioanalytical method validation approaches to aid in understanding how a specific method was selected, and (iii) a summary of data regarding bioanalytical bias differences between products. Results show diversity of the bioanalytical approaches used, as well as the observed differences in bioanalytical bias. Our findings highlight the need for understanding the critical aspects of BPD bioanalysis and clarifying BPD bioanalytical best practices, which could help ensure consistent method validation approaches in the BPD community.

[A novel nanoparticle in treatment of staphylococcus aureus and pseudomonas aeruginosa biofilms].

Objective:To investigate CPC-nanoparticles of low concentrations in treatment of staphylococcus aureus and pseudomonas aeruginosa biofilms in vitro. Method: We established specific biofilms of staphylococcus aureus ATCC 25923 and pseudomonas aeruginosa ATCC 15692, and prepared CPC-nanoparticles and CPC micelle solutions of low concentrations(0.010%, 0.025% and 0.050%). AlamarBlue was used to test the viability of both planktonic staphylococcus aureus and pseudomonas aeruginosa and their biofilms after treatment for 5 minutes and 2 hours respectively in the bactericidal efficacy study.The interaction between CPC-nanoparticles and staphylococcus aureus and pseudomonas aeruginosa biofilms was observed by confocal laser scanning microscope(CLSM). Result: 0.010%, 0.025% and 0.050% CPC-nanoparticles and CPC-micelle solutions had significant bactericidal effect on planktonic staphylococcus aureus and pseudomonas aeruginosa after fiveminute exposure(P<0.05), and staphylococcus aureus and pseudomonas aeruginosa biofilms after both five-minute and two-hour treatments(P<0.05). In CLSM study, the size of staphylococcus aureus biofilms decreased, while dead bacteria of pseudomonas aeruginosa biofilms increased after two-hour treatment. Conclusion: CPC-nanoparticles had significant bactericidal effects on staphylococcus aureus and pseudomonas aeruginosa biofilms, which could be used in treatment of CRS.

[Clinical features and MYH9 gene variant in two Chinese siblings with Fechtner syndrome].

Objective: To summarize the clinical data and molecular characteristics of two siblings with Fechtner syndrome. Methods: A retrospective analysis was made on the clinical data, laboratory tests and genetic test results of two siblings with Fechtner syndrome in a family who were followed up in the Department of Nephrology, Children's Hospital Affiliated to Nanjing Medical University from April 2018 to August 2018. Results: Both siblings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant platelets and leucocyte inclusions were easily seen in peripheral blood smears and bone marrow cells, but the results of renal function, hearing and ophthalmologic examinations were normal. The father of the siblings presented with proteinuria, thrombocytopenia, and hearing loss. At the age of 26 years, he developed uremia and now requires hemodialysis. The renal biopsy of the elder sister suggested focal segmental glomerulosclerosis. Gene analysis showed that the siblings and their father MYH9 gene 25 exon c.3195_c.3215 delCGAGCTCCAGCCCAGATCGC (p.A1065_A1072 del) deletion mutation. The elder sister was treated with benazepril hydrochloride for 4 months and the proteinuria was improved. Her younger brother was given tacrolimus for 3 months, but the proteinuria did not improve significantly, then benazepril hydrochloride was given for 1 month and proteinuria improved. Conclusions: Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant platelets and leucocyte inclusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deletion mutation of p.A1065_A1072del is the second international report. Angiotensin-converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.

Smoke Sense Initiative Leverages Citizen Science to Address the Growing Wildfire-Related Public Health Problem.

Smoke Sense is a citizen science project with investigative, educational, and action-oriented objectives at the intersection of wildland fire smoke and public health. Participants engage with a smartphone application to explore current and forecast visualizations of air quality, learn about how to protect health from wildfire smoke, and record their smoke experiences, health symptoms, and behaviors taken to reduce their exposures to smoke. Through participation in the project, individuals engage in observing changes in their environment and recording changes in their health, thus facilitating progression on awareness of health effects of air pollution and adoption of desired health-promoting behaviors. Participants can also view what others are reporting. Data from the pilot season (1 August 2017 to 7 January 2018; 5,598 downloads) suggest that there is a clear demand for personally relevant data during wildfire episodes motivated by recognition of environmental hazard and the personal concern for health. However, while participants shared clear perceptions of the environmental hazard and health risks in general, they did not consistently recognize their own personal health risk. The engagement in health protective behavior was driven in response to symptoms rather than as preventive courses of action. We also observed clear differences in the adoption likelihood of various health protective behaviors attributed to barriers and perceived benefits of these actions. As users experience a greater number and severity of symptoms, the perceived benefits of taking health protective actions exceeded the costs associated with the barriers and thus increased adoption of those actions. Based on pilot season data, we summarize key insights which may improve current health risk communications in nudging individuals toward health protective behavior; there is a need to increase personal awareness of risk and compelling evidence that health protective behaviors are beneficial.

Transcriptomic analysis of hepatocellular carcinoma reveals molecular features of disease progression and tumor immune biology.

Hepatocellular carcinoma (HCC) develops in the context of chronic inflammatory liver disease and has an extremely poor prognosis. An immunosuppressive tumor microenvironment may contribute to therapeutic failure in metastatic HCC. Here, we identified unique molecular signatures pertaining to HCC disease progression and tumor immunity by analyzing genome-wide RNA-Seq data derived from HCC patient tumors and non-tumor cirrhotic tissues. Unsupervised clustering of gene expression data revealed a gradual suppression of local tumor immunity that coincided with disease progression, indicating an increasingly immunosuppressive tumor environment during HCC disease advancement. IHC examination of the spatial distribution of CD8+ T cells in tumors revealed distinct intra- and peri-tumoral subsets. Differential gene expression analysis revealed an 85-gene signature that was significantly upregulated in the peri-tumoral CD8+ T cell-excluded tumors. Notably, this signature was highly enriched with components of underlying extracellular matrix, fibrosis, and epithelial-mesenchymal transition (EMT). Further analysis condensed this signature to a core set of 23 genes that are associated with CD8+ T cell localization, and were prospectively validated in an independent cohort of HCC specimens. These findings suggest a potential association between elevated fibrosis, possibly modulated by TGF-ß, PDGFR, SHH or Notch pathway, and the T cell-excluded immune phenotype. Indeed, targeting fibrosis using a TGF-ß neutralizing antibody in the STAM™ model of murine HCC, we found that ameliorating the fibrotic environment could facilitate redistribution of CD8+ lymphocytes into tumors. Our results provide a strong rationale for utilizing immunotherapies in HCC earlier during treatment, potentially in combination with anti-fibrotic therapies.

[A multicenter study of reference intervals for 15 laboratory parameters in Chinese children].

Objective: To establish comprehensive laboratory reference intervals for Chinese children. Methods: This was a cross-sectional multicenter study. From June 2013 to December 2014, eligible healthy children aged from 6-month to 17-year were enrolled from 20 medical centers with informed consent. They were assessed by physical examination, questionnaire survey and abdominal ultrasound for eligibility. Fasting blood samples were collected and delivered to central laboratory. Measurements of 15 clinical laboratory parameters were performed, including estradiol (E2), testosterone(T), luteinizing hormone(LH), follicle-stimulating hormone(FSH), alanine transaminase(ALT), serum creatinine(Scr), cystatin C, immunoglobulin A(IgA), immunoglobulin G(IgG), immunoglobulin M(IgM), complement (C3, C4), alkaline phosphatase(ALP), uric acid(UA) and creatine kinase(CK). Reference intervals were established according to central 95% confidence intervals for reference population, stratified by age and sex. Results: In total, 2 259 children were enrolled. Finally, 1 648 children were eligible for this study, including 830 boys and 818 girls, at a mean age of 7.4 years. Age- and sex- specific reference intervals have been established for the parameters. Reference intervals of sex hormones increased gradually with age. Concentrations of ALT, cystatin C, ALP and CK were higher in children under 2 years old. Serum levels of sex hormones, creatinine, immunoglobin, CK, ALP and urea increased rapidly in adolescence, with significant sex difference. In addition, reference intervals were variable depending on assay methods. Concentrations of ALT detected by reagents with pyridoxal 5'-phosphate(PLP) were higher than those detected by reagents without PLP. Compared with enzymatic method, Jaffe assay always got higher results of serum creatinine, especially in children younger than 9 years old. Conclusion: This study established age- and sex- specific reference intervals, for 15 clinical laboratory parameters based on defined healthy children.

CRNDE impacts the proliferation of osteoclast by estrogen deficiency in postmenopausal osteoporosis.

OBJECTIVE: Bone loss is the main reason for postmenopausal osteoporosis, caused by estrogen deficiency. ERT (estrogen replacement therapy) has been demonstrated to protect bone loss efficiently. LncRNA (long non-coding RNA) has been proved to be important in different disease progression. We aimed at analyzing whether the lncRNAs influence the activity of osteoclasts and the progression of this disease. PATIENTS AND METHODS: RT-PCR (reverse transcriptase-polymerase chain reaction) was used to detect the expression of lncRNA CRNDE in OH (osteoclast from healthy people) and OP (osteoclast from patients with postmenopausal osteoporosis). MTT (methylthiazolyl tetrazolium) assay was used to detect the viability of the cells. The cell cycle and apoptosis rate in OH and OP were measured by the flow cytometry analysis. Western blot was used to analyze the possible related mechanism that CRNDE regulated the cells proliferation in postmenopausal osteoporosis. RESULTS: We found that the CRNDE was highly expressed in the osteoclast from patients with OP, compared with OH. We also found that overexpressing CRNDE increased the viability in OH whilst reducing CRNDE in OP decreased the viability. The cell cycle was arrested in G0/G1 phase and the apoptosis rate was improved in OP after transfection with siRNA. Moreover, CRNDE could impact the proliferation of osteoclasts by PI3K/Akt signaling pathway and estrogen could inhibit this proliferation. CONCLUSIONS: We found that lncRNA CRNDE was closely related to the postmenopausal osteoporosis with estrogen deficiency. CRNDE may be involved in the development and progression of postmenopausal osteoporosis in the absence of estrogen and become a potential target for treating.

[The clinical significance of EBV DNA analysis in nasopharyngeal carcinoma screening].

Objective:The aim of this study is to explore the value of EBV DNA monitor in high risk population of nasopharyngeal carcinoma (NPC). Method:A total of 366 cases of NPC at high risk were screened for 15 864 cases by ELISA, and 262 cases were randomly selected from low-risk groups. Fifty-eight nasopharyngeal carcinoma patients were also involved. EBV DNA was detected by PCR in 366 NPC high risk patients and followed up for 1 year. The clinical significance of EBV-DNA in screening NPC was compared. Result:The positive rate of EBV-DNA test was 12.0% in primary screening, EBV-DNA test in primary screening was 3.4% in low-risk population, and EBV-DNA in nasopharyngeal carcinoma was 91.4%, The positive rate of the three groups was statistically significant (P<0.01); After one year follow-up, a total of 267 cases returned visit. Positive rate of group A with continuous high risk was significantly higher than group B who was high risk at the first time of visit and non high risk at returned visit (P＜0.05). Conclusion:Quantitative analysis of plasma EBV DNA in high risk population can supply serological risk assessment. It can elevate the efficiency of screening and has significant application value for NPC high risk population.

[Clinical features and genetic variants of Dent disease in 10 children].

Objective: To summarize the clinical features and genetic analysis results of 10 children with Dent disease. Methods: The clinical data and gene test results of 10 boys aged from 8 months to 12 years with Dent disease diagnosed in Children's Hospital of Nanjing Medical University from January 2014 to July 2017 were analyzed retrospectively. Results: All patients had insidious onset, 5 cases were found to have proteinuria on routine urine examination after hospitalization duo to other diseases, 4 cases were admitted to hospital because increased foams in the urine, and 1 case was found to have proteinuria on health checkup. All cases presented with low molecular weight proteinuria, urine protein electrophoresis showed that the proportion of low molecular weight protein was greater than 50%, 7 cases had nephrotic-range proteinuria, but none had hypoproteinemia. Six cases had hypercalciuria, 3 cases had nephrocalcinosis, 1 case had nephrolithiasis, 2 cases had glomerular microscopic hematuria, in 1 case urine glucose wa weakly positive but blood glucose was normal. All patients had normal renal function, normal serum calcium, no hypophosphoremia and none had rickets. Genetic analysis results showed that 7 patients with variants in the CLCN5 gene, including 2 nonsense variants (p.R637X, p.Y143X), 3 missense variants (p.A540D, p.G135E, p.G703V), 1 deletion variant (exons 9, 10, 11, 12, 13, 1 missing), and 1 frameshift variant (p.T260Tfs*10). Three cases had missense variants of OCRL gene (p.I274T, p.I371T, p.F399S). Except for p.R637X and p.I274T, the other 8 cases had newly discovered variants. Five patients underwent a renal biopsy, the biopsy revealed focal global glomerulosclerosis in 3 patients, mild mesangial proliferative glomerulonephritis in 1 patient and renal minimal change in 1 patient. Mild focal tubular atrophy and interstitial fibrosis were noted in three cases. Mild segmental foot process effacement was noted under electron microscope in all five cases. Conclusions: All the children with Dent disease had insidious onset, low molecular weight proteinuria is the main clinical manifestation, most cases presented with nephrotic-range proteinuria, but there was no hypoalbuminemia, some cases were not associated with hypercalciuria. The pathogenic genes in most cases were CLCN5 and a few were OCRL. The types of genetic variation include missense variant, nonsense variant, deletion variant and frameshift variant. Although Dent disease is a renal tubular disease, renal biopsy suggests that most cases are associated with glomerular lesions.

Effect of combined epidural anaesthesia on tumor-infiltrating lymphocytes in lung adenocarcinoma: a prospective exploratory sub-analysis.

BACKGROUND: Regional anaesthesia may have advantages in preserving immune function. Tumor-infiltrating lymphocytes (TILs) are considered indicators of immune response in the tumor microenvironment and used as a prognostic marker in patients after cancer surgery. This study investigated the effects of combined epidural anaesthesia on the number of TILs in patients undergoing surgery for lung adenocarcinoma. METHODS: Patients undergoing radical resection for primary lung cancer were randomized to receive either combined epidural-general anaesthesia (Epi-GA) or general anaesthesia (GA) in an ongoing randomized controlled trial (ChiCTR-TRC-14004136). Excised adenocarcinoma specimens from patients enrolled between 1 June 2015 and 30 November 2015 were selected for immunohistochemical staining of CD8 and FOXP3 molecules. The numbers of positive lymphocytes were counted and expressed as the number of cells per mm2 tumor area. RESULTS: One hundred and twenty-eight patients were recruited and randomized; 64 patients were included in immunohistochemistry analysis (37 received Epi-GA vs. 27 received GA). The number of CD8+ T cells was higher in the Epi-GA group than in the GA group (median [interquartile range]: 292.8 [198.0-418.3] vs. 204.7 [131.1-305.8], P = 0.036); whereas the number of FOXP3+ T cells was less in the Epi-GA group than in the GA group (37.6 [14.7-92.3] vs. 99.8 [68.9-168.3], P < 0.001). CONCLUSIONS: For patients undergoing surgery for lung adenocarcinoma under general anesthesia, use of epidural anaesthesia increased CD8+ T cells infiltration but decreased FOXP3+ T cells accumulation in tumor tissues. Epidural anaesthesia may affect TILs in a manner that preserves immune function.

Risk-benefit perception of pregnancy among breast cancer survivors.

Helping breast cancer patients who desire a pregnancy after cancer treatment is a vital issue. Little is known about the complex context of the decision to become pregnant after breast cancer treatment. The purpose of this study was to understand the risk-benefit perception of choosing conception or contraception after treatment in Taiwan. We applied grounded theory to guide this exploratory qualitative study. Data were collected through in-depth interviews with 16 breast cancer patients. Pregnancy was addressed in the context of cancer as a potentially life-threatening diagnosis and its treatment. The verbatim transcriptions were analysed using constant comparative analysis and methods of open, axial and selective coding. The core theme that described the risk perception of pregnancy among patients with breast cancer after treatment focused on "reaching the balance of life." Seven dimensions of risk-benefit perception of pregnancy, including perceived health status, safety, expected gain, harm, loading, support and time were explored among women treated for breast cancer. We found that women treated for breast cancer applied risk-benefit perceptions to decide whether to become pregnant. Implementing contextual counselling could help to decrease perceived barriers to choose pregnancy and increase the quality of pregnancy care.

PBPK Modeling of the Effect of Reduced Kidney Function on the Pharmacokinetics of Drugs Excreted Renally by Organic Anion Transporters.

Altered pharmacokinetics (PK) in subjects with chronic kidney disease (CKD) may lead to dosing adjustment of certain drugs in subjects with CKD. It can be valuable to quantitatively predict PK in CKD for the management of drug dosing in these subjects. We developed physiologically based pharmacokinetic (PBPK) models of seven renally eliminated drugs: adefovir, avibactam, entecavir, famotidine, ganciclovir, oseltamivir carboxylate, and sitagliptin. These drugs are all substrates of renal organic anion transporters (OATs). Drug models verified using PK data from healthy subjects (HS) were coupled with physiological models representing CKD that incorporated prior knowledge of effects of CKD on hepatic and renal elimination. The models reasonably described clinically observed PK changes in subjects with CKD (compared to subjects with normal renal function), with predicted AUC changes within 50% of the observed changes. PBPK models can be used to prospectively predict PK of renally eliminated OAT substrates in subjects with CKD.

[Liver sinusoidal endothelial cells regulate adaptive immune tolerance in the liver].

Liver sinusoidal endothelial cells are a major group of nonparenchymal cells in the liver and are involved in immunological surveillance of the liver through the expression of various scavenger receptors and pattern recognition receptors. However, in case of several physiological states, viral infections, and tumor environment, liver sinusoidal endothelial cells maintain immune tolerance in the liver through various mechanisms and cause persistent viral infection and tumor metastasis. This article reviews the mechanisms of immune tolerance of CD4 + T cells and CD8 + T cells in the liver induced by liver sinusoidal endothelial cells.