Introduction of novel α1-hemoglobin gene mutation with transfusion-dependent phenotype.

OBJECTIVE AND IMPORTANCE: Thalassemia is the most frequently monogenetic disorders around the world that is inherited as a recessive single-gene disease, resulting from mutations in α- or ß-globin gene clusters. The aim of this report was to present a new insertional mutation in the α1 globin gene which causes transfusion-dependent anemia in α-thalassemic patients. CLINICAL PRESENTATION: Two 5-year-old girls with blood transfusion-dependent α-thalassemia anemia and another girl with moderate α-thalassemia have been presented among patients who have been referred to Hematology and Thalassemia Research Center, Dastgheib Hospital, Shiraz, Iran. They were not relatives. All children were stunted and pale; they were put on regular blood transfusion every 14-21 days. INTERVENTION: Sequencing of the ß-globin gene was normal in all cases and their parents; but, α-globin gene sequencing results were remarkable. An insertion of 21 base pairs (IVS II+3ins (+21nt)(+GACCCGGTCAACTTCAAGGTG) in the α1-globin gene was detected in all three cases and one of their parents. In two cases, this insertion was accompanied by MED deletion and in one child by POLY A1 mutation. MED deletion was detected by gap-PCR. CONCLUSION: This new 21 base pair insertion cannot affect blood parameters on its own, but can present as continuous blood transfusion-dependent α-thalassemia. Thus, it is important to take this point into account for detecting the carriers, like ß-thalassemia carriers, which can present as transfusion-dependent children in parents with α-thalassemia trait.

A Number of Cases in Iran Presenting with Coinheritance of Hemoglobin-H Disease and Beta-Thalassemia Minor.

Thalassemias are a group of inherited hematological disorders caused by defects in the synthesis of one or more of the hemoglobin (Hb) chains. The ß- and α-thalassemias are widespread throughout the Mediterranean region, the Middle East, and Southeast Asia including Iran. In this study, we report five patients known to carry a coinheritance of Hb H (ß4) disease and ß-thalassemia (ß-thal) minor. There is a high prevalence of consanguineous marriages in our population and the high rate of thalassemia determinants can cause coinheritance of α- and ß-thal. Therefore, it is of special interest to report coinheritance of Hb H disease and ß-thal minor which could lead to misdiagnosis.

Effectiveness of ß-thalassemia prenatal diagnosis in Southern Iran: a cohort study.

AIM: The aim of this study was to evaluate the effectiveness of prenatal diagnosis (PND) for the prevention of thalassemia in Southern Iran. METHODS: From 2004 to 2012 1346 couples with ß-thalassemia minor were referred to our center. Mutation analyses utilized different methods including polymerase chain reaction-based technique of amplification refractory mutation system (ARMS), Restriction Fragment Length Polymorphism Analysis of PCR-Amplified Fragments (PCR-RFLP) and Gel Electrophoresis and direct sequencing. Haplotype analysis of the ß-globin gene cluster was done routinely using the PCR-RFLP technique. RESULTS: Of the 1346 couples, 884 (66%) requested PND. They had a total of 985 pregnancies (954 singleton and 31 twin pregnancies): the 1016 fetuses underwent chorionic villus sampling (CVS). Thalassemia major was diagnosed in 266 cases (26.2%), and termination of pregnancy was requested by the parents in 264 of them (99%). Thalassemia trait was detected in 499 (49.1%) and 251 cases (24.7%) showed no ß-thalassemia mutations. There were three misdiagnoses (0.4%) (affected children diagnosed as carriers at PND). A unique pattern of thalassemia mutations was present in the study population, with IVS II-I (G→A), C36-37(-T), IVS I-5(G>C), -25bpdel (252-276), IVS I-110(G>A) and C44 (-C) being present in 62% of cases. CONCLUSION: The pattern of distribution of thalassemia mutations differs among ethnic groups within the same country.