Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 35
Filtrar
1.
Clin. transl. oncol. (Print) ; 24(6): 1073-1085, junio 2022.
Artigo em Inglês | IBECS | ID: ibc-203807

RESUMO

BackgroundMetastasis-related in colon cancer 1 (MACC1) is highly expressed in a variety of solid tumours, but its role in pancreatic cancer (PC) remains unknown. Interferon gamma (IFN-γ) affecting MACC1 expression was explored as the potential mechanism following its intervention.MethodsExpressions of MACC1 treated with IFN-γ gradient were confirmed by quantitative real-time PCR (qRT-PCR) and western blot (WB). Proliferation, migration, and invasion abilities of PC cells treated with IFN-γ were analysed by CCK8, EDU, colony formation, Transwell (with or without matrix gel) and wound-healing assays. Expression of antisense long non-coding RNA of MACC1, MACC1-AS1, and proteins of AKT/mTOR pathway, (pho-)AKT, and (pho-)mTOR was also assessed by qRT-PCR and WB. SiRNA kit and lentiviral fluid were conducted for transient expression of MACC1 and stable expression of MACC1-AS1, respectively. Rescue assays of cells overexpressing MACC1-AS1 and of cells silencing MACC1 were performed and cellular properties and proteins were assessed by the above-mentioned assays as well.ResultsIFN-γ inhibited MACC1 expression in a time- and dose-dependent manner; 100 ng/mL IFN-γ generally caused downregulation of most significant (p ≤ 0.05). In vitro experiments revealed that IFN-γ decreased cellular proliferation, migration, and invasion abilities and downregulated the expression of pho-AKT and pho-mTOR (p ≤ 0.05). Conversely, overexpression of MACC1-AS1 upregulated pho-AKT and pho-mTOR proteins, and reversed cellular properties (p ≤ 0.05). Rescue assays alleviated the above changes of pho-AKT/ mTOR and cellular properties.ConclusionIFN-γ affected PC properties by MACC1-AS1/MACC1 axis via AKT/mTOR signaling pathway, which provides novel insight for candidate targets for treating PC.


Assuntos
Humanos , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Neoplasias do Colo , Interferon gama , MicroRNAs/genética , Neoplasias Pancreáticas/patologia , Proto-Oncogenes , Transdução de Sinais/genética
2.
Clin Transl Oncol ; 24(6): 1073-1085, 2022 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-35037236

RESUMO

BACKGROUND: Metastasis-related in colon cancer 1 (MACC1) is highly expressed in a variety of solid tumours, but its role in pancreatic cancer (PC) remains unknown. Interferon gamma (IFN-γ) affecting MACC1 expression was explored as the potential mechanism following its intervention. METHODS: Expressions of MACC1 treated with IFN-γ gradient were confirmed by quantitative real-time PCR (qRT-PCR) and western blot (WB). Proliferation, migration, and invasion abilities of PC cells treated with IFN-γ were analysed by CCK8, EDU, colony formation, Transwell (with or without matrix gel) and wound-healing assays. Expression of antisense long non-coding RNA of MACC1, MACC1-AS1, and proteins of AKT/mTOR pathway, (pho-)AKT, and (pho-)mTOR was also assessed by qRT-PCR and WB. SiRNA kit and lentiviral fluid were conducted for transient expression of MACC1 and stable expression of MACC1-AS1, respectively. Rescue assays of cells overexpressing MACC1-AS1 and of cells silencing MACC1 were performed and cellular properties and proteins were assessed by the above-mentioned assays as well. RESULTS: IFN-γ inhibited MACC1 expression in a time- and dose-dependent manner; 100 ng/mL IFN-γ generally caused downregulation of most significant (p ≤ 0.05). In vitro experiments revealed that IFN-γ decreased cellular proliferation, migration, and invasion abilities and downregulated the expression of pho-AKT and pho-mTOR (p ≤ 0.05). Conversely, overexpression of MACC1-AS1 upregulated pho-AKT and pho-mTOR proteins, and reversed cellular properties (p ≤ 0.05). Rescue assays alleviated the above changes of pho-AKT/ mTOR and cellular properties. CONCLUSION: IFN-γ affected PC properties by MACC1-AS1/MACC1 axis via AKT/mTOR signaling pathway, which provides novel insight for candidate targets for treating PC.


Assuntos
Neoplasias do Colo , MicroRNAs , Neoplasias Pancreáticas , RNA Longo não Codificante , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Humanos , Interferon gama/farmacologia , MicroRNAs/genética , Neoplasias Pancreáticas/patologia , Proteínas Proto-Oncogênicas c-akt/metabolismo , RNA Longo não Codificante/genética , Transdução de Sinais/genética , Serina-Treonina Quinases TOR/metabolismo , Transativadores/genética , Transativadores/metabolismo , Neoplasias Pancreáticas
3.
J Physiol Pharmacol ; 72(1)2021 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-34272350

RESUMO

To determine whether curcumin (Cur) can treat mice with experimentally-induced colitis by regulating follicular helper T cells (Tfh) and follicular regulatory T cells (Tfr) by inhibiting interleukin (IL)-21. In this study, 40 male C57BL/6 mice were randomly grouped into four groups, i.e., normal, trinitrobenzene sulfonic acid (TNBS), TNBS + curcumin, and TNBS + anti-IL-21. Mice with experimental colitis were induced by 100 mg/kg TNBS. The mice in the TNBS + Cur group were treated with 100 mg/kg curcumin for seven days, and mice in the TNBS + anti-IL-21 group were treated with anti-IL-21 (150 µg/mouse) once per week, intraperitoneally, starting on the second day after establishing the experimental colitis model. On day eight, the therapeutic effect of curcumin was evaluated by colon mucosa damage index (CMDI), histological examination, and disease activity index (DAI). Furthermore, the number of CD4 + CXCR5 + PD-1 + Tfh and CD4 + CXCR5 + FoxP3 + Tfr cells were measured by flow cytometry. The mRNA and protein expression of IL-21, Bcl-6, FOXP3, ICOS, and PD-1 in colonic mucosa was detected by reverse transcription polymerase chain reaction and the Western blot technique. Compared with the TNBS group, the DAI, CMDI, histological score, the number of CD4 + CXCR5 + PD-1 + Tfh cells, the expression of IL-21, Bcl-6, ICOS, and PD-1 were significantly decreased in the TNBS + curcumin group and TNBS + anti-IL-21 group; body weight, number of CD4 + CXCR5 + FoxP3 + Tfr cells, and the expression of FoxP3 were observably elevated in the TNBS + curcumin group (all P < 0.05). Curcumin may have a potential therapeutic effect on mice with colitis treated experimentally through regulation of the balance of Tfh and Tfr cells via inhibiting the synthesis of IL-21.


Assuntos
Colite/tratamento farmacológico , Curcumina/farmacologia , Interleucinas/metabolismo , Mucosa Intestinal/efeitos dos fármacos , Animais , Colite/fisiopatologia , Modelos Animais de Doenças , Citometria de Fluxo , Mucosa Intestinal/patologia , Masculino , Camundongos , Camundongos Endogâmicos C57BL , RNA Mensageiro/metabolismo , Células T Auxiliares Foliculares/metabolismo , Linfócitos T Reguladores/metabolismo , Ácido Trinitrobenzenossulfônico
4.
J Biol Regul Homeost Agents ; 34(3): 961-968, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32519534

RESUMO

NIn recent years, the incidence of diabetic nephropathy (DN) is rising, and is one of the most important complications of diabetic patients. In this study, the role and regulatory mechanism of lncRNA OIP5-AS1 in the regulation of DN were investigated. Here, the expressions of lncRNA OIP5-AS1 and miR-30c-5p were detected by RT-qPCR. Western blot analysis was used to detect the protein expression of E-cadherin, N-cadherin, TGF-ß1, α-SMA. The relationship between OIP5-AS1 and miR-30c-5p was confirmed by dual luciferase reporter assay. The results showed that the expression of lncRNA OIP5-AS1 was increased in db/db DN mice kidney tissue and high glucose-stimulated HK2 cells. lncRNA OIP5-AS1 promoted epithelial-to-mesenchymal transition (EMT) and renal fibrosis in high glucose-stimulated HK2 cells. In addition, lncRNA OIP5-AS1 directly targets miR-30c-5p, and lncRNA OIP5-AS1 negatively regulated miR-30c-5p expression in high glucose-stimulated HK2 cells. More importantly, overexpression of miR-30c-5p attenuated the promoting effect of OIP5-AS1 on EMT and renal fibrosis in high glucose-stimulated HK2 cells. In conclusion, lncRNA OIP5-AS1 induces EMT and renal fibrosis in DN via binding to miR-30c-5p.


Assuntos
Nefropatias Diabéticas , Transição Epitelial-Mesenquimal , MicroRNAs/genética , RNA Longo não Codificante/genética , Animais , Linhagem Celular , Diabetes Mellitus , Nefropatias Diabéticas/genética , Fibrose , Humanos , Rim/patologia , Camundongos
5.
J Viral Hepat ; 24(6): 514-521, 2017 06.
Artigo em Inglês | MEDLINE | ID: mdl-28039902

RESUMO

Telbivudine, an FDA pregnancy category B drug, has been found to reduce hepatitis B virus (HBV) perinatal transmission with no safety concerns in infants aged up to 1 year. This study evaluated the long-term efficacy and safety of telbivudine in 214 infants born to 210 pregnant women with chronic hepatitis B infection who were treated with telbivudine during pregnancy (weeks 20-32 of gestation). The infants were followed for up to 5 years after birth. The efficacy endpoint was the rate of perinatal transmission, which was established by HBsAg and HBV DNA levels at 7 and 12 months. Safety endpoints included head circumference, weight, height, congenital abnormality and hospitalization rates. In addition, the Denver Developmental Screening Test was performed in 92 randomly selected infants. None of the 214 infants born to these women were infected with HBV, and all had effective serum hepatitis B surface antibody (HBsAb) levels. Compared with Chinese standard values, there were few differences in the infants' mean head circumference, weight, and height values. No birth defects were diagnosed, and the congenital abnormality rate was 0.934%. Serious adverse events requiring hospitalization occurred in 20 infants (9.35%). The qualified Denver Developmental Screening Test rate in 92 infants was 97.82%, which was comparable to a rate of 92% in normal Chinese children. Thus, treatment with telbivudine during the second or third trimesters of pregnancy safely blocked perinatal transmission of HBV. Infants born to telbivudine-treated mothers showed normal growth and development during long-term follow-up of up to 5 years.


Assuntos
Antivirais/efeitos adversos , Antivirais/uso terapêutico , Hepatite B Crônica/tratamento farmacológico , Transmissão Vertical de Doenças Infecciosas/prevenção & controle , Complicações Infecciosas na Gravidez/tratamento farmacológico , Timidina/análogos & derivados , Adulto , Pré-Escolar , Efeitos Colaterais e Reações Adversas Relacionados a Medicamentos/epidemiologia , Efeitos Colaterais e Reações Adversas Relacionados a Medicamentos/patologia , Feminino , Humanos , Lactente , Recém-Nascido , Masculino , Gravidez , Segundo Trimestre da Gravidez , Terceiro Trimestre da Gravidez , Estudos Prospectivos , Telbivudina , Timidina/efeitos adversos , Timidina/uso terapêutico , Resultado do Tratamento , Adulto Jovem
6.
Sci Rep ; 7: 39997, 2017 01 05.
Artigo em Inglês | MEDLINE | ID: mdl-28054672

RESUMO

We report the quantum efficiency of photoluminescence processes of Er optical centers as well as the thermal quenching mechanism in GaN epilayers prepared by metal-organic chemical vapor deposition. High resolution infrared spectroscopy and temperature dependence measurements of photoluminescence intensity from Er ions in GaN under resonant excitation excitations were performed. Data provide a picture of the thermal quenching processes and activation energy levels. By comparing the photoluminescence from Er ions in the epilayer with a reference sample of Er-doped SiO2, we find that the fraction of Er ions that emits photon at 1.54 µm upon a resonant optical excitation is approximately 68%. This result presents a significant step in the realization of GaN:Er epilayers as an optical gain medium at 1.54 µm.

7.
Eur Rev Med Pharmacol Sci ; 19(4): 573-7, 2015 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-25753873

RESUMO

OBJECTIVE: This study examined the usefulness of nasal Duo positive airway pressure (DuoPAP) in the treatment of very low birth weight preterm infants with neonatal respiratory distress syndrome (NRDS). PATIENTS AND METHODS: Eighty-five very low birth weight preterm infants with NRDS were randomly divided into two groups. Forty-five infants were treated with DuoPAP, while 40 infants were treated using nasal continuous positive airway pressure (nCPAP). The study outcomes were pH, PaCO, PaO2, oxygenation index (PaO2/FiO2), and the number of failure cases at 1, 12, and 24 hours after non-invasive respiratory support. RESULTS: At all studied time points, after non-invasive respiratory support, PaCO2, PaO2 and oxygenation index were significantly (p < 0.05) better in the nasal DuoPAP group compared with nasal CPAP group. In addition, rates of failure of assisted ventilation (respectively, 4.44% vs. 22.50%) and the occurrence of apnea (13.33% vs. 32.50%) were significantly (p < 0.05) better in the nasal DuoPAP group. Other parameters (such as duration of noninvasive ventilation, number of retinopathies of premature children, intraventricular hemorrhages, or periventricular leukomalacias) were comparable between both non-invasive regimen. CONCLUSIONS: Nasal DuoPAP better improves oxygenation, reduces CO2 retention, and diminishes the need for invasive mechanical ventilation and complications in the treatment of NRDS.


Assuntos
Pressão Positiva Contínua nas Vias Aéreas/métodos , Doenças do Prematuro/terapia , Recém-Nascido de muito Baixo Peso , Síndrome do Desconforto Respiratório do Recém-Nascido/terapia , Gasometria , Feminino , Humanos , Hipercapnia/terapia , Recém-Nascido , Recém-Nascido Prematuro , Masculino , Nariz , Resultado do Tratamento
8.
J Viral Hepat ; 22(9): 754-62, 2015 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-25641421

RESUMO

We evaluated the efficacy and safety of telbivudine (LdT, 600 mg/day) vs control patients (no treatment) in decreasing vertical transmission of HBV, in HBeAg-positive mothers (HBVDNA >6log(10) copies/mL). HBeAg-positive pregnant women either in the second or third trimester were recruited in a prospective, case-control, open-label study, at the Second Affiliated Hospital of the Southeast University, China (February 2008-December 2010). Efficacy (month 7: HBVDNA (+), HBsAg (+) infants) in either the overall group or the treated group and control group was analysed using student's t-test. Infants were followed for at least 1 year. 362 women received LdT (second trimester n = 257; third trimester n = 105) and 92 were untreated. Before delivery, the mean maternal HBVDNA was 2.73, 2.47, 3.34 and 7.94 log10 copies/mL in the overall, second and third trimester treated and control groups, respectively (P < 0.001). At birth, 11.8% of babies overall (43/365), 13.5% (35/259) of those treated in the second trimester, 7.5% of those treated in the third trimester (8/106) and 20.7% (19/92) of untreated infants were HBsAg positive. At month 7, none of the LdT-treated infant had detectable HBVDNA, while eight infants from control mothers were HBsAg positive. Vertical transmission was 0% in LdT treated and 9.3% (8/86) in the control groups (P < 0.001). No difference in the vertical transmission rate was found in mothers treated in the second or third trimester. LdT treatment was safe for mothers and infants, and no congenital deformities were reported.


Assuntos
Antivirais/efeitos adversos , Antivirais/uso terapêutico , Hepatite B/transmissão , Transmissão Vertical de Doenças Infecciosas/prevenção & controle , Timidina/análogos & derivados , Adulto , Estudos de Casos e Controles , China , DNA Viral/sangue , Feminino , Antígenos de Superfície da Hepatite B/sangue , Humanos , Lactente , Recém-Nascido , Estudos Longitudinais , Masculino , Gravidez , Estudos Prospectivos , Telbivudina , Timidina/efeitos adversos , Timidina/uso terapêutico , Resultado do Tratamento , Adulto Jovem
9.
Opt Express ; 21 Suppl 3: A475-84, 2013 May 06.
Artigo em Inglês | MEDLINE | ID: mdl-24104436

RESUMO

Since their inception, micro-size light emitting diode (µLED) arrays based on III-nitride semiconductors have emerged as a promising technology for a range of applications. This paper provides an overview on a decade progresses on realizing III-nitride µLED based high voltage single-chip AC/DC-LEDs without power converters to address the key compatibility issue between LEDs and AC power grid infrastructure; and high-resolution solid-state self-emissive microdisplays operating in an active driving scheme to address the need of high brightness, efficiency and robustness of microdisplays. These devices utilize the photonic integration approach by integrating µLED arrays on-chip. Other applications of nitride µLED arrays are also discussed.

10.
Transplant Proc ; 45(6): 2341-6, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-23953547

RESUMO

BACKGROUND AND OBJECTIVE: Magnetic resonance cholangiopancreatography (MRCP) is a noninvasive procedure to diagnose biliary complications. The aim of the present meta-analysis was to establish the overall diagnostic accuracy of MRCP to diagnose biliary complications post-orthotopic liver transplantation (OLT). METHODS: A systematic review was performed by searching electronic bibliographic databases prior to May 2012. Sensitivity, specificity, and other measures of the accuracy of MRCP for diagnosis of post-OLT were summarized using a random-effects or a fixed-effects model. Receiver operating characteristic curves were used to summarize overall test performance. RESULTS: Fourteen studies, which involved 892 subjects were eligible for the analysis. The summary estimates of sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, diagnostic odds ratio, and area under cure of MRCP for diagnosis of biliary complications were as follows: 0.95, 0.92, 10.23, 0.08, 206.59, and 0.979, respectively. The results for biliary strictures in four studies involving 177 subjects were 0.94, 0.95, 0.96, 0.09, 178.33, and 0.973 respectively. CONCLUSIONS: MRCP is a sensitive and specific technique to diagnose biliary complications.


Assuntos
Doenças Biliares/diagnóstico , Colangiopancreatografia por Ressonância Magnética , Transplante de Fígado/efeitos adversos , Área Sob a Curva , Doenças Biliares/etiologia , Humanos , Funções Verossimilhança , Razão de Chances , Valor Preditivo dos Testes , Curva ROC , Resultado do Tratamento
11.
Br J Neurosurg ; 27(4): 509-12, 2013 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-23384252

RESUMO

Occult intrasacral extradural cyst is a rare entity. Since little about this lesion has been reported in the literature, this study herein demonstrates by cases some of the clinical features and surgical treatment of occult intrasacral extradural cyst in children. A series of 4 children, 2 boys and 2 girls aged from 4 years and 6 months to 11 years, with occult intrasacral extradural cyst were reviewed. All patients underwent neurological examinations and magnetic resonance imaging. Of these 4 patients two had urinary incontinence in daytime, one frequent micturition, and one numb in saddle area. There were no abnormal findings on physical or laboratory examination. Whole excision of the cyst and ligation of the tract between the cyst and thecal sac were performed for all the patients. No complications such as cerebrospinal fluid leakage and infection were found after operation. All cases made complete recovery and have been asymptomatic at follow-up. The clinical and radiological features of occult intrasacral extradural cyst are characteristic in children. Magnetic resonance imaging is the choice of investigation and surgery is curative.


Assuntos
Cistos/cirurgia , Meningocele/cirurgia , Procedimentos Neurocirúrgicos/métodos , Sacro/cirurgia , Pré-Escolar , Cistos/diagnóstico , Cistos/patologia , Feminino , Humanos , Imageamento por Ressonância Magnética , Masculino , Meningocele/diagnóstico , Meningocele/patologia , Meningocele/fisiopatologia , Sacro/patologia , Resultado do Tratamento
12.
Intern Med J ; 43(5): 573-80, 2013 May.
Artigo em Inglês | MEDLINE | ID: mdl-22931360

RESUMO

BACKGROUND AND OBJECTIVE: The current results on the diagnostic accuracy of multidetector computed tomography (MDCT) in the detection of left atrial/left atrial appendage (LA/LAA) thrombus are conflicting. AIM: The aim of the present study was to determine the diagnostic accuracy of MDCT in LA/LAA thrombus with meta-analysis. METHODS: We searched for studies in PubMed, Embase and Cochrane library prior to May 2012 evaluating the accuracy of MDCT in detecting LA/LAA thrombus. Primary results were summarised using a random-effects model or a fixed-effects model. Receiver operating characteristic curves were used to summarise overall diagnosis accuracy. Metaregression and subgroup analysis were used to explore the potential sources of heterogeneity. RESULTS: A total of 10 studies with 1313 subjects was included in this meta-analysis. The summary estimates of sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, diagnostic odds ratio and the area under cure of overall analysis were 0.84, 0.93, 9.32, 0.21, 50.84 and 0.951, respectively, but all with significant heterogeneity (P < 0.01). Meta-regression and subgroup analysis showed that using electrocardiogram (ECG)-gating technique was a source of heterogeneity (P = 0.022); studies using ECG-gating technique had a higher summary sensitivity than studies with non-gating technique (0.97 vs 0.33). CONCLUSION: Our results suggest that MDCT is a potentially useful technique in the diagnosis of LA/LAA thrombus, especially when ECG gating is applied.


Assuntos
Apêndice Atrial/diagnóstico por imagem , Cardiopatias/diagnóstico por imagem , Tomografia Computadorizada Multidetectores/normas , Trombose/diagnóstico por imagem , Átrios do Coração/diagnóstico por imagem , Cardiopatias/epidemiologia , Humanos , Trombose/epidemiologia
13.
Epidemiol Infect ; 140(8): 1454-60, 2012 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-22000033

RESUMO

This study aimed to investigate the relationship between hepatitis B virus (HBV) covalently closed circular DNA (cccDNA) in the ovary and vertical transmission of HBV. HBV DNA and HBV cccDNA were assayed in the ovaries of 33 pregnant women who were positive for HBV DNA. The HBVM (HBV markers, including HBsAg, HBsAb, HBeAg, HBeAb, HBcAb) level and the HBV DNA content in peripheral blood of infants were measured. The overall positive rate of HBV DNA and HBV cccDNA in samples was 51·52% (17/33). The intrauterine infection rate of the infants was 12·12% (4/33). When HBV DNA and HBV cccDNA were both positive, the intrauterine infection rate of infants was significantly higher than when they were both negative (P<0·05). Levels of HBV cccDNA and the rate of positive samples were significantly higher in mothers with infants with intrauterine infection than in those without (P<0·01 and P<0·05, respectively). HBV can infect the human ovary and may transmit to the filial generation via the ovum.


Assuntos
DNA Circular/genética , DNA Viral/genética , Vírus da Hepatite B/genética , Hepatite B/transmissão , Transmissão Vertical de Doenças Infecciosas , Ovário/virologia , Adulto , DNA Viral/sangue , Feminino , Regulação Viral da Expressão Gênica/fisiologia , Humanos , Lactente , Recém-Nascido , Gravidez , Adulto Jovem
14.
Plant Dis ; 96(11): 1698, 2012 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-30727482

RESUMO

A potato tuber rot disease of unknown cause, affecting 5 to 15% of the potato tuber, was observed at Gansu Province of China in March 2010. Sunken, round, oval, or irregular lesions formed at the umbilicus or buds of potato tubers after 30 days of storage at 4°C. These lesions gradually expanded to form khaki, lavender sunken lesions ranging from 1 to 3 cm. Small black bodies were observed in the center of the lesions after 45 days. Twenty-six diseased tubers were collected and surface sterilized with 75% alcohol. Diseased tissue was then directly transferred to potato dextrose agar (PDA) medium for isolation of pathogenic fungi. Eight fungal isolates from disease tubers were obtained and pathogenicity was evaluated. Conidial suspensions (106 CFU/ml) of per isolate were sprayed on 20 potato tubers, respectively. These potato tubers were stabbed about 20 times with five wounds in a row along the tuber and maximum distance between each row. Wounds were made 2 mm deep and 0.5 mm in diameter with a no. 4 insect needle. Control tubers received water without conidia. The inoculated tubers were put in an incubator at 15°C after 72 h with relative humidity 100%. Assays were repeated three times. Typical symptoms of the disease were observed 14 days after inoculation. Pycnidia sharing the characteristics of the inoculated isolates were retrieved from new lesions after 6 weeks, whereas symptoms did not occur on control tubers. Eight isolates were cultured on PDA medium for 7 days at 20°C and then at 5°C for approximately 30 days to determine cultural and morphological characteristics. Pycnidia were black brown, spherical or oblate, scattered or clustered, and ranged from 82 to 210 × 64 to 175 µm. Conidia were unicellular and colorless, and 2.1 to 4.4 × 5.8 to 11.5 µm. Chlamydospores were spherical and 27 to 81 × 18 to 63 µm. The fungi shared morphological characteristics of P. foveata described in the literature. On oat medium (OA), yellow-green, needle-like crystals were formed. The growth rate of the pathogen on MA and OA was 1.0 cm/day. The pathogens were identified as P, foveata based on the symptoms, morphology, and growth rate (1, 2, 3). Genomic DNA was extracted with UNIQ-10 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 539-bp amplicon (GenBank Accession No. JQ804843) was 99% identical to the ITS sequence from P. foveata available from GenBank (GU237742). Management strategies for potato disease control must be adjusted for the presence and control of gangrene disease in Gansu Province. References: (1) G. H. Boerema et al. Page 220 in: Phoma Identification Manual. CABI Publishing, Wallingford, UK, 2004. (2) EPPO. Quarantine pests for Europe University Press, Cambridge. 865, 1997. (3) W. R. Stevenson et al. Page 25 in: Compendium of Potato Diseases, 2nd Edition. APS Press, St. Paul, MN, 2004.

15.
Genet Mol Res ; 10(3): 2034-7, 2011 Sep 12.
Artigo em Inglês | MEDLINE | ID: mdl-21948765

RESUMO

Nine polymorphic microsatellite loci were isolated, using tetranucleotide repeat oligonucleotide probes from an enriched DNA library of the globally "vulnerable" Saunders's gull (Larus saundersi), collected from the Yancheng coastal wetland, one of the three remaining breeding sites in China. Six breast muscle tissues and 16 blood samples from 22 gulls and eight eggshell membrane tissues were collected for this analysis. The number of alleles per locus ranged from 4 to 15, with a mean of 8.9. The observed and expected heterozygosities ranged from 0.58 to 0.89 and 0.58 to 0.9, with means of 0.77 and 0.81, respectively. No significant linkage disequilibrium and no divergence from Hardy-Weinberg equilibrium were detected among these loci. Based on Micro-Checker tests, no null alleles are present at any of the loci. The microsatellite loci described here will be valuable for exploring population genetic structure and for other relevant genetic studies of Saunders's gull.


Assuntos
Charadriiformes/genética , Repetições de Microssatélites/genética , Alelos , Animais , Sequência de Bases , Primers do DNA , Biblioteca Gênica , Desequilíbrio de Ligação , Polimorfismo Genético , Análise de Sequência de DNA
16.
Med Care ; 44(6): 552-9, 2006 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-16708004

RESUMO

BACKGROUND: Conventional wisdom suggests high-quality care for most patients with hip fractures is surgical fixation within 24 hours to reduce mortality and complications, although there is little evidence to support this standard. OBJECTIVES: We sought to determine the relationship between timing of hip fracture surgery and early mortality. DESIGN AND SUBJECTS: This was a retrospective population-based cohort study of 3981 patients with hip fractures>60 years of age that were admitted to hospitals in one Canadian health region from 1994-2000. METHODS: We collected sociodemographic, prefracture comorbidity, and postoperative complication data. Timing of surgery was classified as within 24 hours ("early surgery," the referent group for all analyses), 24-48 hours, and beyond 48 hours. Main outcome was in-hospital mortality. We used multivariable logistic regression methods, including adjustments with propensity scores and a validated hip fracture-specific mortality index, to determine the independent association between early versus later surgery and mortality. RESULTS: Median age of patients was 82 years, 71% were women, and 26% had >4 prefracture comorbidities. Unadjusted in-hospital mortality was 6%; it was 5% for those who had surgery within 24 hours or from 24 to 48 hours, 10% for surgery beyond 48 hours, and 21% for patients that did not have surgery. Compared with those who had surgery within 24 hours, there was no independent association between timing of surgery and in-hospital mortality (24-48 hours, adjusted odds ratio 0.89, 95% confidence interval 0.62-1.30, P=0.55; beyond 48 hours 1.30, 95% confidence interval 0.86-2.00], P=0.21). CONCLUSIONS: The timing of surgical fixation of hip fracture was not associated with early mortality in carefully adjusted analyses, and the use of "surgery within 24 hours" as a measure of high quality care may be inappropriate.


Assuntos
Fraturas do Quadril/mortalidade , Fraturas do Quadril/cirurgia , Mortalidade Hospitalar , Avaliação de Processos e Resultados em Cuidados de Saúde , Complicações Pós-Operatórias/mortalidade , Idoso , Idoso de 80 Anos ou mais , Estudos de Coortes , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Análise Multivariada , Análise de Regressão , Estudos Retrospectivos , Fatores Socioeconômicos , Fatores de Tempo
18.
Int J Mol Med ; 7(6): 625-9, 2001 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-11351276

RESUMO

Infection with Helicobater pylori (H. pylori) is associated with various stomach diseases such as chronic gastritis, peptic ulcer, and gastric carcinoma. In order to investigate the mechanisms of enhanced production of pepsinogen by H. pylori in cultured rat gastric cells that have the potential to produce pepsinogen, secretion and synthesis of pepsinogen in the cells exposed to H. pylori extract were determined by measuring the hydrolysis of hemoglobin. Various drugs were used to study the mechanisms of effects of H. pylori on the cells. Exposure of the gastric cells to H. pylori extract caused a significant increase in pepsinogen secretion into the culture medium within 30-180 min in a dose-dependent manner, accompanied by a significant increase in pepsinogen synthesis in the gastric cells after 60 min of incubation. Heat treatment of the H. pylori sonicate at 100 degrees C for 10 min completely abolished the stimulatory effect of H. pylori on pepsinogen secretion. 2',3'-Dideoxyadenosine (50 microM), a specific adenylate cyclase inhibitor, abolished the effect of H. pylori-induced pepsinogen secretion. Puromycin (10 microg/ml), a protein synthesis inhibitor, and nicorandil (0.1 mM), a specific intracellular calcium antagonist, reduced the H. pylori-induced pepsinogen secretion by 37% (p<0.01) and 25% (p<0.05), respectively. On the other hand, actinomycin D (1 microg/ml), an RNA synthesis inhibitor, did not affect the H. pylori-induced pepsinogen secretion. Consequently, dibutyryl cAMP potentially stimulated the pepsinogen secretion from gastric epithelial cells in a dose-dependent manner. H. pylori induces pepsinogen secretion and synthesis by gastric epithelial cells through an increase in the intracellular cAMP and mobilization of the intracellular calcium. In addition, H. pylori affects pepsinogen synthesis at the translational level.


Assuntos
AMP Cíclico/metabolismo , Mucosa Gástrica/metabolismo , Helicobacter pylori/metabolismo , Pepsinogênio A/metabolismo , Transdução de Sinais , Estômago/citologia , Animais , Antimetabólitos/farmacologia , Bucladesina/farmacologia , Cálcio/antagonistas & inibidores , Linhagem Celular , Sobrevivência Celular , Células Cultivadas , Dactinomicina/farmacologia , Didesoxiadenosina/farmacologia , Relação Dose-Resposta a Droga , Células Epiteliais/metabolismo , Hemoglobinas/metabolismo , Hidrólise , Microscopia de Contraste de Fase , Nicorandil/farmacologia , Biossíntese de Proteínas , Inibidores da Síntese de Proteínas/farmacologia , Puromicina/farmacologia , RNA Mensageiro/metabolismo , Ratos , Fatores de Tempo
19.
Am J Respir Crit Care Med ; 157(6 Pt 1): 1818-21, 1998 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-9620911

RESUMO

lnterleukin-4 (IL-4) has been shown to play a crucial role in the pathogenesis of allergic disease including bronchial asthma. In order to investigate the role of IL-4 in airway hyperreactivity, we investigated the effect of inhaled recombinant human IL-4 on airway responsiveness to methacholine and eosinophil numbers in induced sputum in eight patients with allergic asthma using a placebo-controlled study design. Our results demonstrated that in the control experiments receiving vehicle inhalation, methacholine PC20 values did not change nor did the numbers of eosinophils in sputum change from baseline values. In contrast, after IL-4 inhalation, methacholine PC20 fell from baseline (0.43 +/- 1.81 mg/mI) to 0.22 +/- 1.73 mg/mI (p < 0.01) at 24 h, and to 0.21 +/- 1. 74 mg/ml (p < 0.01) at 48 h. Accompanying this increased airway sensitivity was a significant eosinophilia in sputum. Our data indicated that IL-4 increases airway responsiveness by recruiting eosinophils into the airway in patients with allergic bronchial asthma.


Assuntos
Asma/fisiopatologia , Hiper-Reatividade Brônquica/fisiopatologia , Interleucina-4/administração & dosagem , Administração por Inalação , Adolescente , Adulto , Testes de Provocação Brônquica , Eosinófilos , Feminino , Humanos , Contagem de Leucócitos , Masculino , Cloreto de Metacolina , Pessoa de Meia-Idade , Proteínas Recombinantes/administração & dosagem , Escarro/citologia
20.
Phytomedicine ; 5(2): 83-6, 1998 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-23195758

RESUMO

Four tetracyclic oxindole alkaloids, rhynchophylline, isorhynchophylline, corynoxine and corynoxine B were isolated from the hooks of Uncaria macrophylla Wall. (Rubiaceae), that is a dominant plant widely distributed in Yunnan province. These compounds exhibited prolongation of the thiopental-induced hypnosis on oral administration in mice.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...